ID: 1167291144

View in Genome Browser
Species Human (GRCh38)
Location 19:48625868-48625890
Sequence CTGTGGGAAGGGAGGAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1731
Summary {0: 1, 1: 0, 2: 10, 3: 149, 4: 1571}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167291144_1167291155 7 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291155 19:48625898-48625920 ACCAGGAGCTGACCGGGAGCTGG 0: 1
1: 0
2: 0
3: 19
4: 210
1167291144_1167291162 22 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291162 19:48625913-48625935 GGAGCTGGGGCCACGGGCCTAGG 0: 1
1: 0
2: 8
3: 48
4: 636
1167291144_1167291152 0 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291152 19:48625891-48625913 AGGCCAGACCAGGAGCTGACCGG 0: 1
1: 0
2: 2
3: 15
4: 274
1167291144_1167291157 8 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291157 19:48625899-48625921 CCAGGAGCTGACCGGGAGCTGGG 0: 1
1: 0
2: 2
3: 33
4: 275
1167291144_1167291153 1 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291153 19:48625892-48625914 GGCCAGACCAGGAGCTGACCGGG 0: 1
1: 0
2: 2
3: 28
4: 277
1167291144_1167291158 9 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291158 19:48625900-48625922 CAGGAGCTGACCGGGAGCTGGGG 0: 1
1: 0
2: 3
3: 44
4: 421
1167291144_1167291159 15 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291159 19:48625906-48625928 CTGACCGGGAGCTGGGGCCACGG 0: 1
1: 0
2: 3
3: 27
4: 374
1167291144_1167291149 -10 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291149 19:48625881-48625903 CTTCCCACAGAGGCCAGACCAGG 0: 1
1: 0
2: 2
3: 22
4: 316
1167291144_1167291160 16 Left 1167291144 19:48625868-48625890 CCTTCTCTCCTCCCTTCCCACAG 0: 1
1: 0
2: 10
3: 149
4: 1571
Right 1167291160 19:48625907-48625929 TGACCGGGAGCTGGGGCCACGGG 0: 1
1: 0
2: 1
3: 26
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167291144 Original CRISPR CTGTGGGAAGGGAGGAGAGA AGG (reversed) Intronic
900186510 1:1335630-1335652 TTGCCGGATGGGAGGAGAGAAGG + Exonic
900300210 1:1973343-1973365 CTGTGGGGAGGGAGGAGGCAGGG + Intronic
900658269 1:3770792-3770814 CTGGGGGAGGGGAGGAGGAAGGG + Intronic
900658538 1:3772084-3772106 GTGTGGGTGGGGAGCAGAGAAGG - Intergenic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
900827382 1:4937664-4937686 CAGAGGGAAGGAAGGAGGGAGGG + Intergenic
900892326 1:5458446-5458468 AGGAGGGAAGGGAGGAGAGAGGG - Intergenic
900908633 1:5578402-5578424 CAGTGGGAGGGGGAGAGAGAGGG - Intergenic
900918561 1:5656184-5656206 GGGAGGGAAGGGAGGAGAGAAGG + Intergenic
900954132 1:5876324-5876346 CAGTGGTCAGGGAGGAGGGAGGG - Intronic
900954959 1:5881097-5881119 CTGAGGGTAGGCAGGAGTGAAGG - Intronic
901063995 1:6486117-6486139 CAGGAGGAAGGGAGGAGGGAAGG - Intronic
901798963 1:11696222-11696244 CTATGGGAAGGGGAGACAGAGGG - Intronic
901803279 1:11721635-11721657 TTGTGGGGAGGGAGCAGGGAGGG + Exonic
902167177 1:14581929-14581951 GTGTGGGAAGGGGAAAGAGAGGG - Intergenic
902497398 1:16883046-16883068 CTGTGGGATGTGACAAGAGAAGG + Intronic
902515452 1:16987274-16987296 CACAGGGAAGGGAGGACAGAGGG + Intronic
902533422 1:17105062-17105084 CTGTGGGGAGAGATGAGAGAGGG + Intronic
902689507 1:18101366-18101388 CGGTTGGAAGGGAGGAAGGAAGG - Intergenic
902700449 1:18168591-18168613 CTGAGTGAAAGAAGGAGAGAGGG - Intronic
903021772 1:20400018-20400040 CTGTAGGAAGGCAGGGGAGGAGG - Intergenic
903268700 1:22174359-22174381 CAGAAGGAAGGCAGGAGAGAGGG - Intergenic
903331692 1:22600003-22600025 CGGAGGGAAGGAAGGAGGGAAGG + Intronic
903423918 1:23238902-23238924 CTGAGGGCAGGCAGCAGAGACGG - Intergenic
903830294 1:26170395-26170417 CTGTAGGAATGGAAGTGAGAAGG - Intronic
903832257 1:26182409-26182431 CTGTGGGGTGGGAAGAGAGTGGG + Intronic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
904055748 1:27668877-27668899 CTGGGGGATGGGAGGAGTGTGGG - Intronic
904205984 1:28855541-28855563 CTGTGGGTGGAGGGGAGAGAGGG + Intronic
904284067 1:29442879-29442901 GTCTGGGAAGAGAGGAGAGGAGG - Intergenic
904325876 1:29727294-29727316 CTGGGGGAGGGGTGGAGGGAAGG + Intergenic
904325926 1:29727406-29727428 CTGGGGGAGGGGTGGAGGGAAGG + Intergenic
904326052 1:29727742-29727764 CTGAGGGAGGAGAGGAGGGAAGG + Intergenic
904353620 1:29924597-29924619 CTGAGGGAAGGAGGGAGGGAGGG - Intergenic
904433416 1:30479465-30479487 CTGGGGGAGGGGTGGAGGGAAGG - Intergenic
904433499 1:30479659-30479681 CTGGGGGAGGGGTGGAGGGAAGG - Intergenic
904469542 1:30727946-30727968 TGGTGGGAGGGGAGGAGAGGGGG - Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904795538 1:33053556-33053578 TTGGGGGAAGGGTGGAGAAAGGG + Intronic
904954278 1:34269976-34269998 CTTTGTGTGGGGAGGAGAGAAGG + Intergenic
905031044 1:34884924-34884946 CTGGGAGACAGGAGGAGAGAGGG - Intronic
905037121 1:34925511-34925533 CTGAGTGAGGGGAGGGGAGAGGG + Intronic
905102200 1:35534046-35534068 CTTTTGAAAAGGAGGAGAGAGGG - Intronic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
905179471 1:36157032-36157054 AGGAGGGAGGGGAGGAGAGAGGG + Intronic
905241781 1:36586282-36586304 TCGTGGGAGGGGAGGGGAGAAGG + Intergenic
905263679 1:36736589-36736611 CTGGGGGAGGGGAGGTGACAAGG + Intergenic
905282687 1:36859320-36859342 CTGTGGCAAGGGAGGAGAAGGGG - Intronic
905324646 1:37142343-37142365 GTAGGGTAAGGGAGGAGAGAGGG + Intergenic
905325983 1:37152280-37152302 AGGTGGGAAGAGAGGAGGGAAGG - Intergenic
905387814 1:37616285-37616307 AGGTGCGAAGGGAGGAGACAGGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905746386 1:40422137-40422159 CTGTGGAAAGGGGAGAGCGAGGG - Exonic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906343961 1:45003795-45003817 GTGTGGGGAGGGAGGACAGAAGG + Intronic
906553446 1:46687011-46687033 GTGGGAGATGGGAGGAGAGAGGG + Intronic
906748101 1:48235611-48235633 CTGGGGGTGGGGATGAGAGAGGG - Intronic
906974895 1:50559747-50559769 TTGTGAAGAGGGAGGAGAGAAGG - Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907389884 1:54151404-54151426 CTGTGGGTAGGGCTGGGAGAAGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907914751 1:58858457-58858479 CTGGGGGAAGGCAGCAGAGCAGG - Intergenic
908146238 1:61247614-61247636 ATGTGTGAGGGGAGGTGAGAGGG + Intronic
908697658 1:66862767-66862789 TAGTGGGAAGGGAGGTGTGATGG - Intronic
908763780 1:67536267-67536289 CGGTGGGCAGAGTGGAGAGAAGG + Intergenic
908994539 1:70135480-70135502 CTGTGGGAAGAGAAGAGAGCAGG + Intronic
909156404 1:72083308-72083330 GAGAAGGAAGGGAGGAGAGAGGG - Intronic
909393080 1:75136998-75137020 CAGGGGGAAGGGAGGGGAGGCGG + Intronic
909761892 1:79299055-79299077 CTGTGGGAATGTAAGATAGATGG - Intergenic
911258507 1:95660433-95660455 CTGTGGGCAAGTAGGAGAGTGGG - Intergenic
911509861 1:98798444-98798466 GTCTGGGAAGGGAAGAGGGAAGG - Intergenic
911522069 1:98941120-98941142 CTGTTGGAAGGGATAACAGAGGG + Intronic
911854537 1:102860016-102860038 GTGGGGGGAGGGGGGAGAGATGG + Intergenic
912230583 1:107788069-107788091 CAGAGGCATGGGAGGAGAGAAGG - Intronic
912451456 1:109770104-109770126 CTGTGGGAGGGCAGGGGAGAAGG + Intronic
912471076 1:109907289-109907311 AGGTGGGAAGGAAGGAGAAAAGG + Intergenic
912570891 1:110620201-110620223 CAGAGGGAAAGGAGAAGAGAGGG - Intronic
912604797 1:110978916-110978938 CTGGGGCTAGGGAGAAGAGAGGG + Intergenic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912970027 1:114272389-114272411 ATGTGGGGCGGGAGGAGAGCAGG + Intergenic
913248586 1:116892294-116892316 TTCTGGGATTGGAGGAGAGAAGG + Intergenic
913449493 1:118983557-118983579 TTGTGTGAAGGGAAGCGAGAGGG - Intronic
913988340 1:143585709-143585731 CAGACAGAAGGGAGGAGAGAAGG + Intergenic
914456104 1:147837830-147837852 TTGTGGGAAGAGAGCAGGGAGGG + Intergenic
914760747 1:150596043-150596065 CTGGGGGAGGGGAGGCGAGGGGG + Intergenic
914830139 1:151165255-151165277 CTGTTGGCAGGGTGAAGAGATGG - Exonic
914882246 1:151556393-151556415 GGGTGGGAAGGGAGGAGACGGGG - Intronic
915512700 1:156395099-156395121 CTGGGGGACGGCAGGTGAGAAGG + Intergenic
915516028 1:156413221-156413243 CTGTGGGAACAGAGAAGAGGAGG - Intronic
915597028 1:156901781-156901803 CTGAGGGAGAGGTGGAGAGAAGG + Intronic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
915826553 1:159084334-159084356 CTGTGTGAAAGGAGAAGGGAAGG - Intronic
915839493 1:159203037-159203059 GTGGGGGAAGGGAGCAGGGAGGG + Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
915954840 1:160213087-160213109 CTGGAGGAAGGCAGGAGATAGGG - Intronic
915979513 1:160411144-160411166 ATGAGGCCAGGGAGGAGAGAGGG - Intronic
916076469 1:161202631-161202653 CTCTGGCGAGGGAGGGGAGAGGG + Intronic
916228453 1:162514596-162514618 TTGTAGGAAGGAAGGAAAGAAGG + Intronic
916301867 1:163284775-163284797 GGGAGGGAGGGGAGGAGAGAGGG - Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916493849 1:165327215-165327237 CTGTGGGAAAGGACCACAGAGGG + Intronic
916628310 1:166583738-166583760 ATGTGGGAAAAGAGGAGACATGG - Intergenic
916652338 1:166843844-166843866 CTGAGGAAAGGGAGGAGGGCAGG + Intronic
916686537 1:167152325-167152347 CGGTGGGAAGGGAGAAGGGCTGG - Intergenic
916764097 1:167843687-167843709 CTGTGGGAAAGGATGTGTGAGGG - Intronic
916956256 1:169838927-169838949 GTAGGGGGAGGGAGGAGAGATGG - Intronic
917249219 1:173038971-173038993 ATGTGGGCAGGGTGGAGAAAAGG + Intergenic
917441405 1:175072237-175072259 GTGTGGGAAGGTGGGAGGGAGGG - Intronic
917591467 1:176480761-176480783 CTGAGGGAGGGGTGGGGAGAGGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
917718830 1:177765386-177765408 GTGGGGGAAGGGGGGAGGGATGG + Intergenic
918042595 1:180922220-180922242 CAGGGAGAAGGGAGCAGAGAAGG + Intronic
918069066 1:181121806-181121828 CTGTGACAAGGGAGTAGACAAGG + Intergenic
918095542 1:181330959-181330981 TTGTGGGAAGGGAGGAGGGCAGG + Intergenic
918146261 1:181758624-181758646 GTGTGGTACAGGAGGAGAGATGG - Intronic
918514435 1:185346924-185346946 CTCTGGGCAGGGAGGGGAGGTGG - Intergenic
918866943 1:189913734-189913756 ATGAGGAGAGGGAGGAGAGAGGG - Intergenic
919051193 1:192513410-192513432 CAGTGGGAAGGAAGGAAGGAAGG + Intergenic
919321013 1:196038339-196038361 GTGGGGGGAGGGAGGAGGGATGG - Intergenic
919481086 1:198090672-198090694 GAGTGAGAAGGGAGGTGAGAAGG + Intergenic
919674864 1:200371279-200371301 CTCTGGGAAGTGAGGACAGAAGG + Intergenic
919742312 1:200988545-200988567 CTGTGGGAGGGCGGGAGGGAGGG + Intronic
919756167 1:201067414-201067436 AGGTGGAGAGGGAGGAGAGAGGG - Intronic
919757614 1:201075616-201075638 CTGTATGGAGGGAGGATAGAGGG + Intronic
919803796 1:201368929-201368951 ACCTGGGAAGGGAGGACAGAGGG - Intronic
919935181 1:202246228-202246250 ATGGGGGATGGAAGGAGAGAGGG - Intronic
919966385 1:202530749-202530771 CTGGGAGTAGGGAGAAGAGATGG - Intronic
920118142 1:203635924-203635946 CTGTGGGTGGGGAGCAGTGAGGG - Intronic
920202261 1:204266786-204266808 GTGAGGGATGAGAGGAGAGAGGG - Intronic
920430430 1:205915199-205915221 GGGAAGGAAGGGAGGAGAGAGGG + Intronic
920460415 1:206135339-206135361 ATGAGGTAGGGGAGGAGAGAAGG + Intergenic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920518179 1:206602207-206602229 CTGTGGAAAGAGTGGAGGGAAGG - Intronic
920573571 1:207037444-207037466 CTGTGTGGATGGAAGAGAGAAGG - Intronic
920624642 1:207585113-207585135 CTGAGGGAGGGGTGGAGGGAAGG + Intronic
920738764 1:208560232-208560254 CTGTGGGAAGGAGGCAGGGAGGG - Intergenic
920804544 1:209220131-209220153 CTGTGCGTAGGGAGGAGACTGGG + Intergenic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
921367389 1:214386585-214386607 CTTAGGAAAGGGAGGAGAAAAGG + Intronic
921430345 1:215058160-215058182 CTGTGAGAAGGACAGAGAGATGG - Intronic
921524547 1:216201040-216201062 CTGTCGGAAGGAAGGAAGGAAGG - Intronic
921538893 1:216387835-216387857 ATGGGGGAAGGGCAGAGAGAGGG - Intronic
921585383 1:216940473-216940495 GGGTGAGAAGGGAGAAGAGAAGG + Intronic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
922191788 1:223325148-223325170 TTGGGGGAAGACAGGAGAGAAGG - Intronic
922233296 1:223704639-223704661 CTGAGGGAAGGGAAATGAGAAGG + Intronic
922251118 1:223849379-223849401 CCAAGGGAAGGGAGGAGAAAAGG + Intergenic
922331614 1:224581886-224581908 CTGTGGGAAGCCTGGAGAGCAGG + Intronic
922413479 1:225397800-225397822 CTTTGGGAGGCGAAGAGAGACGG + Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922620938 1:226987726-226987748 CTGTAAGAAGGGAGGTGGGAGGG + Intergenic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923047491 1:230366297-230366319 CTGTCTGTAGGGATGAGAGATGG + Intronic
923218412 1:231871298-231871320 ATGTGGGAAGAGAGAATAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923429341 1:233905369-233905391 CGGCGGGAAGGGAGGAGCGCGGG + Intronic
923552187 1:234972960-234972982 CTGCGGGAAGGAAGGAGCAATGG - Intergenic
923629397 1:235640004-235640026 CTGTGGGAGGGGAGCAGTGAGGG + Intronic
923909217 1:238421181-238421203 CTGTTGGAAGGAAGGAAGGAAGG + Intergenic
924144415 1:241059221-241059243 GTGTGGAAAGCGAGAAGAGAAGG - Intronic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063173574 10:3531684-3531706 GTGTGGAAAGAAAGGAGAGACGG - Intergenic
1063414540 10:5862849-5862871 CAGTTGGAAGGGAGAAGGGAAGG + Intronic
1063486919 10:6428768-6428790 CGGAGGGATGGGAAGAGAGAAGG + Intronic
1063501964 10:6563430-6563452 CAGTGACAAGGTAGGAGAGATGG - Intronic
1063929009 10:11010395-11010417 CAGTTGGAAAGGAAGAGAGAAGG - Intronic
1063971499 10:11384350-11384372 CTGTGGCAAGGCAGTGGAGAAGG + Intergenic
1064014471 10:11761845-11761867 ATGAGGGAAGGAAGGAGAGAGGG - Intronic
1064119034 10:12603526-12603548 CTGGAGGAAGGCAGGTGAGAAGG - Intronic
1064152216 10:12874591-12874613 CTCTGCAAAGGGAGAAGAGAAGG - Intergenic
1064168656 10:13008462-13008484 CTATGGGATGGGAGTAGTGATGG + Intronic
1064593777 10:16922344-16922366 CAGTAAGAAGGTAGGAGAGAGGG - Intronic
1064717154 10:18188315-18188337 CTCTGGGAAGGAAGGCAAGAAGG - Intronic
1065012601 10:21432893-21432915 CTCTGGGAAGGGACTAGAGAGGG + Intergenic
1065110812 10:22437824-22437846 CTGGGGGAGGCGTGGAGAGAGGG + Intronic
1065204532 10:23344286-23344308 GTGGGGGAAGGGGGAAGAGATGG + Intronic
1065205610 10:23355183-23355205 CTGTGGCCACAGAGGAGAGAAGG - Intergenic
1065253105 10:23836916-23836938 CTGTGGGAAGGAAGGAAGGGAGG + Intronic
1065874332 10:29983861-29983883 AGGAGGGAAGGAAGGAGAGAAGG + Intergenic
1066502425 10:36007085-36007107 GTGGGGAAAGGGAGGAGGGAGGG - Intergenic
1066566351 10:36725606-36725628 CTGTGAGAAGGAAGGAGGAAGGG - Intergenic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1067095236 10:43295273-43295295 TTGTGGGAGGTGAGGAGTGAAGG - Intergenic
1067250751 10:44584683-44584705 ATGTGGGAAAAGAGGAGAGGGGG - Intergenic
1067323858 10:45247872-45247894 GGGTGGGAGAGGAGGAGAGAAGG - Intergenic
1067576483 10:47411986-47412008 CTCAGGGACAGGAGGAGAGATGG - Intergenic
1067748317 10:48953080-48953102 CAGGGGGAAGTGAGGAGAGGCGG - Intronic
1067757756 10:49017876-49017898 CTTTGGGAGGGGAGGATATATGG - Exonic
1067811673 10:49432427-49432449 CTGAAGGAAAGGAGGAGAGGAGG + Intergenic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1069448281 10:68494494-68494516 AGGAGGGAGGGGAGGAGAGACGG + Intronic
1069557308 10:69406778-69406800 CTGGGGCAAGAGAAGAGAGAAGG - Intronic
1069646333 10:70001265-70001287 GTGGGGGAAGGGTGGATAGAGGG - Intergenic
1069688468 10:70334468-70334490 TTCTGGGAAGGGAGGAGACGGGG - Intronic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069963753 10:72096280-72096302 CCGTGGTGAGGGAGGAGTGAGGG + Intronic
1070380933 10:75879581-75879603 CTGGGGGAAGGGAAGAGACTGGG + Intronic
1070535449 10:77373980-77374002 CTGTGGGAAGGGTGGATAATGGG + Intronic
1070579711 10:77710407-77710429 CTGTGGGGAGGGAGGTGCGGGGG - Intergenic
1070627591 10:78062325-78062347 CTGTCGGAAGGTAGGGGATAGGG - Intergenic
1070666880 10:78351244-78351266 CTTCGGGAAGGGTGGGGAGAGGG - Intergenic
1071188272 10:83069514-83069536 AAGTGGGAAAGGAAGAGAGAGGG + Intergenic
1071215374 10:83394405-83394427 CTGTGTGCTGGGAAGAGAGAGGG - Intergenic
1071268286 10:83983784-83983806 CTGTGGGAGGTGGGAAGAGAGGG - Intergenic
1071346777 10:84701008-84701030 GGGTGGGAAGGGAGAACAGAGGG + Intergenic
1071444840 10:85736064-85736086 GAGAGGGAAGGAAGGAGAGAAGG + Intronic
1071444876 10:85736214-85736236 AGGAGGGAAGGAAGGAGAGAAGG + Intronic
1071444881 10:85736234-85736256 AGGAGGGAAGGAAGGAGAGAAGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072009463 10:91290830-91290852 CTCTGGGGAGGGCGGAGAGTGGG - Intergenic
1072024779 10:91444133-91444155 GTGTGGGAAGGGATAAGAAAGGG - Intronic
1072149390 10:92673557-92673579 GGGTGGGAAAGGATGAGAGAAGG + Intergenic
1072347817 10:94526085-94526107 GGCTGGGAAGGGTGGAGAGAAGG - Intronic
1072474819 10:95750209-95750231 CTGTGGGAAAGGAGCGGGGATGG + Intronic
1072531166 10:96320828-96320850 AGGTGGGAACGGGGGAGAGAGGG + Intronic
1072710601 10:97713650-97713672 GGGTGGGAAGGGTGGAGAGCTGG + Intronic
1073015445 10:100395465-100395487 CTTTGGAAGGGGAGGAGAAAGGG - Intergenic
1073042556 10:100617511-100617533 CTCTGGGAAGGGAGTGGAGATGG + Intergenic
1073086123 10:100890329-100890351 GGGTGGAAAGGAAGGAGAGAGGG - Intergenic
1073447577 10:103590572-103590594 CAGAGGGAGGGGAGGAGAGGAGG + Exonic
1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG + Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1073954092 10:108847938-108847960 GAGAGGGAAGGAAGGAGAGAGGG + Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074217698 10:111403832-111403854 GAGGGGGAAGGGGGGAGAGAGGG - Intergenic
1074246700 10:111701463-111701485 ACGTGGGAAGTGATGAGAGAAGG - Intergenic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1074558407 10:114513054-114513076 CTGGGGAAAGGGAGGATGGATGG - Intronic
1074561931 10:114542760-114542782 CTCTGGGGAGGGATGAGGGATGG + Intronic
1074720206 10:116257362-116257384 CCGAGGGCAGGGAGGATAGAGGG - Intronic
1074756315 10:116627023-116627045 CTGTGGGTAGGGGTCAGAGAGGG + Intronic
1074883384 10:117675931-117675953 CTGGGGGTAGGGAGGAGAGAAGG - Intergenic
1074924464 10:118053253-118053275 CTGTTGGAAGGAAGGAAGGAAGG - Intergenic
1074974342 10:118568068-118568090 CTGTGGGAAGGAAGGAACAAAGG - Intergenic
1075345764 10:121680988-121681010 CTGGGATAGGGGAGGAGAGAAGG + Intergenic
1075499249 10:122957239-122957261 GAGAGGGAAAGGAGGAGAGAAGG - Intronic
1075559512 10:123458413-123458435 AGGAAGGAAGGGAGGAGAGATGG - Intergenic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076083172 10:127601704-127601726 CTGTAGGATGAGAGGAGAGTTGG - Intergenic
1076108988 10:127846650-127846672 CTGGGAGAAGGGAGGTGGGATGG - Intergenic
1076312494 10:129518475-129518497 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076312507 10:129518500-129518522 CAGGGGGAAGGGAGGGGAGGAGG - Intronic
1076327985 10:129643227-129643249 CTGTGGGGTGGGAGGAGGGCTGG + Intronic
1076540374 10:131210675-131210697 CTGAGGGAAGGGCGGAGATGAGG - Intronic
1076619518 10:131778344-131778366 GGGTGGGCAGGGAGGAGAGATGG + Intergenic
1076637829 10:131893919-131893941 CTGAAGGAAGGGAAGAAAGATGG - Intergenic
1076662154 10:132062867-132062889 GTCTGGGAAGGGAGGAGAAAAGG + Intergenic
1076835067 10:133016884-133016906 CAGCGGGAAGGAAGGAGGGAAGG - Intergenic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077077745 11:708992-709014 CTGTGGGGAGGGGGGTGGGATGG - Intronic
1077101332 11:823864-823886 CTGGGGGACGGGAGGGGAGGAGG + Intronic
1077109453 11:855635-855657 GTGAGGGAACGGAGGACAGATGG + Intronic
1077160435 11:1110113-1110135 CTGGGGGGAGGGCGGAGTGAGGG - Intergenic
1077208118 11:1353750-1353772 GTGTGAGAAGGACGGAGAGAAGG - Intergenic
1077544179 11:3161954-3161976 CTGTGAGCAAGGAGGGGAGAGGG + Intronic
1077868618 11:6243013-6243035 GTGTGGGGAGGGTGGAGAGAGGG - Intronic
1078013463 11:7592260-7592282 TTGTGGGCAGACAGGAGAGAAGG - Intronic
1078049385 11:7948519-7948541 CTGTGGAAGGGAAGGAAAGAAGG - Intergenic
1078759108 11:14237410-14237432 CATGGGGGAGGGAGGAGAGAAGG + Intronic
1078887629 11:15520271-15520293 CAGAGGAGAGGGAGGAGAGAAGG - Intergenic
1078923626 11:15854388-15854410 AGGAGGGAAGGAAGGAGAGAAGG + Intergenic
1078923640 11:15854437-15854459 AGGAGGGAAGGAAGGAGAGAAGG + Intergenic
1079085079 11:17439588-17439610 CAGTGGGAGGGGGAGAGAGACGG - Intronic
1079144298 11:17837138-17837160 GTGTGGTAAGGAAGAAGAGAAGG - Intronic
1079377745 11:19908856-19908878 CTGTGGGGTGGGAGTAGAGGAGG + Intronic
1080231860 11:30025468-30025490 CTAAGTGAAGGAAGGAGAGATGG - Intergenic
1080232918 11:30037844-30037866 AGGAGGGAAAGGAGGAGAGAAGG + Intergenic
1080271202 11:30452390-30452412 CTGTGGGAATGGAGAAGGTATGG - Intronic
1080384047 11:31800019-31800041 CTCTGGTCTGGGAGGAGAGATGG - Intronic
1080557404 11:33430086-33430108 GTGGAGGGAGGGAGGAGAGAGGG - Intergenic
1080645980 11:34187847-34187869 CTGAGGGAAGGAGGGAGGGATGG + Intronic
1081398087 11:42611116-42611138 CTGTGAGAGGGAAAGAGAGAAGG + Intergenic
1081409127 11:42735015-42735037 CTTTGCAGAGGGAGGAGAGAAGG + Intergenic
1081430408 11:42970480-42970502 CTCTTGAAAGGGAGGAAAGAAGG - Intergenic
1081479467 11:43471595-43471617 CCGTGGGAAGGGATGAAAGCTGG - Intronic
1081535027 11:43990034-43990056 CTCTGGGAAGGGAGGAGTAAGGG - Intergenic
1081660943 11:44888010-44888032 ATGTGGGAAGGGAGGAGGTGAGG + Intronic
1081668433 11:44930035-44930057 GTGTGGGGAGGTAGGAGCGAGGG - Exonic
1081674448 11:44960419-44960441 CCCTGGGGAGGCAGGAGAGAGGG - Intergenic
1081748987 11:45494352-45494374 CTGTGGGCAGATATGAGAGAAGG + Intergenic
1082565813 11:54676804-54676826 GTGGGGGAAGGGAGGGGAAAGGG - Intergenic
1082767274 11:57179927-57179949 GGGTGGGAAGGGGGGAGGGAGGG + Intergenic
1082786925 11:57322420-57322442 CTGCGGGAGGGAGGGAGAGAGGG - Intronic
1082864407 11:57885590-57885612 CTGTGAGAAGGGTGGAGAAGAGG - Intergenic
1082950248 11:58807140-58807162 GTGTGGGATGGGGGCAGAGAAGG + Intergenic
1082988702 11:59189060-59189082 CTGCTGGAAAGGAGGAGAGTAGG + Intronic
1083224640 11:61277017-61277039 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083445026 11:62702633-62702655 CTGAGAGAAGGGAGGAGGGCAGG - Intronic
1083545497 11:63546037-63546059 CTTAGGGGAGGCAGGAGAGAGGG + Intronic
1083682169 11:64356706-64356728 CTCTGGGAAGAAAGGAGAGCAGG + Intronic
1083783936 11:64933267-64933289 GTGGGGGAAGGGAGAAGAGCAGG + Intronic
1083829829 11:65224675-65224697 AGGGGGGAAGGAAGGAGAGAAGG - Intergenic
1083850024 11:65359943-65359965 CTGTAGGGAGGCAGGGGAGAAGG - Intergenic
1084224967 11:67710399-67710421 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
1084262786 11:67990242-67990264 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
1084305941 11:68283353-68283375 CTACTGGAAGGGAGGAGAAAAGG - Intergenic
1084406825 11:68979109-68979131 CTGTGGGAAGGAAAGGGGGAGGG + Intergenic
1084410161 11:69002260-69002282 ATGTGGGAAGGGTGGGGTGAAGG - Intergenic
1084441806 11:69178939-69178961 AGCAGGGAAGGGAGGAGAGAGGG + Intergenic
1084445299 11:69200303-69200325 GTATGGCAAGGGAGGAGTGAGGG + Intergenic
1084465215 11:69319394-69319416 CTGGGCAAGGGGAGGAGAGAAGG - Intronic
1084810604 11:71608863-71608885 ATGAGGGCAGAGAGGAGAGATGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085073551 11:73571231-73571253 CTGTGGGGAGGGGGGGGGGAGGG - Intronic
1085265937 11:75238105-75238127 AAGTGGGAAGAGAGGAGAGGAGG + Intergenic
1085266174 11:75239446-75239468 CAGGGGGTAGGGAAGAGAGAGGG + Intergenic
1085326305 11:75609344-75609366 CTGTGGGAAAGGAGGAGTTAGGG + Intronic
1085331611 11:75656653-75656675 GGGTGGGTAGGGAAGAGAGAGGG - Intronic
1086417742 11:86606075-86606097 CTTTGGGGAGGGAGGAGGGGTGG - Intronic
1087501191 11:98956082-98956104 CTATGGGAAGGAAGGAAGGATGG - Intergenic
1087535465 11:99439220-99439242 CTGTTGGAGGAGAGCAGAGAAGG + Intronic
1087712988 11:101575900-101575922 CTATGAAAAGGGAGAAGAGAAGG + Intronic
1088063376 11:105685112-105685134 CTTTAGGAAGGAAGGAAAGAAGG + Intronic
1088333235 11:108674876-108674898 CTGGGGGAAGTAAGGAGAGTGGG - Intronic
1088733668 11:112707338-112707360 CTGTGGGTAGGGAGTAGGGGTGG - Intergenic
1088859922 11:113790085-113790107 CTGAGGGCGGGAAGGAGAGAAGG - Intergenic
1088920598 11:114257708-114257730 CTGAGGGAGGGGAGGGGAGCTGG - Intergenic
1088996876 11:115008380-115008402 CTGTTGTAAGGAAGGAGAGAGGG - Intergenic
1089133031 11:116226964-116226986 CAGTGGGAAAGGAGGAGGGGCGG + Intergenic
1089411995 11:118252095-118252117 CTCTGGGAAGGAAGGAGGGAGGG - Intronic
1089506919 11:118969536-118969558 AGGAGGGAAGGGAGGAGGGAGGG + Intergenic
1089539501 11:119181488-119181510 CTGGGGGAGGTGGGGAGAGAGGG + Intronic
1089602700 11:119625110-119625132 CCCTGGGACGGGAGGAGGGAGGG + Intronic
1089649663 11:119904495-119904517 CTTTGGGAGGAGAGGAGAGGAGG + Intergenic
1089689279 11:120176939-120176961 CTGTGGGAAGGGATGGGGCAGGG - Intronic
1090311557 11:125745844-125745866 CTCTAGGAATGGAGAAGAGAGGG - Intergenic
1090331885 11:125939104-125939126 TTCTGGGAATGGAGGAGGGAAGG - Intergenic
1090415483 11:126537417-126537439 TTGTGGGGAGGAAGCAGAGAAGG + Intronic
1090726439 11:129531145-129531167 TTGGGGGAAGGGAGAAGAAATGG + Intergenic
1090977466 11:131689714-131689736 CTGCGGTATGGGAGGGGAGATGG - Intronic
1091105613 11:132916794-132916816 CTCTGTGAAGGGAGGAGGCAGGG - Intronic
1091131099 11:133147957-133147979 GGGTGGGGAGGGATGAGAGATGG - Intronic
1091161569 11:133426566-133426588 CTGGGGCAGAGGAGGAGAGAGGG - Intronic
1091437715 12:485861-485883 CTCAGAGAAGGGAGGTGAGAAGG + Intronic
1091454728 12:598524-598546 CTGTGAGAAATGAGGAGAAAGGG + Intronic
1091701668 12:2667359-2667381 CTGGGGGAAGGGAGACCAGAGGG + Intronic
1091860506 12:3777236-3777258 CAGAGGGAAGGAAGGAGGGAAGG + Intergenic
1091933596 12:4416986-4417008 CAGTTGGAGGGAAGGAGAGAGGG + Intergenic
1091946960 12:4555161-4555183 TGGTGGGGAGGGAGGAGAGGTGG - Intronic
1091983891 12:4891812-4891834 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1092258133 12:6938103-6938125 CAGAGGGAAGGAAGGAAAGAGGG - Intronic
1092462580 12:8698702-8698724 TTGTGGGAAGGGGGGGGAGGGGG - Intronic
1092531217 12:9347186-9347208 ATGGAGGAAGGGAGAAGAGATGG - Intergenic
1092564345 12:9648541-9648563 CTTTTGGAAGGGCGGAGAGAGGG + Intergenic
1092968903 12:13672578-13672600 CTGTGGGCAGGGAGGATGGCAGG - Intronic
1093310809 12:17581198-17581220 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1093827938 12:23717731-23717753 CTGTGGTCAAGGTGGAGAGAAGG + Intronic
1094038056 12:26091537-26091559 CTGTGGCCATGGAAGAGAGATGG - Intergenic
1094088209 12:26617686-26617708 AGGAGGGAAGGAAGGAGAGAAGG + Intronic
1094174082 12:27524117-27524139 CTGCAGGGAGGGAGGAGAGAAGG + Intronic
1094702342 12:32881918-32881940 CTGTGGGAAAGGAGGCTAGCAGG + Intronic
1094797296 12:33990375-33990397 CGGTGGGGAGCGGGGAGAGAAGG - Intergenic
1095110035 12:38284374-38284396 CGGTGGGGAGGGGGGAGAGGAGG - Intergenic
1095206383 12:39443762-39443784 CTCCGGGGAGGGAGGAGGGAGGG - Intergenic
1095228523 12:39704926-39704948 GTGGGGGGAGGGAGGAGGGATGG + Intronic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1096001437 12:48133874-48133896 ATGTAGGATGGGAGGATAGAAGG + Intronic
1096036239 12:48473565-48473587 GTGAGGGAAGGGAGGGGAGGAGG + Exonic
1096271083 12:50167023-50167045 CTGTGGGAAGGGCCGAGGGCCGG - Intronic
1096271217 12:50167475-50167497 AAGTGGGCCGGGAGGAGAGATGG - Intronic
1096518849 12:52172994-52173016 CTGGGGGCGGGGAGGAGAGCAGG - Intronic
1096588844 12:52643958-52643980 CTGCGGTGAGAGAGGAGAGAAGG + Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096772736 12:53946351-53946373 CAGTGGGAAGGGAAGAGGCAAGG - Exonic
1096778182 12:53976342-53976364 CTCTGGGAAGGGAGCAGGGTGGG - Exonic
1097108004 12:56636381-56636403 GGGTGGGGAGGGAGGAGGGAAGG + Intronic
1097195151 12:57238984-57239006 GTGTGGGGAGCGAGGAGAGATGG - Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097250639 12:57630812-57630834 AGGTGGGAAGTGAGGACAGAAGG - Intronic
1097386987 12:58962021-58962043 CTGGGGGGAGTGGGGAGAGAGGG - Intergenic
1097568553 12:61301562-61301584 CTGTGGTAAGAGATAAGAGATGG - Intergenic
1097823137 12:64147540-64147562 CGGTGGGATGGGAGGACACAGGG - Exonic
1098230031 12:68363846-68363868 GTGAGAGAAGGGAGGACAGATGG - Intergenic
1098246272 12:68521495-68521517 TTGTGGGAAGATTGGAGAGACGG - Intergenic
1098567882 12:71956301-71956323 CTGTGGGAAGGGATTACACATGG + Intronic
1098886977 12:75970134-75970156 CTGTGGTCTGGAAGGAGAGAAGG - Intergenic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1099914761 12:88878383-88878405 CTGTAGGAAGGAAGCAGAGCAGG + Intergenic
1100145700 12:91674953-91674975 CTGTGGGAAGGGGAGTGGGAAGG - Intergenic
1100363043 12:93895428-93895450 CTGTGGGAAGTGGGGAGGGGAGG - Intergenic
1100373806 12:93993877-93993899 CTGTGAGAGGTGAGGAGGGAAGG + Intergenic
1100607785 12:96165972-96165994 CTGGGGGGTGGGAGGACAGACGG - Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100721359 12:97362328-97362350 CTGTGAGCAGGAAGGAGGGATGG + Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1102232099 12:111269785-111269807 CTTTGGGGAAAGAGGAGAGAGGG - Intronic
1102360030 12:112277710-112277732 CTGTGTGATGTGAGAAGAGATGG - Intronic
1102626473 12:114239401-114239423 CTGTGGGAAATTAGGAGAGCAGG + Intergenic
1102764719 12:115422911-115422933 AAGGAGGAAGGGAGGAGAGAAGG + Intergenic
1102825125 12:115942585-115942607 CTGCCAGAAGGGAGGGGAGAGGG + Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1102991893 12:117321936-117321958 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
1102991899 12:117321956-117321978 AGGAGGGAAGGAAGGAGAGAGGG - Intronic
1102991905 12:117321976-117321998 GGGAGGGAAGGAAGGAGAGAAGG - Intronic
1102991910 12:117321996-117322018 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
1102991921 12:117322036-117322058 AGGAGGGAAGGAAGGAGAGAAGG - Intronic
1102991939 12:117322100-117322122 AAAGGGGAAGGGAGGAGAGAGGG - Intronic
1102991962 12:117322194-117322216 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
1102992025 12:117322412-117322434 GTGAGGAAAGGGAGGAGGGAAGG - Intronic
1102992109 12:117322725-117322747 GGGAGGGAAGGGAGGAAAGAGGG - Intronic
1103021423 12:117537819-117537841 CTGAGGGAAGGAAGGAGCTAAGG + Intronic
1103131964 12:118477067-118477089 GGGAGGGAAGGAAGGAGAGAAGG - Intergenic
1103223187 12:119263710-119263732 CTCTGGGAAGTGGGGAGAAAAGG - Intergenic
1103223255 12:119264420-119264442 CTCTGGGAAGTGGGGAGAAAAGG + Intergenic
1103279164 12:119740832-119740854 CTCAAGGAAGGGAGGAGGGATGG + Intronic
1103445089 12:120989199-120989221 CTGTGGGACGGGAGTAGACTTGG + Intronic
1103578189 12:121894407-121894429 CTGTGGGAAGGAGGGTGTGAAGG + Intronic
1103933676 12:124463887-124463909 CGGCAGGAAGGGAGGGGAGATGG - Intronic
1103938611 12:124489806-124489828 CTGGGGGCAGAGAGGAGAAAGGG + Intronic
1104436654 12:128762200-128762222 CTGTGAGGAGAGATGAGAGAAGG + Intergenic
1104463264 12:128971616-128971638 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463274 12:128971635-128971657 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463284 12:128971654-128971676 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463294 12:128971673-128971695 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463304 12:128971692-128971714 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463314 12:128971711-128971733 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104463333 12:128971749-128971771 AGGGGGGAAGGGAGGAGGGAGGG - Intronic
1104510010 12:129368711-129368733 CTGTTGGTAAGGAGGAAAGAGGG - Intronic
1104568806 12:129907588-129907610 CTCTGGGAAGAGATGAGAAAGGG - Intergenic
1104637598 12:130447798-130447820 CAGATGGAAGGGAGGAGACATGG + Intronic
1104668789 12:130666757-130666779 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
1104668892 12:130667117-130667139 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
1104688752 12:130808208-130808230 ATGTGGGAAGAGAGGAGTGGGGG - Intronic
1105269092 13:18854214-18854236 CTGAGGCAAGTCAGGAGAGAGGG - Intergenic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105427002 13:20302478-20302500 AGGAGGGAAGGCAGGAGAGATGG + Intergenic
1105573059 13:21622390-21622412 CTTTATGAAGGGAGAAGAGATGG + Intergenic
1105620333 13:22060425-22060447 ATGAGGCACGGGAGGAGAGATGG + Intergenic
1105705063 13:22963392-22963414 GGGTGGGAAGGAAGGAGGGAGGG + Intergenic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1105936809 13:25107955-25107977 GTGAGGGGAGGGAGAAGAGAGGG - Intergenic
1106058742 13:26264714-26264736 GAGTGGGGAGGGAGGAGAGGAGG - Intronic
1106134041 13:26961198-26961220 CTTGAGGAAGGGAGAAGAGAAGG + Intergenic
1106263842 13:28092234-28092256 TTGGGGAGAGGGAGGAGAGAGGG - Intronic
1106322869 13:28658948-28658970 GTGTGGGCTGGGAGGAGGGAGGG - Intergenic
1106559103 13:30833430-30833452 CTCTGGGAAGGAAGGAAAAAAGG - Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1106587621 13:31071062-31071084 ATGTGAGAAGGAAGAAGAGATGG - Intergenic
1107285534 13:38786209-38786231 AGCTGGGAAGGGAGGAAAGATGG - Intronic
1107422563 13:40262192-40262214 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1107481503 13:40789536-40789558 CTGCGCGAAGGGAGGGGCGAAGG + Exonic
1107773599 13:43814157-43814179 ATGAGGGAGGGAAGGAGAGAGGG + Intergenic
1107788488 13:43977802-43977824 GGGAGGGAAGGGAGGGGAGAGGG - Intergenic
1108359352 13:49654969-49654991 CAGTAGAAAGGGAAGAGAGAAGG + Intergenic
1108411189 13:50148889-50148911 AGGTGGGAAGGAAGGAGGGAGGG - Intronic
1108851395 13:54736095-54736117 GTGAGGGAAGGGAAGGGAGAGGG - Intergenic
1108976198 13:56446131-56446153 CTGTCAGAAGGTAGGAGAGGAGG - Intergenic
1109449686 13:62494493-62494515 CTGTGAGAAAAGGGGAGAGAAGG - Intergenic
1110568622 13:76980425-76980447 CTGTTCGGAGGGAAGAGAGAGGG + Intergenic
1110574107 13:77036652-77036674 CTATTGGAAGGGAGTAGAGGTGG - Intergenic
1111781497 13:92731960-92731982 TTGTGTGAGGGGAGTAGAGATGG + Intronic
1111858567 13:93671670-93671692 TGGTGAGAAGTGAGGAGAGAGGG - Intronic
1112028816 13:95438617-95438639 ATCTGGAAAGTGAGGAGAGAAGG - Intronic
1112119453 13:96393730-96393752 CTGTGGCAAGGGAAGGGAGATGG + Intronic
1112238321 13:97656381-97656403 CTTGGGGTAGGAAGGAGAGATGG + Intergenic
1112441333 13:99426855-99426877 AGGTGGGAGGGGAAGAGAGAAGG + Intergenic
1112781073 13:102901993-102902015 GTGAGGGCAGAGAGGAGAGACGG + Intergenic
1113207279 13:107931521-107931543 GGGAGGGAAGGGAGGAGGGAGGG + Intergenic
1113375613 13:109762699-109762721 CTGGGGACAGGGAGGTGAGAAGG - Intronic
1113530464 13:111020724-111020746 CTGGGGGACAGGAGGAGGGAGGG - Intergenic
1113653643 13:112055469-112055491 CTGTGGGGAGGAGGCAGAGAGGG + Intergenic
1113665286 13:112136793-112136815 CTGAGGGAAGGGAGGAGGGAGGG - Intergenic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113729421 13:112629381-112629403 TTGGGGGAGGGGAGGAGGGAAGG - Intergenic
1113774958 13:112938813-112938835 CTGTGGCCAGGCAGGAGAGCTGG + Intronic
1113943609 13:114031829-114031851 CTGTGGGAGGGTGGGACAGACGG + Intronic
1114213312 14:20634347-20634369 TTACAGGAAGGGAGGAGAGAAGG + Intergenic
1114484378 14:23054369-23054391 CTGTGGGGAGGGAGGAGGGCTGG - Intronic
1114647591 14:24264187-24264209 TAGTGGGAAGGAAGGAAAGAAGG - Intronic
1115378433 14:32705341-32705363 CATTGGGAAGGGAAGAGAGTGGG + Intronic
1115724174 14:36194708-36194730 GAGGGGGAAGGGAGGGGAGAGGG + Intergenic
1115851011 14:37590560-37590582 CTGTGGGTAGAGAGGACAAAGGG + Exonic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117035450 14:51723309-51723331 CTTTGGGAAGGGAGGTATGAGGG + Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1117437373 14:55729541-55729563 CTATGGGAAGGCAGGGGACAGGG + Intergenic
1118010348 14:61604489-61604511 CTGTGGCAGCAGAGGAGAGATGG + Intronic
1118360587 14:65053363-65053385 CTCTGGGGAGGGAAGGGAGAGGG + Intronic
1118589690 14:67392294-67392316 CTATGAGCAGGGAAGAGAGATGG - Intronic
1118600321 14:67467449-67467471 CTGTGGGTGGGAAGGAGGGAGGG + Intronic
1118707807 14:68496042-68496064 CTGGGGGAAGGCAGGATGGAAGG - Intronic
1118900696 14:69983048-69983070 CTATGGGAAGGAGGGAGACATGG - Intronic
1118916798 14:70114587-70114609 ATGGGGGCAGGGAGGAGAGATGG - Intronic
1119063382 14:71500297-71500319 CTGGGGGAAGGCAAGAGGGAGGG - Intronic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119202380 14:72765976-72765998 CTCTGGGGAGGGAGTAAAGAAGG + Intronic
1119216983 14:72876596-72876618 CTGAGGGAAGGAAGGCCAGATGG - Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119726108 14:76922689-76922711 CTGGGGGAAGGGAGATGAGAGGG - Intergenic
1119726493 14:76924728-76924750 CTGGGGGATGGGGGGAGGGAAGG + Intergenic
1119825516 14:77654234-77654256 ATGTGGCAAAGGAGAAGAGAGGG - Intergenic
1120205001 14:81578717-81578739 CAGGGGGAAGGAAGGGGAGAAGG + Intergenic
1120635347 14:86943988-86944010 AGGAGGGAAGGGAGGAGGGAAGG - Intergenic
1120635361 14:86944028-86944050 AGGAGGGAAGGGAGGAGGGAAGG - Intergenic
1120680081 14:87470820-87470842 TTGGGGGAAGGGAAGAGAGGAGG - Intergenic
1120903154 14:89593187-89593209 AGGAGGGAAGGCAGGAGAGAGGG + Intronic
1120967678 14:90182087-90182109 ATTTGGGAAGGGAGGATCGAGGG - Intronic
1121209066 14:92193003-92193025 ATGTGGGATGGGAGGGGAGGCGG + Intergenic
1121235716 14:92390070-92390092 CTGAGATAAGGAAGGAGAGAAGG - Intronic
1121318206 14:92974676-92974698 GTGGGACAAGGGAGGAGAGAAGG + Intronic
1121453301 14:94023006-94023028 CTGGGGCAAGGGAGGAGTGAGGG + Intergenic
1121475015 14:94191209-94191231 CTGTGGGGTGTGAGGAGAAAGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121586629 14:95067463-95067485 CTGAGGGAAGTGAGCAGAGAGGG - Intergenic
1121612811 14:95293159-95293181 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
1121786905 14:96668833-96668855 ATGTGGCAAGTGAAGAGAGATGG + Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1121943654 14:98097500-98097522 TTGTGGGAAGGCATCAGAGAGGG - Intergenic
1122002054 14:98666927-98666949 GGGAGGGAAGGAAGGAGAGAGGG - Intergenic
1122043418 14:99006895-99006917 CTTTGAGAAGAGAGGAGAGCAGG - Intergenic
1122102524 14:99424677-99424699 CAGAGGGAGGGGAGGAGAGGAGG + Intronic
1122122466 14:99561767-99561789 ATGTGGGAAGGGGGCAGAGGAGG + Intronic
1122246375 14:100406044-100406066 CTGTGGGAAGGGATGTGTGGTGG + Intronic
1122316486 14:100828493-100828515 CAGGGAGAGGGGAGGAGAGAAGG - Intergenic
1122948582 14:105027110-105027132 ATGGAGGAAGGAAGGAGAGAAGG + Intergenic
1122958785 14:105085088-105085110 CTGTGGGAAGTGAAGGCAGAGGG - Intergenic
1123195148 14:106609198-106609220 TGGTGGGAAGGGTGGAGACATGG + Intergenic
1202830214 14_GL000009v2_random:19777-19799 CTGAGGCAAGTCAGGAGAGAGGG + Intergenic
1123989224 15:25671051-25671073 TAGTGGGAAGGGAGGGGATAAGG + Intergenic
1124035322 15:26048991-26049013 GTGTGGGGTGGGAGGGGAGAGGG - Intergenic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124425196 15:29557463-29557485 TTTTGGGGAGGGTGGAGAGAGGG - Intronic
1124587923 15:31026272-31026294 CTGTGTGAAGGGAGAAGTGTCGG + Intronic
1124845984 15:33290412-33290434 GTGTGTGGTGGGAGGAGAGAGGG - Intergenic
1125149214 15:36512112-36512134 ATGAAGGAAGGGAGGAGAGAAGG + Intergenic
1125542917 15:40481533-40481555 TGGTGGGGAGGGAGGGGAGATGG - Intergenic
1125607438 15:40949137-40949159 CTCTGGTAAGAGAAGAGAGAAGG + Intergenic
1125736302 15:41928861-41928883 AAGGGGGCAGGGAGGAGAGAAGG - Intronic
1126356541 15:47802121-47802143 CTGAGGGAAGGTGGGAGAGCAGG - Intergenic
1126810469 15:52398000-52398022 CTGGGTGAAAGGAGGAGAAAAGG + Intronic
1127263989 15:57346651-57346673 CTGTGGCCAGGGAGAAGAGTAGG - Intergenic
1127324229 15:57879892-57879914 CAGTGGTGAGGCAGGAGAGAGGG + Intergenic
1127517818 15:59713404-59713426 AGGAGGGAAGGGAGGAAAGAAGG - Intergenic
1127657712 15:61071490-61071512 AGAGGGGAAGGGAGGAGAGAGGG + Intronic
1127785002 15:62348053-62348075 CTGTGAGGAGGCAGGAGAAAGGG + Intergenic
1127866973 15:63041468-63041490 CAGTGGGAGGGGAGGAGAGGGGG - Intergenic
1127957301 15:63864327-63864349 TTTAGGGAAGGGAGGAGTGAGGG + Intergenic
1128084966 15:64879529-64879551 AGGTGAGGAGGGAGGAGAGATGG + Intronic
1128307392 15:66608537-66608559 GAGTGGGGAGGGAGGAGGGAAGG + Intronic
1128451903 15:67810719-67810741 GTGTGGGACGGTAGGAGGGAGGG + Intergenic
1128579539 15:68799256-68799278 CTGCTGGAAGGAAGGGGAGAGGG + Intronic
1128733127 15:70034266-70034288 CTCTGGGAATGGTGCAGAGAGGG + Intergenic
1128735772 15:70053195-70053217 CTTTGGGAAGGGAGGAGTCTTGG + Intronic
1128942326 15:71799061-71799083 AAGAGGGAAGGAAGGAGAGAAGG - Intronic
1129186438 15:73910118-73910140 ATGTGGGTAGTGAGGATAGATGG - Intergenic
1129225976 15:74170727-74170749 CAGCGGAATGGGAGGAGAGAGGG + Intergenic
1129232608 15:74205104-74205126 GTGGGGGAAGAGAAGAGAGACGG + Intronic
1129328035 15:74812393-74812415 GAGGGGGCAGGGAGGAGAGAAGG + Intergenic
1129384015 15:75185776-75185798 CTGAGGGAAGGGAGTGGGGATGG + Intergenic
1129389436 15:75213322-75213344 CGGCGGGAAGGGAGGACCGAAGG - Intergenic
1129442153 15:75589024-75589046 GAGTGGGAGGGGAGGGGAGAGGG + Intergenic
1129665435 15:77576989-77577011 CTGTGGGAAGGCAGGGGCTATGG - Intergenic
1129673053 15:77617579-77617601 GTGTGGGAAGGGGTGGGAGAAGG - Intronic
1129888121 15:79052810-79052832 ATGGGGGATGGCAGGAGAGATGG + Intronic
1129944075 15:79524204-79524226 GAGTGGGAAGGGAGGAGTGATGG - Intergenic
1129952137 15:79601286-79601308 CTCTGAGAAGGCAGGAGGGATGG + Intergenic
1130060834 15:80568858-80568880 CTGATGGAAGGCAGGGGAGATGG - Intronic
1130314852 15:82786365-82786387 GTGAAAGAAGGGAGGAGAGAAGG + Intronic
1130422508 15:83762581-83762603 CGGTGGGAGGGCAGAAGAGAGGG + Intronic
1130454188 15:84088689-84088711 CAGTGGGATCTGAGGAGAGATGG + Intergenic
1130556264 15:84924507-84924529 GTGGGGAAAGGGAGGAGGGAAGG - Intronic
1130677744 15:85968534-85968556 GAGTGGGAAGGGGGGAGATAGGG - Intergenic
1130859895 15:87876462-87876484 CTCTGGGACGGGAGGAGTTAAGG - Intronic
1130908980 15:88257997-88258019 CTGTGGGAAAGGAGAAGAAAGGG + Intergenic
1130915821 15:88303738-88303760 CTGGGGGGAGGAAGGAGAAAGGG - Intergenic
1131185473 15:90270397-90270419 CTGGCAGAAGGGAGGAGAGAAGG - Intronic
1131237761 15:90711688-90711710 AGGAGGGAAGGAAGGAGAGAGGG - Intergenic
1131341405 15:91605140-91605162 CTGTGGGGAGTGATGAGGGAAGG + Intergenic
1131521515 15:93119592-93119614 CTCTGAGAGGGGAGCAGAGATGG + Intergenic
1131841844 15:96445709-96445731 CGGTGGGGAGGGATGAGGGAAGG + Intergenic
1132083934 15:98891302-98891324 CTGTGGAGAGAGAGGAGAGACGG - Intronic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132255762 15:100374167-100374189 GTGGGGGAAGGAGGGAGAGAGGG - Intergenic
1132279694 15:100602441-100602463 CCGGGGGTAAGGAGGAGAGAAGG + Intronic
1132359623 15:101201567-101201589 CAGTGGGGTGGGAGGAGAGGAGG + Intronic
1132386988 15:101407718-101407740 CTGTCAGGAGGCAGGAGAGAGGG - Intronic
1132574699 16:659065-659087 CGCTGGAGAGGGAGGAGAGAGGG - Exonic
1132583685 16:696668-696690 CTTTGGGGTGGGAGGAAAGAAGG - Intronic
1132609859 16:810255-810277 CAGAAGGAAGGGAGGGGAGAGGG + Intronic
1132664681 16:1076080-1076102 GAGGGGGAGGGGAGGAGAGAGGG - Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1132997506 16:2830827-2830849 CTGTGGGATGGGAGGGGACATGG - Intronic
1133172550 16:3990661-3990683 CTGAGTCAGGGGAGGAGAGAGGG - Intronic
1133319580 16:4904656-4904678 CTGTGGATAGGGAGGAAACAGGG + Intronic
1133351288 16:5102342-5102364 ATGTGATGAGGGAGGAGAGATGG + Intergenic
1133816302 16:9199975-9199997 GGGAGGGAAGGAAGGAGAGAAGG - Intergenic
1134073015 16:11272330-11272352 CTTTGGGATGGAAGGAGTGAGGG + Intronic
1134229918 16:12420850-12420872 CTGGGGGAAGTGATGAGCGAGGG + Intronic
1134316883 16:13127052-13127074 CTGAGGGAAGGAGAGAGAGAGGG + Intronic
1134373064 16:13643738-13643760 CTGTGGGGAGGGCAGTGAGAGGG + Intergenic
1134449572 16:14354632-14354654 ATGGGGGAGGGGAGGAGAGGAGG + Intergenic
1134636332 16:15794735-15794757 CTGTGGGAAGGATGGAGGGAAGG + Intronic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1135221790 16:20620831-20620853 CTGGGGGAAGGAAGGGGATAGGG + Intronic
1135476431 16:22780115-22780137 AGGAAGGAAGGGAGGAGAGAAGG + Intergenic
1135546617 16:23371276-23371298 CTGTGGGGAGGGTGGGGTGAGGG - Intronic
1135623236 16:23974146-23974168 TGGTGGTGAGGGAGGAGAGAAGG + Intronic
1135752885 16:25070922-25070944 CTCAGGGCAGGGAGAAGAGAGGG - Intergenic
1135939099 16:26805506-26805528 CCGGGGCTAGGGAGGAGAGAGGG + Intergenic
1135945196 16:26859069-26859091 GTGAGGGAAGGGAAAAGAGAAGG + Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136080646 16:27850490-27850512 CTGTAGGAAGAGGAGAGAGAAGG + Intronic
1136499835 16:30664692-30664714 CTGTGGGAGGGGACGGGAGAAGG - Intronic
1136554688 16:31001051-31001073 CTGTGGGGTGGGAGGAGAAGGGG - Intronic
1136632475 16:31496953-31496975 GGGTGGGAGGGGAAGAGAGAAGG + Intronic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137624833 16:49901003-49901025 GTGTGGGAGAGGAAGAGAGAGGG - Intergenic
1137658828 16:50185439-50185461 CTGTGAGGAGGGAGGAGGGAAGG + Intronic
1137697823 16:50474030-50474052 CTGCAGGAAGGAGGGAGAGAAGG + Intergenic
1137774005 16:51040862-51040884 AGGAGGGAAGGAAGGAGAGAAGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138194658 16:55043434-55043456 CTTTGGGAAAGGAGGAGTGGGGG + Intergenic
1138222112 16:55260723-55260745 CTGTGAGAAGGGAAGACAGTAGG - Intergenic
1138301846 16:55937186-55937208 CTGGGGGAAGGGGTTAGAGAAGG - Intronic
1138959117 16:62007788-62007810 CTGAGGGAAGGAAAGAGAGTAGG - Intronic
1139173816 16:64662794-64662816 ATGAGGGAAGGAAGGAGGGAGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139521741 16:67486704-67486726 CTCTGTGCAGGGAGGAGAAAGGG + Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140611683 16:76607570-76607592 GTATGGGAAAGGAGGAGGGATGG + Intronic
1140648380 16:77059909-77059931 TTTTGGAAAGGGAGGAGAGAGGG + Intergenic
1140930478 16:79623103-79623125 CTGTGGGAGGGGACAAGAGGTGG - Intergenic
1141285788 16:82670356-82670378 CAGTGGGGAAGGTGGAGAGAAGG - Intronic
1141343919 16:83228069-83228091 CCGTGAGAAGGGAGGCCAGATGG + Intronic
1141533222 16:84661089-84661111 CTGTGGGGAGAGGGGAGGGAGGG - Intronic
1141769101 16:86078124-86078146 CTCTGGGAAGGGAAGGCAGAGGG - Intergenic
1141821534 16:86449533-86449555 CTGTGGCCAAGGAGGAGGGACGG + Intergenic
1141882917 16:86871833-86871855 GGGAGGGAGGGGAGGAGAGAAGG - Intergenic
1142096933 16:88245126-88245148 ATGAGGGAGGGGAGGAAAGAAGG + Intergenic
1142409321 16:89908075-89908097 CTGGGAGGAGGGAGGAGACAGGG - Intronic
1142491011 17:279664-279686 CTGTGGGAGGGCAGAAGTGAGGG - Intronic
1142623371 17:1178792-1178814 CTCAGGGAAGGGTGGGGAGAAGG + Intronic
1142752586 17:1997874-1997896 CTCTGAGAAGGGAGGTGACAAGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143204728 17:5133778-5133800 CTTCGGGAAGGAAGGAAAGAAGG - Intronic
1143377285 17:6474288-6474310 AGGTGGAAAGAGAGGAGAGAGGG - Intronic
1143402322 17:6654756-6654778 ATTTGGACAGGGAGGAGAGAAGG - Intergenic
1143473990 17:7192658-7192680 CCATGGGAAGAGAGGAGAAATGG + Intronic
1143476637 17:7207060-7207082 CTGTGAGCAGAGAGGAGAAAGGG + Intronic
1143476964 17:7208397-7208419 CTGTTGGGAGAGTGGAGAGAGGG - Intronic
1143576770 17:7798380-7798402 CAGTGACAAGAGAGGAGAGATGG + Intronic
1143633735 17:8152653-8152675 ATAATGGAAGGGAGGAGAGAGGG + Intronic
1143765235 17:9133397-9133419 CTGGGAGCAAGGAGGAGAGATGG - Intronic
1143887489 17:10076074-10076096 CCTTGGGAAGGGAAGAGGGAAGG + Intronic
1144032721 17:11336636-11336658 CTGTTAGAGGGGAGGAGAGAAGG - Intronic
1144269999 17:13606271-13606293 CTGTGGTAGGGCATGAGAGATGG - Intergenic
1144482376 17:15638692-15638714 CCCTGGCAAGGAAGGAGAGAGGG + Intronic
1144585467 17:16485028-16485050 GTGGGGGTAGGGAGGAGAGCAGG + Intronic
1144622413 17:16825955-16825977 GTGCGGGAAGGGGGCAGAGAAGG - Intergenic
1144737041 17:17561034-17561056 CTGGAGGAAGGGAGGAGAGAGGG - Intronic
1144764759 17:17726281-17726303 GTGTGGGAAGGGTGGGGAGCAGG - Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1144875781 17:18396457-18396479 CTTTGGGAAGGAAGGAAAGAAGG - Intergenic
1144916307 17:18726340-18726362 CCCTGGCAAGGAAGGAGAGAGGG - Intronic
1145014592 17:19387893-19387915 CTGTGGGAGGGGAAAAGAGTGGG - Intergenic
1145037819 17:19553445-19553467 ATGTGGGAGGGAAGGAAAGATGG - Intronic
1145087739 17:19956907-19956929 TTGAGGGAAGGAAGGAGGGAGGG + Intronic
1145156447 17:20547964-20547986 CTTTGGGAAGGAAGGAAAGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145320530 17:21764709-21764731 CTGTGGGAGGGGAATAGAGGTGG - Intergenic
1145726116 17:27126421-27126443 ATGGGTGAAGGAAGGAGAGAAGG + Intergenic
1145737220 17:27241412-27241434 TTGAGGGAAGGGAGGAGTGAGGG - Intergenic
1145978554 17:28998120-28998142 CTATGGGGAGGGAGGAGGGATGG + Intronic
1146160452 17:30556764-30556786 CTTCGGGAAGGAAGGAAAGAAGG - Intergenic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1146843943 17:36172051-36172073 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146856249 17:36259986-36260008 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146864370 17:36328389-36328411 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1146872156 17:36383897-36383919 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146879518 17:36434982-36435004 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1146883445 17:36456125-36456147 CTTTGGGAAGGAAGGACAGAAGG + Intergenic
1146941591 17:36847350-36847372 GTGTGGGGAGGGAGGTGGGAGGG + Intergenic
1147016609 17:37497058-37497080 CAGTGGGAAGGGAAGAGAAATGG - Intronic
1147031966 17:37645759-37645781 ATGTGTGAATGGAGAAGAGAAGG + Intergenic
1147067229 17:37928977-37928999 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1147075042 17:37984521-37984543 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1147078761 17:38008538-38008560 CTTCGGGAAGGAAGGACAGAAGG - Intronic
1147086567 17:38064067-38064089 CTTCGGGAAGGAAGGACAGAAGG + Intronic
1147094699 17:38132473-38132495 CTTCGGGAAGGAAGGACAGAAGG - Intergenic
1147102510 17:38188030-38188052 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1147186928 17:38717972-38717994 CTTTGGGAAGAAAGGGGAGAGGG - Intronic
1147318333 17:39631699-39631721 GGCTGGGAAGGGAGGAGAGAAGG + Intronic
1147396757 17:40149438-40149460 CTGAGGGAAGGCTGAAGAGATGG + Intronic
1147443074 17:40459318-40459340 GTGTGCGATGTGAGGAGAGAGGG + Intergenic
1147576764 17:41605877-41605899 GTGCGGGAAGGGGGCAGAGAAGG - Intergenic
1147599492 17:41737023-41737045 CTGTCGGAAGGAAGGAAGGAAGG + Intergenic
1147758165 17:42781707-42781729 GTGGGGGACGGGAGGAGTGAGGG - Intronic
1148018650 17:44539632-44539654 AAGTGGGAAAGGAGGAGGGAAGG + Intergenic
1148150426 17:45393762-45393784 CTGTGGGAGGGAAGATGAGAGGG + Intergenic
1148463679 17:47851838-47851860 CTGGGAGAGGGGAGGAGAGGAGG - Intronic
1148559948 17:48600269-48600291 TTGTGGGCAGGGAGGAGGCAGGG - Intronic
1148687601 17:49509374-49509396 GCGTGGGAAGTGAGGAGGGACGG + Intronic
1148695486 17:49555852-49555874 CAGTGGGAAGGGGGCTGAGAGGG - Intergenic
1148745590 17:49916243-49916265 CTGTGGGAGGGCAGGAGCTAGGG + Intergenic
1148789592 17:50165981-50166003 CAGGGGGCAGGGAGGAGAGGAGG - Intronic
1148862907 17:50613868-50613890 CTGGGGCAAGGGAGGACAGGAGG - Intronic
1148904111 17:50900703-50900725 CTGAGGGGAGGGAGGCGAGCTGG + Intergenic
1149027901 17:52051086-52051108 GAGTGGGAAGGGAGGAAGGAAGG + Intronic
1149336522 17:55641670-55641692 CTGTGGGAGGGAAAGAAAGAAGG - Intergenic
1149560940 17:57607565-57607587 GTCTGAGAAGGGAGGAGGGAGGG + Intronic
1149615518 17:57994489-57994511 CTGTGGGAAACAAGGAGAAAGGG + Intronic
1149821544 17:59783744-59783766 TAGCGGGAAGGGAGAAGAGAGGG - Intronic
1149847083 17:60014496-60014518 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1149881048 17:60290788-60290810 CTCTAGGGAGGGAGGGGAGAGGG + Intronic
1150085442 17:62271113-62271135 CTTCGGGAAGGAAGGACAGAAGG + Intergenic
1150281419 17:63931509-63931531 CTGGGGGCAGGGAGGACCGAGGG - Intronic
1150285998 17:63954489-63954511 ATGGGGGAAGGGAGGAGGGGAGG + Intronic
1150440179 17:65184837-65184859 CAGTGAGAAGGAAGGAAAGAAGG - Intronic
1150666429 17:67143275-67143297 CAGTTGGAAGGGAGGAGCTATGG - Intronic
1150958612 17:69890012-69890034 ATGTGGGAAGAAAAGAGAGATGG + Intergenic
1150994154 17:70296822-70296844 GCTTGGGAAGGGAGGAGAGAGGG + Intergenic
1151095424 17:71492175-71492197 CTGAGGTAAGAGAGGAGAGAAGG + Intergenic
1151115177 17:71727513-71727535 AGGTGGGAAGGAAGGAAAGAAGG - Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151529909 17:74697555-74697577 CTGTGGGGAGGGAGAAGTGTTGG + Intronic
1151679346 17:75615391-75615413 CTCTGGGACTGGAGGAGGGAGGG + Intergenic
1151740945 17:75981615-75981637 CTGAGGGAGAGGAGGACAGAAGG - Intronic
1151778669 17:76227017-76227039 CTGAGGGCGGGGAGGAGGGAAGG + Intronic
1151811680 17:76447022-76447044 CAGTGGGCAGGCAGGAGGGAGGG - Intronic
1151854089 17:76709636-76709658 TTCTTGGAAGGGAGGAGAGCCGG - Intronic
1152010361 17:77709363-77709385 CTGTGGGAGATGAGGAGGGAGGG + Intergenic
1152063690 17:78098099-78098121 ATGGGGGAAAGGAAGAGAGAAGG - Intronic
1152118060 17:78400886-78400908 CTGTGGGTGGGGTGGAGTGAGGG + Intronic
1152248860 17:79201036-79201058 GGGTGGGAAGAGAGGAGAGAAGG - Intronic
1152297017 17:79473751-79473773 CTTTGGGGTGGGAGGGGAGATGG - Intronic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152494388 17:80660829-80660851 CTGAGAGAAGGGTGGGGAGATGG - Intronic
1152645579 17:81467114-81467136 CTGTGGCAAGAAAGGAAAGACGG + Intergenic
1153786828 18:8543114-8543136 CTGTCGGAAGGAAGGAAGGAAGG + Intergenic
1153912636 18:9717629-9717651 CTCTGGGAGGGAAGGACAGAGGG + Intronic
1154145358 18:11862136-11862158 CTGTGGCAGTGGAGAAGAGAGGG + Intronic
1154275166 18:12952745-12952767 GGGTGGGAGGGGAGGGGAGAGGG - Intronic
1154323768 18:13375229-13375251 CGGTGGAAAAGGAGGAGAAAAGG + Intronic
1155371280 18:25103734-25103756 CTCTGTGATGGGAAGAGAGAAGG + Intronic
1155868386 18:30995153-30995175 GTGAGGAAAGGGAGGAGACATGG - Intronic
1156221539 18:35057454-35057476 CTGTGACAAGGTAGTAGAGAAGG + Intronic
1156233648 18:35180016-35180038 CCATGGGAAGACAGGAGAGAGGG - Intergenic
1156480433 18:37433063-37433085 CTGTGGGAGGTGAGCAGTGAGGG + Intronic
1156802363 18:41131945-41131967 CAGAGAGAAGGGAGAAGAGATGG + Intergenic
1156851762 18:41736935-41736957 CAGTTGGAAGGCAGGAGGGAAGG + Intergenic
1156997839 18:43489424-43489446 CTATTGGAAGGGAGGGAAGAAGG + Intergenic
1157000283 18:43514720-43514742 ACGTGGGAAGGGGGAAGAGAAGG - Intergenic
1157002936 18:43549142-43549164 CTGGAAGAAGGGAGGAGAGAAGG + Intergenic
1157605317 18:48922771-48922793 CTGTGGAAGGAGGGGAGAGAGGG - Intronic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1157728638 18:49984826-49984848 CTGTGGGAGGCGAGGAAATAAGG + Intronic
1158051022 18:53220097-53220119 TAGTGGGAAGGGAGGAGATGGGG + Intronic
1158488847 18:57892199-57892221 CTGGAGGCTGGGAGGAGAGAGGG - Intergenic
1158528205 18:58234334-58234356 CTGAGGGAGGGAAGGAGGGAGGG - Intronic
1158608021 18:58913107-58913129 CAGTTGGAAGAGAAGAGAGAAGG + Intronic
1158671304 18:59476344-59476366 CTGTGGGAAGGGAGCAGTACTGG - Intronic
1158780854 18:60648791-60648813 TTGTGGGGTGGGAGGAGGGAGGG + Intergenic
1158875446 18:61730061-61730083 CTGTGAGTAGGGAGCAGGGATGG - Intergenic
1159005755 18:63008897-63008919 CTGTGTGTAGGGAGAAGAGAGGG - Intergenic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159050805 18:63419528-63419550 CTGTGGGATGGGAGGCGGTAAGG - Intronic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159855527 18:73583126-73583148 CTTTGGGAAGGGAGGTGAGTAGG + Intergenic
1160105795 18:75974883-75974905 AGGAGGGAAGGAAGGAGAGAGGG - Intergenic
1160306796 18:77747565-77747587 CTGCGGGAAAGAAGGAAAGAGGG - Intergenic
1160368548 18:78350397-78350419 CTGTGGGAAGGGGTGTGAGGTGG - Intergenic
1160373875 18:78396288-78396310 CTGGGGCAAGGGGGGAGAGGGGG + Intergenic
1160394509 18:78562113-78562135 CAGTGGGAAGGGCAGAGGGATGG - Intergenic
1160570675 18:79815698-79815720 CCGTGGGGAGGGAGAAAAGAGGG + Intergenic
1160591901 18:79949762-79949784 CTGGTGGAGGGGTGGAGAGAAGG - Intronic
1160615210 18:80121175-80121197 CAGAGGGAAGGAAGCAGAGAGGG - Intronic
1160872210 19:1282562-1282584 GGGTGGGAGGGGAGGAGGGAGGG + Intergenic
1160872221 19:1282597-1282619 AGGTGTGAAGGGAGGAGGGAGGG + Intergenic
1160872239 19:1282640-1282662 GGGTGTGAAGGGAGGAGGGAGGG + Intergenic
1160872249 19:1282667-1282689 GGGTGTGAAGGGAGGAGGGAGGG + Intergenic
1160983254 19:1826376-1826398 CTGGGAGTAGGGAGGAGGGAGGG + Intronic
1160999843 19:1905182-1905204 CGGCGGGAGGGGAGGAGAGGCGG - Intergenic
1161022361 19:2016059-2016081 AGGTGGGAGGGGAGGAGGGAGGG + Intronic
1161378346 19:3951275-3951297 CAGGGGGACGGGGGGAGAGATGG + Intergenic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161726363 19:5931532-5931554 CTGTGGGAGGGAAGGAGAGTGGG + Intronic
1161850439 19:6735455-6735477 TTGTTGGAAGGAAGGAGAGAGGG - Intronic
1161955985 19:7495298-7495320 CAGAAGGAAGGAAGGAGAGAGGG - Intronic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1162019182 19:7860952-7860974 AGGAAGGAAGGGAGGAGAGAGGG + Intronic
1162026247 19:7895576-7895598 CTGTGGGACGGGACGAGACGGGG - Intronic
1162084193 19:8238575-8238597 CTGTGGGAAGGAAGTAAAGAGGG - Intronic
1162084779 19:8241964-8241986 CTGAGGGAAGGGAGGAAATGAGG - Intronic
1162095200 19:8306122-8306144 CAGGGTGTAGGGAGGAGAGAGGG - Intronic
1163008306 19:14409876-14409898 GTGTGGGAAGGGAGGTGGGAGGG + Intronic
1163124184 19:15235752-15235774 CTGTGGGAAGGGTTGGGAAATGG + Exonic
1163203747 19:15787406-15787428 CAGGAGGAAGGGAGGAAAGATGG + Intergenic
1163238267 19:16042571-16042593 ATGTGGGAAGGGAAGGGTGATGG - Intergenic
1163668461 19:18613849-18613871 CTGGGGGAGGGGAGGACAGGGGG - Intronic
1163678891 19:18669396-18669418 CTTTGGGAAGGAGGGAGGGAGGG - Exonic
1163719140 19:18890063-18890085 CTGTGGGCTGGGAGCAGAGGAGG - Intronic
1164401553 19:27905515-27905537 CAGTGGGGAGGCAGGAGAGAAGG - Intergenic
1164562112 19:29299592-29299614 CCGTGGGAAGGGAGTAGGGGTGG - Intergenic
1164575795 19:29404703-29404725 GTGTGGCCAGGGAGGAGAGTAGG - Intergenic
1164618113 19:29678602-29678624 CTGTGGCGAAGCAGGAGAGACGG - Intergenic
1164808768 19:31139688-31139710 CTGTGGGAAGGTAGTAGGGCTGG - Intergenic
1164849436 19:31469248-31469270 CAGTGGGAAGGTTGGAGACAGGG - Intergenic
1165341366 19:35214437-35214459 CTATGGGAAGAGGGGAGAGGAGG + Intergenic
1165395789 19:35563006-35563028 TGGAGGGAGGGGAGGAGAGAGGG - Intronic
1165489287 19:36114105-36114127 CTGGGCGAAGGGAGGAGGGAAGG - Intronic
1165636441 19:37344180-37344202 CATAGGGGAGGGAGGAGAGAGGG + Intronic
1165736625 19:38180989-38181011 CTTTGGAAGGAGAGGAGAGAAGG - Intronic
1165828479 19:38718996-38719018 CTCTGGGAAGGGATGGGAGGTGG - Intronic
1165859208 19:38898426-38898448 CTGGGGGAGGGGAGCAGAGGTGG + Intronic
1165923927 19:39315341-39315363 CAGTGGGAAGGCAGGAGGGGTGG + Intergenic
1165936355 19:39391190-39391212 CTGGGTGAAGGGCGGAGCGAGGG + Exonic
1165949549 19:39466426-39466448 CTGGGGTCAGGGAGGAGAGTGGG + Intronic
1166206461 19:41272872-41272894 CTGAAGGAAGGAAGGAGGGAAGG - Intronic
1166422819 19:42652021-42652043 CAGTGTCAGGGGAGGAGAGAGGG - Intronic
1166458405 19:42964433-42964455 ATGAGGGAAGGAAGGAGGGAGGG - Intronic
1166475352 19:43119690-43119712 ATGAGGGAAGGAAGGAGGGAGGG - Intronic
1166650350 19:44569371-44569393 TGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1166684805 19:44789981-44790003 CTGGGGGAAGGGAAGAGAGGGGG - Intronic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166747777 19:45149899-45149921 ATGGGGGAAGGGAGTGGAGAAGG + Exonic
1166790296 19:45395385-45395407 CTGGGTGAAGGGAGGACAAATGG - Intronic
1166933892 19:46319484-46319506 CTGTGTGAAGGGAGGTGCCAGGG + Intronic
1167195197 19:48023465-48023487 ATGGAGGAAGGGAGGAGGGAAGG + Intronic
1167238189 19:48327432-48327454 CTGTGGGAAGGGCTGGGAAAAGG - Intronic
1167286585 19:48601829-48601851 GGGAGGGAAGAGAGGAGAGAGGG + Intronic
1167291144 19:48625868-48625890 CTGTGGGAAGGGAGGAGAGAAGG - Intronic
1167350279 19:48969856-48969878 CTAGGGGAAAGGAGGAGAGGGGG + Intronic
1167354711 19:48996169-48996191 CTGTGGGAAGGAAGGAGACCTGG + Intronic
1167552421 19:50170116-50170138 AGGAAGGAAGGGAGGAGAGAAGG - Intergenic
1167554234 19:50183184-50183206 CTGTCGGAAGGAAGGAAGGAAGG - Intergenic
1167612501 19:50514190-50514212 CTTTGGGTTGGGAGAAGAGATGG + Intronic
1167660535 19:50793661-50793683 CTGTGGGGAGACAGGACAGATGG - Intronic
1167852719 19:52214225-52214247 CTGAGAGAAAGCAGGAGAGAGGG + Intronic
1168145557 19:54418646-54418668 CAGTGAGCAGGGAGGAGAGGGGG + Intronic
1168181592 19:54665656-54665678 CTGTGAAATGGGTGGAGAGAGGG + Intronic
1168233539 19:55047877-55047899 CTGTGGGTTGGGAGGAGTGAGGG + Intronic
1168252084 19:55147032-55147054 GTGTGGGGAGAGAGGAGGGAGGG + Intronic
1168306581 19:55439181-55439203 TTGAGGGAAGGGATGGGAGATGG - Intronic
1168471566 19:56644328-56644350 CTGTTGGGAGTGAGGAGAGGAGG - Intronic
1168489111 19:56792992-56793014 ATGTGAGAAGGAAGGTGAGAAGG - Intronic
1168525149 19:57082704-57082726 CTGTGAGGAGGGAGTAGAGTGGG + Intergenic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
1202642477 1_KI270706v1_random:107995-108017 CTGAGGCAAGTCAGGAGAGAGGG - Intergenic
925007845 2:458620-458642 CTGGGGGGAGGGAGCAGAGGAGG + Intergenic
925032211 2:659675-659697 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
925110329 2:1330045-1330067 AGGTGGGAAAGGAGGAGAGGAGG + Intronic
925168586 2:1736389-1736411 GCCTGGAAAGGGAGGAGAGATGG + Intronic
925281833 2:2690419-2690441 GTGTGAGTAGGGAGGAGAGAGGG - Intergenic
925618714 2:5769164-5769186 CAGTGAAGAGGGAGGAGAGAGGG + Intergenic
925648326 2:6061316-6061338 CTATTGGAAGGAAGGAGGGAAGG + Intergenic
925719521 2:6813660-6813682 AGGGAGGAAGGGAGGAGAGAGGG + Intergenic
925722661 2:6843803-6843825 TTGTGATATGGGAGGAGAGAAGG + Intronic
925822880 2:7817832-7817854 CGGTGGGAGGGGAGGACAAAGGG + Intergenic
926125553 2:10269827-10269849 AGGTGGGGAGGGAGGAGAGGAGG - Intergenic
926151342 2:10427195-10427217 CTGTGGGAAGGGTGGGGACGAGG + Exonic
926245736 2:11121507-11121529 CTGAGGAAGGGGAGGAGATATGG - Intergenic
926306324 2:11639782-11639804 AGGTGGGGAGGGAGCAGAGAGGG + Intronic
926347135 2:11957671-11957693 CTGTGTGAAGGAAGTAGAGTGGG + Intergenic
926389229 2:12370496-12370518 CTGTGGGAGGAGAGAAGAGGAGG - Intergenic
926705265 2:15833116-15833138 ATGTGGGAGGGAAGGAGAGGAGG + Intergenic
926766723 2:16328729-16328751 CTGGAGAAAGGAAGGAGAGAAGG - Intergenic
926862648 2:17325309-17325331 CTATGGGAAGGGATGACAAAAGG - Intergenic
926933241 2:18061558-18061580 GTGAGGGAAGGAAGGAAAGAAGG + Intronic
927148647 2:20183233-20183255 ATGAGGGGAGGGAGGAGAGCAGG + Intergenic
927351907 2:22125738-22125760 CTGTGAGGAGGGAGCAGAGAAGG - Intergenic
927612671 2:24557540-24557562 AAGGGGGAAGGGAGGGGAGAAGG - Intronic
927651097 2:24914184-24914206 CAGCCGGAAGGGAGGACAGATGG - Intronic
927655625 2:24943070-24943092 CTGTGACCAGGGAGGAAAGATGG + Intergenic
927877895 2:26670866-26670888 AGGAGGGAAGGGAGGAGGGAAGG + Intergenic
928255469 2:29718550-29718572 CTGAGTGCAGGGAGGAGGGAAGG + Intronic
928292993 2:30056325-30056347 TTGTGGGAAGGGAGTAGAGAGGG - Intergenic
928377527 2:30787753-30787775 TTGTGGGATGGGGGCAGAGAGGG + Intronic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
929097258 2:38275352-38275374 CTGAGGCAAGGGATGGGAGATGG - Intergenic
929677187 2:43948200-43948222 CTGTGAGAAGGGAAGGGAGGGGG + Intronic
929904897 2:46037023-46037045 CTGTGGGAAGGCAGGCGAGGAGG - Intronic
929918646 2:46156514-46156536 GTGTGCAAAGGAAGGAGAGAAGG + Intronic
930066576 2:47332436-47332458 CTGTGGGAAGGGAAGATTGACGG - Intergenic
930136301 2:47906341-47906363 GAGTGTGAAGGGAGGAGATAGGG + Intergenic
930145589 2:47999836-47999858 AAGTTGGAAGGAAGGAGAGAAGG - Intergenic
930622530 2:53658900-53658922 GTGAGGGAAGGGGGGAGTGAGGG + Intronic
930745586 2:54880164-54880186 CTGGGGTAAGGGAGGACAGGTGG - Intronic
930752218 2:54945110-54945132 GAATGGGATGGGAGGAGAGAGGG - Intronic
930873633 2:56190825-56190847 CTGGGGTAGGGGAGGAAAGAAGG - Intronic
931271900 2:60710993-60711015 CTGCAGGAAAGGAGAAGAGAAGG - Intergenic
931289012 2:60856158-60856180 ATGGGGGAAGGGAGGACAGCAGG + Intergenic
931322253 2:61182502-61182524 CAGAGGGAAGGAAGAAGAGAGGG - Intronic
931625034 2:64249779-64249801 CTCTGGGAAGGGAAGAGGAATGG - Intergenic
931797873 2:65729076-65729098 CTGAGTGACAGGAGGAGAGAAGG + Intergenic
931826327 2:66004279-66004301 AGGAAGGAAGGGAGGAGAGAAGG - Intergenic
931957062 2:67439345-67439367 CTTTAGGGAGGGAGGAGAGTAGG - Intergenic
932076176 2:68665238-68665260 ATGTGGGAAAGGAGGAGCTATGG - Intergenic
932432964 2:71686431-71686453 CTGGAGGGAGGGAGGAGACAGGG - Intronic
932572643 2:72946057-72946079 CTGTGGGGTGGGAGGAGGGCAGG - Intronic
932825973 2:74940544-74940566 CAGGGGGATGGGAAGAGAGATGG - Intergenic
932924311 2:75954283-75954305 GTGGAGGAAGGGAGGAAAGAAGG - Intergenic
933102237 2:78274903-78274925 GTGGGGGGAGGGAGGAGGGATGG + Intergenic
933586751 2:84187418-84187440 CTGTGGGAAGTGAGCAAAGCTGG - Intergenic
933806026 2:85998494-85998516 CTGGGGGTGGGGACGAGAGAGGG + Intergenic
934498314 2:94831438-94831460 CTGAGGCAAGTCAGGAGAGAGGG - Intergenic
934563317 2:95324102-95324124 CTGTGGGGAATGAGGAGAGATGG + Intronic
934858708 2:97745702-97745724 CTGTGGGTGGGGATGTGAGATGG + Intergenic
934861564 2:97767822-97767844 CTGTGGGCTGGGAGGACAGAAGG - Intronic
934989807 2:98913335-98913357 GGGTGGGAAGGGAAGAGAGCTGG + Intronic
935011556 2:99141205-99141227 GGGTGGGAAGGGAGGAGAAAGGG - Intronic
935013118 2:99154680-99154702 CTGGGCGAAGGTAGGAGAGCGGG - Exonic
935223589 2:101035216-101035238 CTGTGGGAGGCCAGGTGAGAGGG - Intronic
935354791 2:102187933-102187955 CTCTGGGAACGGAGGACACACGG - Intronic
935422778 2:102887035-102887057 CTGAGGGGAGGGGGGAGGGAGGG - Intergenic
935620498 2:105125825-105125847 GGGAGGGAAGGAAGGAGAGATGG + Intergenic
935626661 2:105177276-105177298 AAGAGGGAAGGAAGGAGAGAAGG - Intergenic
935697312 2:105781363-105781385 GTGTGGGAAGGGATGAGTGGTGG - Intronic
935796438 2:106645642-106645664 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
935831460 2:107004999-107005021 CTGAGGGAGGGGATGAGGGAGGG + Intergenic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
935939043 2:108219741-108219763 CTGTGGGGAGGGAGGAGGAAAGG + Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937027452 2:118711272-118711294 CTGTTGGCAGGGAGAAGAGGAGG - Intergenic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
937278085 2:120698955-120698977 CTGTAGAAAGTGAGAAGAGAGGG - Intergenic
937314407 2:120921823-120921845 AGGTGGAAAGGCAGGAGAGAAGG - Intronic
937475140 2:122208557-122208579 CTGGGATAAGGGAAGAGAGAGGG - Intergenic
937899863 2:127011692-127011714 CTGGGGGAGGGGAGGAGGAAAGG - Intergenic
937948482 2:127364586-127364608 CTGTGTGATGAGTGGAGAGATGG - Intronic
938248920 2:129798816-129798838 CTGTGTGCAGGGAGGACACAGGG - Intergenic
938302041 2:130222755-130222777 CTGTGGGAAGGGAAATGAAATGG + Intergenic
938454659 2:131451697-131451719 CTGTGGGAAGGGAAATGAAATGG - Intergenic
938823172 2:134978833-134978855 CTTTGGGAAGGCAGGTCAGATGG - Intronic
939125856 2:138176812-138176834 CTGAGTGAAGGGGAGAGAGAAGG + Intergenic
939172213 2:138709439-138709461 CTGTGGGTAGGGAGGGGGGCAGG - Intronic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
939973573 2:148689597-148689619 GTGGGGGAAGGGAGGAAGGAGGG + Intronic
940011068 2:149056221-149056243 TTGTGGAAAGGCAGGATAGAAGG - Intronic
940274911 2:151929151-151929173 CAGGGGGAAGCAAGGAGAGATGG + Intronic
941018124 2:160380157-160380179 CTGTGGTGAGTGAGGAGAGATGG - Intronic
941045596 2:160671768-160671790 TTGAGGGAAGGTGGGAGAGAGGG + Intergenic
941132556 2:161671525-161671547 CTATTAGAAGGGAAGAGAGAGGG + Intronic
941157893 2:162001322-162001344 CTCTGGCTAGGGAGCAGAGAAGG + Intronic
941235922 2:162973807-162973829 CACTGGGAAGGAAGGAAAGAAGG + Intergenic
941239850 2:163023855-163023877 GTGGAGGATGGGAGGAGAGAGGG - Intergenic
941339294 2:164286939-164286961 ATGAGGGAAGGAAGGAAAGAGGG + Intergenic
941500204 2:166264747-166264769 TTTTGGGTAGGGAGAAGAGAGGG + Intronic
941565693 2:167103169-167103191 AGGAGGGAAGGGAGGGGAGAGGG + Intronic
941993042 2:171575722-171575744 CTCTGGGGAGGGAAGAGAGAAGG + Intergenic
942043864 2:172087832-172087854 ATGGGGGAAGGGAGGAAGGAGGG + Intronic
942149072 2:173056887-173056909 CTGCAGGATGGGAGGAGTGAAGG + Intergenic
942189585 2:173456836-173456858 CGGTGGGAACGGAGAAGAGCAGG + Intergenic
942201459 2:173575737-173575759 TTGGGGGAAGGAATGAGAGAAGG - Intergenic
942257404 2:174117728-174117750 CTGGGAGAAGGGTGGAGAAAAGG - Intronic
942265232 2:174217685-174217707 CTGGGGGAGGGGCAGAGAGAGGG - Intronic
942863789 2:180648036-180648058 GTGGGGGAAGAAAGGAGAGAGGG - Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
944174653 2:196816535-196816557 CTATTAGAAGGAAGGAGAGAGGG + Intergenic
944177634 2:196850635-196850657 CTCTTGGAAGGAAGGAGGGAAGG + Intronic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
945042193 2:205751791-205751813 CCCTGGGAAGGGAAGTGAGAAGG + Intronic
945056041 2:205869772-205869794 CTGGGGGATGGGAGGAGGAAAGG + Intergenic
945606573 2:211940205-211940227 CTGGGGTAAGGGTGGAGAGGTGG + Intronic
945647861 2:212522929-212522951 CTGTAGAAAGTGAGGAGAGGTGG + Intronic
946146395 2:217734416-217734438 CTGTGGTCAGGGTTGAGAGAGGG - Intronic
946565841 2:220964711-220964733 ATGGAGGAAAGGAGGAGAGACGG - Intergenic
946708596 2:222484254-222484276 CAGCAGGAAGGAAGGAGAGAGGG - Intronic
946713782 2:222532601-222532623 GTGTGGGAAGGGAGGAGCTGGGG - Intronic
946766617 2:223046544-223046566 AAGTGGGGAGGGAAGAGAGATGG - Intergenic
946902196 2:224383461-224383483 CAGGAGGAAGGAAGGAGAGAAGG - Intronic
947032093 2:225807899-225807921 CTGTGGGGAGGAAGGAGCTAAGG + Intergenic
947339648 2:229124290-229124312 TTGTGGGAAGGCAGGACAGATGG - Intronic
947815184 2:233032079-233032101 CAGTGGGAAAGGAAGAGACAGGG - Intergenic
947858084 2:233338101-233338123 ATCTTGGAAGGCAGGAGAGAAGG + Intronic
947998010 2:234544766-234544788 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948408361 2:237739953-237739975 TTGTGGGAATGGAGGAGGGGAGG + Intronic
948420592 2:237858038-237858060 CTGAGGGCTGGGTGGAGAGAAGG - Intergenic
948582618 2:238998184-238998206 GGGAGGGAAGGAAGGAGAGAAGG - Intergenic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948839091 2:240640585-240640607 GTCAGGGAAGGAAGGAGAGAGGG - Intergenic
1168927911 20:1598159-1598181 ATGTGGCAGGGGAGGAGGGAAGG + Intronic
1169546303 20:6654485-6654507 TTATGGGAGGGGAGGAGAAAGGG - Intergenic
1169748238 20:8964676-8964698 CTGTGGCAAGGAAGGAAGGAAGG + Intronic
1170272068 20:14538344-14538366 CTGGAGCAATGGAGGAGAGATGG + Intronic
1170290143 20:14760205-14760227 CTGGGGGCAGGGTGGAGTGAGGG + Intronic
1170375022 20:15690798-15690820 CTCAGGGAAAAGAGGAGAGATGG - Intronic
1170463631 20:16602297-16602319 TAGTTGGAAAGGAGGAGAGATGG + Intergenic
1171033773 20:21700447-21700469 ATTTGTGAAGGGAGGCGAGAGGG - Intergenic
1171721687 20:28569792-28569814 AGGAGGGAAGGAAGGAGAGAGGG - Intergenic
1171756376 20:29113705-29113727 AGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1171756383 20:29113733-29113755 AGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1171785832 20:29464015-29464037 GAGAGGGAAGGAAGGAGAGAGGG - Intergenic
1171785881 20:29464199-29464221 AGGAGGGAAGGAAGGAGAGAGGG - Intergenic
1171862363 20:30412785-30412807 AGGAGGGAAGGAAGGAGAGAAGG + Intergenic
1171862374 20:30412829-30412851 AGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1171862382 20:30412861-30412883 AGGAGGGAAGGAAGGAGAGAAGG + Intergenic
1171862449 20:30413107-30413129 GAGAGGGAAGGAAGGAGAGAGGG + Intergenic
1171889581 20:30698177-30698199 CTGAGGCAAGTCAGGAGAGAGGG - Intergenic
1171905050 20:30893695-30893717 CAGAGGGAAGGAGGGAGAGAGGG - Intergenic
1171993219 20:31712780-31712802 GTGTGGCCAGGGAGGAGGGAGGG + Intronic
1172036946 20:32017890-32017912 CTCTGGGGAGGGAGGAGGGCAGG + Intronic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172104846 20:32510791-32510813 GTGTGGGAAGGCAGGCGAGAGGG + Intronic
1172230090 20:33330640-33330662 CAGTGGGAAGGAAGGAGGGCTGG - Intergenic
1172449757 20:35013705-35013727 CTGTGGGCAGTGTGGAGAGGTGG + Intronic
1172481435 20:35274166-35274188 CTGTGGCAAGGGAGGCAAGGTGG - Intronic
1172614180 20:36272781-36272803 TGCTGGGAACGGAGGAGAGATGG + Intergenic
1172625613 20:36344898-36344920 CTTTGGGAGGGGAGGAGCCAGGG + Intronic
1172664160 20:36587532-36587554 CTGTGGGAGGGAGGGAGAGAAGG + Intronic
1172835771 20:37872161-37872183 CTGTGGGGAGGGGGCAGGGAGGG - Intergenic
1172877689 20:38175840-38175862 CCGTGGGAAGGGAGGTGACCTGG - Intergenic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1173249500 20:41357204-41357226 CTGTGGGAAGGGGAGGGAGAGGG + Intronic
1173307428 20:41863512-41863534 GTGGGGGAAGGTAGCAGAGATGG + Intergenic
1173343612 20:42177837-42177859 GGGAGGGAAGGGAGAAGAGAAGG - Intronic
1173586654 20:44187517-44187539 ATCGGGGAAGGGAGGGGAGAGGG + Exonic
1173865851 20:46312383-46312405 GAGTGGGAAGGAAGGAGGGAAGG - Intergenic
1173892335 20:46522574-46522596 GTGGGGAAAGGGAGGAGAGTGGG + Intergenic
1173934571 20:46850097-46850119 TTATGGGAAGTGGGGAGAGAAGG + Intergenic
1173950064 20:46985226-46985248 TTGGAGGAAGGGAGGAAAGAAGG - Intronic
1173994110 20:47324647-47324669 CTGAGTGAATGAAGGAGAGAAGG - Intronic
1174272589 20:49380570-49380592 CTGAGGGAAGGGGAGAGGGAGGG - Intronic
1174299011 20:49568468-49568490 GTGATGGAAGGGAGGGGAGAGGG + Intergenic
1174330045 20:49810820-49810842 CTGTGCTAACGGAGGAGAGTAGG + Intergenic
1174391891 20:50222912-50222934 CTGTGGGAAGTGTGGGGCGAGGG - Intergenic
1174509106 20:51037676-51037698 CTGGGGCGAGGGAGGACAGATGG + Intergenic
1174837020 20:53866167-53866189 CTGTGGCTGGGGAGGAGAGGAGG - Intergenic
1175101216 20:56580112-56580134 CTGTAGAAATGGAGGAGGGAAGG + Intergenic
1175153721 20:56955162-56955184 TCGGGGGAAGGCAGGAGAGATGG - Intergenic
1175372603 20:58502047-58502069 CTGTGAGAGGAGAGGAGAAAGGG - Intronic
1175376203 20:58525666-58525688 CTCTGGGAAGGGGGCAGGGAAGG + Intergenic
1175461581 20:59155667-59155689 CTGAGTGTAGGAAGGAGAGAAGG + Intergenic
1175552590 20:59827001-59827023 CTATGGGAGGGAAGGAGGGAGGG - Intronic
1175644048 20:60656535-60656557 CTGTGGGCAGGCAGATGAGAGGG + Intergenic
1176003763 20:62848076-62848098 CCGCAGGAAAGGAGGAGAGAAGG + Intronic
1176289820 21:5037971-5037993 CAGTGGGGAGGGGGGAGAGCGGG - Intronic
1176289841 21:5038023-5038045 CAGTGGGGAGGGGGGAGAGCGGG - Intronic
1176382698 21:6121121-6121143 CTGTGGGAACAGAGGACAGGTGG - Intronic
1176609401 21:8864615-8864637 CTGAGGCAAGTCAGGAGAGAGGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177113002 21:17050902-17050924 CTGTGGGGAGGGAAGTGAGGTGG + Intergenic
1177123946 21:17172544-17172566 TTGTGGGGAGGGGGGAGGGATGG - Intergenic
1177817808 21:25997321-25997343 CTGAGGGAAGGGAAGAGGGGAGG - Intronic
1178220493 21:30652200-30652222 GTGGGGGGAGGGAGGAGGGATGG + Intergenic
1178286550 21:31330200-31330222 CAGGGGCTAGGGAGGAGAGAGGG - Intronic
1178300633 21:31450013-31450035 CTGTGGGGAGGGAAGAGGCAAGG - Intronic
1178403039 21:32303559-32303581 AGGAGGGAAGAGAGGAGAGAGGG + Intronic
1178603981 21:34019127-34019149 CAGTGAGAAGGGAGCAGGGAGGG - Intergenic
1178794030 21:35727001-35727023 CTGTGGGCAAGGAGGAGGGTAGG - Intronic
1178915874 21:36705400-36705422 CTGGGGTAGGGGAGGGGAGAGGG - Intronic
1178932229 21:36829740-36829762 CTCTGGGAAGGGAATAGAGTGGG - Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179142678 21:38740842-38740864 CTGGAGCAAGGAAGGAGAGAAGG - Intergenic
1179401553 21:41089312-41089334 CTTTGAGAAGGGTAGAGAGAGGG + Intergenic
1179597943 21:42455670-42455692 CTGGGAGAGGGAAGGAGAGAGGG + Intergenic
1179740771 21:43417118-43417140 CTGTGGGAACAGAGGACAGGTGG + Intronic
1179867410 21:44225616-44225638 CAGTGGGGAGGGGGGAGAGCGGG + Intronic
1179922927 21:44516864-44516886 CTCTGGGAAGGAAGGAGGGGAGG - Intronic
1180072870 21:45445554-45445576 CTGCAGGAAGGGACGTGAGATGG - Intronic
1180104291 21:45607677-45607699 CAGAGGGAGGGGAGGAGGGAGGG + Intergenic
1180295193 22:10928297-10928319 GAGAGGGAAGGAAGGAGAGAGGG - Intergenic
1180295242 22:10928483-10928505 AGGAGGGAAGGAAGGAGAGAGGG - Intergenic
1180359496 22:11874462-11874484 CTGAGGCAAGTCAGGAGAGAGGG + Intergenic
1180413437 22:12637590-12637612 AGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1180729380 22:17970186-17970208 TGGTGAGAAGGGAGGACAGATGG + Intronic
1180748936 22:18111190-18111212 CTGTGGACAGAGTGGAGAGAAGG + Intronic
1180936619 22:19629675-19629697 ATTTGGGATGGGAGGAGAAAAGG + Intergenic
1180990206 22:19931099-19931121 CTGAGAGAAGGGATGAGAGGTGG + Intronic
1181043229 22:20202769-20202791 CTGTGGGACTGCAGGGGAGACGG + Intergenic
1181069467 22:20323537-20323559 GTGTGGGATGGGAGGAGGGCGGG + Intergenic
1181086460 22:20441779-20441801 ATCTAGGCAGGGAGGAGAGAAGG + Exonic
1181432490 22:22890224-22890246 CTCTGGGAAGAGGTGAGAGATGG - Intronic
1181439006 22:22926314-22926336 GTGGGGGAAGGGAGGAGCGGAGG - Intergenic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181537867 22:23556056-23556078 ATGTGGGCAGGGAGGAGAGCTGG + Intergenic
1181674793 22:24444645-24444667 CTTTGGGAAGGGCAGGGAGAGGG - Intergenic
1181773487 22:25143510-25143532 AGGAAGGAAGGGAGGAGAGAAGG - Intronic
1182093162 22:27609599-27609621 CTGGGGGAAGGGACGGGAGCGGG - Intergenic
1182250114 22:28993383-28993405 ATGTTGAAAGGGAGGAGAGCTGG + Intronic
1182255032 22:29031797-29031819 CTGTGGTCAGGGAGGGGAAAAGG - Intronic
1182325859 22:29512135-29512157 GGCTGGGAAGAGAGGAGAGAGGG + Exonic
1182336776 22:29588830-29588852 CTTTGGGAAGGGAAGAGGGCAGG - Intergenic
1182468123 22:30530833-30530855 CTCTGGGAAGGGCTGAGAGTAGG - Intronic
1182862723 22:33574064-33574086 ATGTGGGAAGGGACTAGACATGG + Intronic
1183332884 22:37230700-37230722 GTGGGGAAAGGGAGGAGAGAAGG + Intronic
1183367180 22:37412938-37412960 CTGTGTCAAGGGAAGGGAGAGGG - Intronic
1183459598 22:37941808-37941830 CTATGGGAGAGGAGGAGTGATGG + Exonic
1183700715 22:39449459-39449481 CTCTGGGCAGGGAGCAGGGAGGG + Intergenic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183777545 22:39976686-39976708 CTGTGGAATGGGTGCAGAGAAGG - Intergenic
1184092477 22:42299810-42299832 ATGGGGGAGGGGAAGAGAGAAGG + Intronic
1184109043 22:42384490-42384512 CTGGGGGCATGGAGCAGAGAGGG - Exonic
1184134966 22:42542738-42542760 GTGGGGGAGGTGAGGAGAGACGG + Intergenic
1184159320 22:42688510-42688532 TTCTGGGAAAGGAGGAGGGAGGG + Intergenic
1184178274 22:42802105-42802127 CTGTGGGAAGAGTGAGGAGAGGG + Intronic
1184291153 22:43498780-43498802 GTGGGGGCAGAGAGGAGAGATGG - Intronic
1184309094 22:43629631-43629653 ATGAGGGACGTGAGGAGAGAGGG + Intronic
1184450759 22:44581204-44581226 CCGTGTGAATAGAGGAGAGATGG + Intergenic
1184564939 22:45286142-45286164 CTGTCTGCAGGGAGGAGGGAAGG + Intronic
1184642362 22:45879407-45879429 GTGTGGGAAGGAGGGAGGGAAGG - Intergenic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
1184706195 22:46215150-46215172 CTGGGGAAAAAGAGGAGAGACGG - Intronic
1184799627 22:46751751-46751773 CTGAGGGAAGTGGGGAGATAGGG - Intergenic
1185013758 22:48331771-48331793 CTGAGGGATGGGAAGAGAGGAGG + Intergenic
1185031582 22:48446289-48446311 CACTTGGCAGGGAGGAGAGAAGG - Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185310295 22:50150547-50150569 CAGGGGGAAGCGGGGAGAGACGG + Intronic
1185342220 22:50296798-50296820 CGGTGGGGTGGGAGGAGAGTGGG - Intronic
1185379946 22:50503700-50503722 CTGTGGGAGGGAGGGAGGGAGGG + Intronic
949432424 3:3991873-3991895 CGGAGGGAAGGAGGGAGAGAAGG + Intronic
949467318 3:4357158-4357180 TTGTTGGAAGGAAGGAGGGAAGG + Intronic
949481370 3:4496673-4496695 TTGCGGGGAGGGAGGAGAGTGGG + Intronic
949518005 3:4824668-4824690 CTGCGGGTAGAGAGGAGAGTGGG + Intronic
949854735 3:8451113-8451135 CTGTGGGAGGGGAAGAGAAATGG - Intergenic
949926428 3:9045957-9045979 CAGTGAGAATGGAGGAGAAAGGG - Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950408457 3:12819094-12819116 CTGAAGGCAGGGAGGTGAGAAGG - Intronic
950706914 3:14788555-14788577 ATGTGGCCAGGGAGGTGAGATGG + Intergenic
950730742 3:14954699-14954721 CTATGGGAAGGGGTGTGAGAGGG + Intronic
950863387 3:16170038-16170060 CTGAGGGAAGGGAGGAGTTGGGG + Intergenic
951028401 3:17853920-17853942 TTGGGGGAGGGGAGTAGAGATGG - Intronic
951258407 3:20478443-20478465 AGATGGGAAGGGAGGAGGGAGGG + Intergenic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
951532702 3:23712651-23712673 CTGTGTGAGTCGAGGAGAGATGG + Intergenic
951706085 3:25545711-25545733 TGCTGGGCAGGGAGGAGAGAGGG - Intronic
951829922 3:26915048-26915070 CTGAGGGAAGGCTGGGGAGAAGG + Intergenic
951937394 3:28036952-28036974 CTTTGGGATGGAGGGAGAGAGGG - Intergenic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
951990271 3:28668820-28668842 CTGTGGGAAGGAGGTAGAAAAGG - Intergenic
952053583 3:29416208-29416230 GTGTGGGAGAGGTGGAGAGATGG + Intronic
952172755 3:30826932-30826954 ACGTGGGATGGGATGAGAGAAGG + Intronic
952331464 3:32367736-32367758 CTGTGGGAGGGTGGGGGAGAAGG - Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952504151 3:33992503-33992525 CTGAGGGAAGGGAGCAGGGCAGG - Intergenic
952947568 3:38489552-38489574 TTGTGGATTGGGAGGAGAGAGGG + Exonic
953134742 3:40172761-40172783 GTGGGGGAAGGAAGGGGAGAGGG - Intronic
953228369 3:41041878-41041900 CTGTTGGAAAGGAGGAGGAAGGG + Intergenic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953372445 3:42400771-42400793 ATGTGGGACGGGGGGAGAAAAGG + Intronic
953374280 3:42415691-42415713 TTGTGGGGAGGAAGAAGAGAAGG + Intergenic
953903728 3:46857814-46857836 GGGAGGGAAGGAAGGAGAGAAGG + Intergenic
954329126 3:49879982-49880004 CTGGGGGAAGGGAGCAGAACTGG + Intergenic
954361899 3:50126574-50126596 CCTTGGGGAGGGAGGACAGATGG - Intergenic
954590356 3:51777456-51777478 CGGTGGGAAGGGAGGTGTGCAGG - Intergenic
954621235 3:51996816-51996838 CAGAGGGGAGGAAGGAGAGAGGG + Intergenic
954677367 3:52323318-52323340 CTGGGGGCAGGGAAAAGAGAGGG + Intronic
954744270 3:52778159-52778181 CTGTGGGATATGAGGTGAGATGG - Intronic
954800707 3:53185583-53185605 CTCTGGGGAGGGAGCAGAGGTGG - Exonic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
955692546 3:61604795-61604817 TTGTGGCAAAGTAGGAGAGAAGG + Intronic
955756629 3:62231282-62231304 TTCTGGGGAGAGAGGAGAGAAGG + Exonic
956350864 3:68334833-68334855 CTGAGGGATAGGAAGAGAGAGGG + Intronic
956541528 3:70345119-70345141 CTGTGGTAATGGATTAGAGATGG - Intergenic
956690721 3:71875620-71875642 CTAAGGGGAGGGAGGAGGGATGG + Intergenic
956848621 3:73207185-73207207 CTTTGGGAAAAGAGCAGAGAAGG - Intergenic
956916543 3:73877903-73877925 ATGTGGGAAGGAAGGAAATATGG + Intergenic
957078224 3:75618184-75618206 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
957094450 3:75765653-75765675 CTGTGGGAAGCCAGGGGAGGTGG - Intronic
957550164 3:81694172-81694194 ATGAGGGAAGGGGGGAGAAAAGG + Intronic
957683423 3:83469681-83469703 GAGGGGGAAGAGAGGAGAGATGG + Intergenic
957885014 3:86275551-86275573 ATTTGGGAAGGAAGGAGGGAGGG - Intergenic
957938701 3:86977241-86977263 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958018644 3:87971009-87971031 CTGTGGAAGGGGAGGAGGCAGGG - Intergenic
958039068 3:88204816-88204838 AGATGGGAAGAGAGGAGAGAGGG + Intergenic
958058890 3:88451664-88451686 CAGTTGGAAGGAAGAAGAGAAGG - Intergenic
958637801 3:96766879-96766901 ATGTGGGTAGGAAGGAGAGGAGG - Intergenic
958904984 3:99932172-99932194 GAGTGGGAAGGGAGGAGAAGGGG - Intronic
958958011 3:100482166-100482188 CAATGAGAAGGGAGGAGAGCTGG - Intergenic
960051366 3:113241934-113241956 CTGGAGGCAGGGTGGAGAGAGGG + Intronic
960812349 3:121636965-121636987 GTGAGGGGAGAGAGGAGAGATGG - Intronic
960875870 3:122294876-122294898 CTGTAAAAAGGAAGGAGAGAGGG + Intergenic
960942864 3:122945915-122945937 ATGGGGGAAGTGGGGAGAGAAGG + Intronic
960945018 3:122960207-122960229 CTGGGGGAAGTGAGTAGAAATGG - Intronic
961173561 3:124816108-124816130 CAGTGGGAAGGGGGAAGAAAGGG + Intronic
961243473 3:125432231-125432253 CTGTGGGCAAGGAGGTGTGAGGG - Intergenic
961396784 3:126599195-126599217 AGGTGGGAAGGAAGGAGGGAGGG - Intronic
961597365 3:128029109-128029131 CTGTGGAGAGGGTGGAGAGGAGG - Intergenic
961617433 3:128193869-128193891 CTCTGGCATGGGAGGACAGAAGG + Intronic
961697810 3:128718093-128718115 CTGTGGGAAAAGAGGAGAAAAGG + Intergenic
962070466 3:132028522-132028544 ATGGGGGAAGGGATAAGAGATGG + Intronic
962207216 3:133444866-133444888 CTGTGGGAAGAGAGGATTGGAGG - Intronic
962878013 3:139550700-139550722 CAGTTGGAAGGAAGGACAGAAGG - Intergenic
962921833 3:139957311-139957333 CTGTGGGTAGGGAGAAGATGAGG - Intronic
963101090 3:141604760-141604782 GTGTGGGGAGGGGGGAGGGATGG + Intronic
963136382 3:141909255-141909277 CTGCTGGAAGGGAGGAGGGCAGG - Intronic
963875869 3:150473538-150473560 GTCGGGGGAGGGAGGAGAGATGG + Intergenic
963972545 3:151445532-151445554 CTGAGTAAAGGGAGGGGAGATGG + Exonic
964231620 3:154476651-154476673 GTGAAGGAAGAGAGGAGAGAGGG + Intergenic
964258666 3:154809074-154809096 GGGAGGGAGGGGAGGAGAGAGGG - Intergenic
964271358 3:154959704-154959726 CTATGGGATGGGATGGGAGAAGG + Intergenic
964969464 3:162542090-162542112 AGGAAGGAAGGGAGGAGAGAGGG - Intergenic
965300300 3:166999204-166999226 TTGTGCTAAGGGAGGAGAGGGGG + Intergenic
965514545 3:169606788-169606810 CTGCAGGAAGGGAGAAAAGAGGG + Intronic
965551149 3:169966643-169966665 CGGAGGGAAGAGGGGAGAGAAGG + Intronic
965630896 3:170731437-170731459 CAGTAGGAGGGGAGCAGAGAGGG + Intronic
965714816 3:171591597-171591619 CTGGGGGATGGGGGGAGGGAGGG - Intergenic
966247641 3:177826415-177826437 CTTTGGGAAGTGAGAAGGGAAGG + Intergenic
966553623 3:181233091-181233113 CTGTGAGAAGATAGAAGAGATGG + Intergenic
966599112 3:181757559-181757581 CTTTGGGAAGTTAGGATAGAAGG + Intergenic
966786851 3:183630151-183630173 CTGAGGTAAGGGAGCAGAGGTGG + Intergenic
966937121 3:184717963-184717985 CTATGGGAAGTGTGGAGACAGGG + Intergenic
966967331 3:185007174-185007196 CTGTGGGAAGGAGGAAGAGGGGG - Intronic
967096654 3:186182795-186182817 TTGTTGGAAGAGGGGAGAGAGGG - Intronic
967531729 3:190555317-190555339 CTGAGAGTAGGGAGTAGAGAAGG - Intronic
967648602 3:191957454-191957476 CTGAGGGAAGGAGGGAGGGATGG + Intergenic
967925169 3:194640152-194640174 CTGCAGGAGGGGAGGCGAGACGG + Intergenic
967931141 3:194691121-194691143 CAGAGGGGAGGAAGGAGAGATGG - Intergenic
968005264 3:195238318-195238340 CTGTGGGAAGGCTGGAGGGGAGG - Intronic
968352859 3:198075914-198075936 TGGTGGGAAGGTAGGAGATAAGG - Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968612283 4:1562763-1562785 CTTTGGGAAGGGAGGTGTCAGGG + Intergenic
968727895 4:2256708-2256730 CTCTGGGAGGAGAGGACAGAGGG + Intronic
968887157 4:3341173-3341195 CGGAGGGGAGGGTGGAGAGATGG + Intronic
968887247 4:3341407-3341429 CGGAGGGGAGGGTGGAGAGATGG + Intronic
969021296 4:4142157-4142179 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969247683 4:5945978-5946000 CTGGAGAAAGGGAGGAGAGAAGG + Intronic
969260456 4:6030233-6030255 CTGGGGGATGGGGGGAGGGAGGG + Intronic
969426608 4:7128111-7128133 CTGCAGCAAGGGAGGAAAGAGGG + Intergenic
969624943 4:8297625-8297647 CTGTGGGAAGGGAGTGGGGCAGG + Intronic
969732569 4:8965259-8965281 ATGAGGGCAGAGAGGAGAGATGG - Intergenic
969792148 4:9499342-9499364 ATGAGGGCAGAGAGGAGAGATGG - Intergenic
969987669 4:11228127-11228149 TAATGGGAAGGGAGGAGAGCAGG + Intergenic
970050124 4:11904999-11905021 CTGTGGGAAGGGAGGATGAAGGG + Intergenic
970430855 4:15987774-15987796 TTGTGGGAAGGGAGGACACAAGG - Intronic
970450338 4:16160167-16160189 CTGTGGGAAGGGGACAGAGGAGG + Intergenic
970644008 4:18098581-18098603 CTGTGGGAAGGGGTCAGGGATGG + Intergenic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
971865171 4:32160520-32160542 GGGAGGGAAGGAAGGAGAGAAGG - Intergenic
972017655 4:34266226-34266248 AGGAGGGAAGGAAGGAGAGAAGG + Intergenic
972327012 4:38026333-38026355 CTGTGGGAGGGGAGGAGCCGTGG + Intronic
972374654 4:38459193-38459215 ATGTATGGAGGGAGGAGAGAGGG + Intergenic
972909273 4:43794627-43794649 CTCTGGGAACAGAGAAGAGAGGG - Intergenic
973016284 4:45142821-45142843 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973016298 4:45142884-45142906 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973133390 4:46676142-46676164 CTGTGGGACAAGAGGAGAAATGG - Intergenic
973258250 4:48135124-48135146 GTATGGGATGGGAGGAGGGAAGG + Intergenic
973555468 4:52077308-52077330 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
973737820 4:53889747-53889769 TGGTAGGCAGGGAGGAGAGAGGG + Intronic
973856818 4:55019740-55019762 GTGTGGGCTGGGAGGTGAGAAGG - Intergenic
975335844 4:73174076-73174098 GCGAGGGAAGGGAGGGGAGAAGG + Intronic
975811211 4:78171792-78171814 ATGTGAGGAGGGAGGAAAGAAGG - Intronic
975837627 4:78441328-78441350 TTGAGAGAAGGGAGGGGAGAGGG + Intronic
975957539 4:79859269-79859291 GAGTGGGAAAGGAGGTGAGAGGG - Intergenic
975996988 4:80327231-80327253 CTGGGGCAGGGAAGGAGAGATGG + Intronic
976075044 4:81288370-81288392 CTGTGGGAGGGGTGAAGGGAAGG - Intergenic
976089944 4:81446750-81446772 CTTTTGGAAGGAAGGAAAGAGGG - Intronic
976105004 4:81606916-81606938 CCTTGGGAAGGGAGGAGAACTGG + Intronic
976669240 4:87633635-87633657 ATGTGTGAAGGGAGGAAAAAGGG - Intergenic
978133332 4:105226605-105226627 CAGAGGGAGGGAAGGAGAGAGGG - Intronic
978177785 4:105755259-105755281 AGGTAGGAAGGAAGGAGAGAGGG + Intronic
978375048 4:108066188-108066210 CTGGGGACAGGGAGTAGAGAGGG + Intronic
978900813 4:113947532-113947554 GGGAGGGAAGGAAGGAGAGAGGG + Intronic
979101130 4:116615614-116615636 AGGAGGGAAGGAAGGAGAGAAGG + Intergenic
979417995 4:120466842-120466864 CTGTGGGAAGAAAGGAGGAAAGG + Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
980897137 4:138870584-138870606 CTGTAGGAAGGGAAGAGTCAGGG + Intergenic
981377917 4:144037373-144037395 CCAGGGGAAGTGAGGAGAGAAGG + Intergenic
981495743 4:145390494-145390516 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
981536272 4:145803061-145803083 AGGAGGGAAGGAAGGAGAGAGGG - Intronic
981563040 4:146067692-146067714 CTGTGAGAAGGAAGGAGAGAAGG - Intergenic
981817029 4:148842729-148842751 CTGGGGGAAGGGGGAATAGATGG - Intergenic
982088974 4:151864126-151864148 CTGTGGATTGGGAGGAGAGGTGG - Intergenic
982152085 4:152471367-152471389 AGGAGGGAAGGAAGGAGAGAAGG + Intronic
982157721 4:152537602-152537624 CTGCGGGAAAGGTGGTGAGAGGG + Intergenic
982307336 4:153946485-153946507 ATGTGGTGAGGCAGGAGAGATGG + Intergenic
982338705 4:154270640-154270662 CTGTGAGAACAGAGAAGAGAGGG + Intronic
982708589 4:158737261-158737283 CTGTCGTAAGGGAGGGGAAAGGG + Intergenic
982753847 4:159194977-159194999 CTGAGGGAATGGAGGAGTCAGGG + Intronic
983066525 4:163216298-163216320 AGGAAGGAAGGGAGGAGAGAGGG + Intergenic
984497031 4:180511484-180511506 AGGAGGGAAGGGAGGAGGGAAGG - Intergenic
984613497 4:181868255-181868277 GTGAGGGAAGGGAGGTGGGAGGG - Intergenic
984822046 4:183890528-183890550 AGGAGGGAAGGAAGGAGAGAGGG + Intronic
985025089 4:185732600-185732622 ATGTGGGAAGGGATGAGTGTTGG + Intronic
985273575 4:188216703-188216725 AAGAGGGAAGGAAGGAGAGAGGG - Intergenic
1202769842 4_GL000008v2_random:193892-193914 CTGAGGCAAGTCAGGAGAGAGGG - Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985559278 5:574271-574293 AGGTGGGAAGGGAGCAGAGGGGG + Intergenic
985709410 5:1419915-1419937 AAGTGGGAAGGAAGGGGAGAAGG - Intronic
985805384 5:2039265-2039287 CTGTGGGAAGGGACTGGGGAAGG - Intergenic
985859850 5:2462284-2462306 CTGGGGGAAGGGAGGAGGCCAGG - Intergenic
985962889 5:3316255-3316277 CTGGGGGACAGGAGGAGATAGGG - Intergenic
986006970 5:3676667-3676689 CAGAGGGAAGAGAGCAGAGAGGG - Intergenic
986150243 5:5121593-5121615 CTGAGGGAAGGAATGAGAGAAGG + Intergenic
986226035 5:5813539-5813561 ATGTGTGATGGAAGGAGAGACGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987183017 5:15386248-15386270 CTCTGGGGAAGGAGGAGGGATGG - Intergenic
987345874 5:16978534-16978556 GAGAGGGAAGGAAGGAGAGAGGG - Intergenic
987351467 5:17025896-17025918 TTGGGGGAGGGGAGGGGAGAGGG + Intergenic
988388663 5:30599051-30599073 GTGGGGGGAGGGAGGAGGGATGG - Intergenic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
989414367 5:41156242-41156264 TTGAGAGAAGGGAAGAGAGAAGG - Intronic
990182912 5:53182590-53182612 CTGTGGGCTGAGAGGAGAGGAGG + Intergenic
990283881 5:54280135-54280157 GAGTGGGAAGGAAGGAGGGATGG - Intronic
990346553 5:54877195-54877217 CTAGGGAAAGGGAGGAGAAAGGG + Intergenic
990446189 5:55896589-55896611 GTGGGGGAAGGGAGGGGAGGGGG - Intronic
990486268 5:56261831-56261853 CTATGGGAAGAGAGGAGGGATGG + Intergenic
990886682 5:60602182-60602204 GGGTGGGGAGGGAAGAGAGAGGG + Intronic
990976342 5:61564854-61564876 CTTTGGGAATGAAGGGGAGAAGG - Intergenic
991399256 5:66236261-66236283 CTCTGGGAGGGGAGAAGAGTTGG + Intergenic
991592147 5:68264656-68264678 CTGTGGGGTGGGAGGAGTTAGGG - Intronic
991950284 5:71940358-71940380 TTGTGAGATGGGAGGAGGGAAGG + Intergenic
992686599 5:79205374-79205396 ATGTGGTATGGGTGGAGAGAAGG - Intronic
992895187 5:81239486-81239508 CTTTGGGGAGGGAGGAGTGGGGG + Intronic
993283549 5:85959919-85959941 CGGAGGGAAGGAAGGAGGGAGGG - Intergenic
993899124 5:93572506-93572528 CTGCGGGGAGCGAGGAGGGACGG - Intergenic
994299309 5:98127377-98127399 GTGGGGGTAGGGTGGAGAGAGGG + Intergenic
994890207 5:105623606-105623628 CTCTGGGAAAGGAACAGAGAGGG + Intergenic
995150363 5:108836906-108836928 TTGGGGGAAGCGGGGAGAGAAGG - Intronic
995257246 5:110060934-110060956 CTATGGGAAGAGAGGCGATATGG + Intergenic
995735789 5:115297919-115297941 CTGTGAGAAGGGAGGAAAACCGG + Intergenic
995809844 5:116093360-116093382 CTGAGGAGAGGGAGGAGAGGTGG + Intronic
996546009 5:124679455-124679477 CTGAAGGAAGGAAGGACAGAAGG - Intronic
997202786 5:132022814-132022836 CTCTGGGAATGGAGGTGAGGGGG + Intergenic
997303660 5:132823872-132823894 CTGTGGGGAGGCTGGAGAGGAGG - Exonic
997372471 5:133370702-133370724 CTGTGGGAAGTGGGGAGAAGGGG + Intronic
997487106 5:134240512-134240534 CTGTTGGAAGGAGGGAGTGAGGG + Intergenic
997583096 5:135029322-135029344 CTGGGGGAGGGGACGGGAGAAGG + Intronic
997969723 5:138391431-138391453 CCGTGGGAAGGCTGGAGTGAGGG - Exonic
998368613 5:141646987-141647009 CTGTTGGGAGGGAGGTGAGCTGG + Intronic
998387561 5:141766570-141766592 TTGGGGAAAGGAAGGAGAGAGGG - Intergenic
998472206 5:142392062-142392084 AGGAGGGAAGGAAGGAGAGAAGG - Intergenic
998514864 5:142743785-142743807 ATGTGGGAAGGGATGAGTCATGG - Intergenic
998885881 5:146693115-146693137 GGGAGGGAAGGAAGGAGAGAGGG - Intronic
998996812 5:147875056-147875078 CTGAAGGAAGACAGGAGAGATGG + Intronic
999059980 5:148623373-148623395 CTGTGGGAAGAGACAAGAGATGG + Intronic
999477611 5:151915274-151915296 CTGAGGGAAGGCAGAAGAGAAGG + Intronic
999642232 5:153683091-153683113 CCCTGGGATGGGGGGAGAGAGGG + Intronic
999722874 5:154411901-154411923 GTGAGGGAAGGAAGGAGAGCCGG + Intronic
999845517 5:155475307-155475329 CTGTGGGAAGGGTGTGGAGTTGG - Intergenic
1000055484 5:157602521-157602543 CTGTGGCAAGGGGTGGGAGACGG + Intergenic
1000380820 5:160627910-160627932 TGGTGGGAAGAGAGGAGGGAGGG + Intronic
1000724248 5:164749317-164749339 CTCTGAGTAAGGAGGAGAGAAGG - Intergenic
1000895406 5:166849055-166849077 CTCAAGGAATGGAGGAGAGAAGG + Intergenic
1000975453 5:167759581-167759603 CAGAGGGACGTGAGGAGAGATGG + Intronic
1001638693 5:173230603-173230625 CTGTGGGAAGGAAGAGGAAAGGG - Intergenic
1001711804 5:173784773-173784795 CTGTGGGAGATGAGTAGAGATGG + Intergenic
1001802874 5:174558869-174558891 ATGAGGGAAGGAAGGAGGGAAGG - Intergenic
1001919421 5:175588685-175588707 AAGTGGGAGGGGAGGAGAAAAGG + Intergenic
1002024706 5:176389019-176389041 CGGAGGGAAGGAAGTAGAGAAGG + Intronic
1002340852 5:178515799-178515821 CTGTGGAAGGGAAGGAGAGCAGG - Intronic
1002364106 5:178696790-178696812 CTGGGGAGAGGGTGGAGAGAGGG + Intergenic
1002524023 5:179805984-179806006 CTGTGGGAGGGAGGGAGGGAGGG - Intronic
1002578992 5:180195853-180195875 CTGTGGGCAGGGAGGATGCACGG - Intronic
1002826365 6:777713-777735 CTGTGTGGAGGGATGGGAGAGGG + Intergenic
1002968789 6:1993127-1993149 CTGGGGCAAGGGAGAGGAGATGG - Intronic
1002990988 6:2238553-2238575 CAGTGGGAAGGAATGAGAGAAGG - Intronic
1003068202 6:2920921-2920943 CTGTGGGCAGGGAGGAGCCTTGG - Intergenic
1003130379 6:3390391-3390413 CTTTGGGGAGGGAGGAGAGAGGG - Intronic
1003534317 6:6962912-6962934 CAGAAGGAAGGGAGGTGAGATGG - Intergenic
1003965522 6:11248957-11248979 CTCTGGGGAGAGAGAAGAGAAGG - Intronic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1005127880 6:22469845-22469867 CTGTGGGGAGGGAGGCAATAGGG + Intergenic
1005183171 6:23130580-23130602 CTTTGGGAATGCAGAAGAGAAGG + Intergenic
1005228821 6:23674953-23674975 ATGTGGGAAGGGAAGAGAACAGG - Intergenic
1005355473 6:24979191-24979213 CAGTGGGAGTGGAGCAGAGAGGG - Intronic
1005531684 6:26713504-26713526 CTGTGAGGAGGGAGGAGAAAAGG - Intergenic
1005539111 6:26788161-26788183 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1005926469 6:30449588-30449610 ATGTGGGCAGGGAGAAGAGGAGG + Intergenic
1006009679 6:31032053-31032075 GTGTGGTGGGGGAGGAGAGATGG - Intronic
1006360443 6:33584324-33584346 GTTTGGGAAGGAGGGAGAGATGG + Intergenic
1006403287 6:33830044-33830066 GTGAGGGAGGGGAGGAGACAAGG - Intergenic
1006406948 6:33851001-33851023 CTGAGGTGAGGGAGGAGAGCTGG + Intergenic
1006595144 6:35187452-35187474 CTGTGGGGAGAGCAGAGAGATGG - Intergenic
1006679686 6:35788045-35788067 CTCTGGGTAGGGAGGAGAGCAGG - Exonic
1006727620 6:36211231-36211253 CAGGGAGAAGGGAGGACAGAAGG - Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006831458 6:36970614-36970636 CAGTGGGAAGGAAGGACAGCTGG + Intronic
1006898293 6:37484431-37484453 CAGTGGGAAGTGAGGGGTGAAGG - Intronic
1006945480 6:37781673-37781695 CTGTGGGAAGCTGGGAAAGAAGG - Intergenic
1006988560 6:38193702-38193724 CTGTGAGAGCGGAGGAGGGATGG - Intronic
1007088562 6:39167646-39167668 CAGCGGGAAGGGAAGAGTGAGGG + Intergenic
1007100377 6:39241977-39241999 CTGTGGGGCGGGAGCAGAGGCGG - Intergenic
1007614079 6:43170515-43170537 AGGCGGGCAGGGAGGAGAGACGG - Intergenic
1007909467 6:45499047-45499069 GTGTGGGTATGGAGGAGAGTGGG + Intronic
1007951166 6:45873680-45873702 CTGTGAGGAGGGAGGAGGCATGG - Intergenic
1008193314 6:48486882-48486904 CTGTGGGATGGGACTAGAGTGGG - Intergenic
1008487517 6:52051966-52051988 CTATGGAAACAGAGGAGAGATGG + Intronic
1008617596 6:53241333-53241355 CTGTGGGAAGGAATGAGTGAGGG + Intergenic
1009009945 6:57830387-57830409 CTGTGAGGAGGGAGGAGAAAAGG + Intergenic
1009443076 6:63705578-63705600 CGGTGGGATGAGGGGAGAGATGG - Intronic
1009942467 6:70305001-70305023 CTCTGGTAAGAAAGGAGAGAGGG + Intergenic
1010350638 6:74870219-74870241 CTGGGGGAAAGGAGGAAATAAGG - Intergenic
1011531136 6:88322298-88322320 ATGTGGGAAAAGAGGAGAGGAGG + Intergenic
1011550504 6:88527482-88527504 CTGAGGGAGGGAAGGAAAGAAGG + Intergenic
1012827024 6:104159248-104159270 CTTTGGGTAGGGAGGGTAGAGGG + Intergenic
1012905145 6:105055771-105055793 CTGTCTGAAGGGTGGAGGGAAGG - Intronic
1012925512 6:105263357-105263379 CTGTGAGAGGGGAGGACACAGGG + Intergenic
1012934182 6:105348537-105348559 ATGGGGGAAAGGAGGAGAGGGGG + Intronic
1013309668 6:108881321-108881343 CTGTTGGAAGGAAGGAAGGAAGG - Intronic
1013473517 6:110486961-110486983 GTGTGGGAAGTGAAGTGAGAGGG - Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013917837 6:115363587-115363609 CTATGGGAAAGGAAGTGAGATGG - Intergenic
1013971605 6:116026525-116026547 AGGGGGGAAGGGAGGAAAGAAGG + Intronic
1014418290 6:121211142-121211164 CTGTGGGCGGGGCGGAGGGAGGG + Intronic
1014561877 6:122900986-122901008 GAGAGGGAAGGAAGGAGAGAAGG - Intergenic
1014795328 6:125718018-125718040 CTGGCAGAAGGGTGGAGAGAGGG + Intergenic
1015785482 6:136918587-136918609 TTTTGGGAAAGGGGGAGAGAGGG - Intergenic
1015847924 6:137540706-137540728 CTGTGTGTAGGAAGGAGAGGAGG + Intergenic
1015982408 6:138852477-138852499 TTGTGGGATGAGGGGAGAGAAGG + Intronic
1016403269 6:143703226-143703248 CTGGGGGAATAGAGGTGAGAGGG + Intronic
1016731793 6:147435487-147435509 CTTTGGGAAAGGAGGTGAGGAGG - Intergenic
1016885938 6:148959768-148959790 CTGTCCCAAGGCAGGAGAGATGG - Intronic
1017156194 6:151324547-151324569 CTTGGGGCAGGGAGGAGGGAGGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017308732 6:152952097-152952119 CTGAGGAAAGTGAGTAGAGAAGG + Intergenic
1017318612 6:153062267-153062289 CTGGGGGTAGGGAGGAGAGGTGG - Intronic
1017712556 6:157183401-157183423 GTGTGGCAAGGGAGGAGGTAAGG - Intronic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018074595 6:160200671-160200693 CTGTGGGAAGAGAGGTGGGGAGG - Intronic
1018318137 6:162577683-162577705 CTTTGGGAAGCCAAGAGAGAAGG + Intronic
1018737775 6:166701634-166701656 CTGCGGGGAGGGAGGAGTCATGG + Intronic
1018880353 6:167872521-167872543 CTGTGTGGAGGGAGGATAGAGGG + Intronic
1019231881 6:170573097-170573119 CTGTTGGAGGTGAGGAGATAAGG + Intergenic
1019316637 7:390058-390080 CTGTGGGAAGGCCAGAGGGAAGG - Intergenic
1019345123 7:526010-526032 CTGTGGGCACGGTGGAGAGACGG - Intergenic
1019428727 7:988882-988904 CTGTGGGGTGGGAGGAGAGAGGG - Exonic
1019475112 7:1240675-1240697 GAGTGGGGAGTGAGGAGAGAAGG + Intergenic
1019539332 7:1544719-1544741 CAGGAGGCAGGGAGGAGAGAGGG + Exonic
1019551788 7:1606800-1606822 GAGTGGGAGGGGAGGAGGGAGGG - Intergenic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019932111 7:4230469-4230491 CAGGGGGAAGGAAGGAGGGAGGG + Intronic
1020278061 7:6636836-6636858 GGGTGGGGAGGGAGGAGGGACGG - Intergenic
1020308715 7:6854186-6854208 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
1020452666 7:8337632-8337654 CTTTGGACAGGGAGCAGAGATGG + Intergenic
1020456865 7:8383870-8383892 CTGAGGGAAAGGGGGAAAGAAGG + Intergenic
1020883293 7:13791364-13791386 CTGTAGGCAGGCAGGAAAGAGGG - Intergenic
1021075343 7:16297430-16297452 GAGTGGTAAGGCAGGAGAGAAGG + Intronic
1021372777 7:19870604-19870626 CTCTGAGAAGGTGGGAGAGATGG - Intergenic
1021653470 7:22853639-22853661 CTGTGAGGAGGAAGGGGAGAAGG - Intergenic
1021703358 7:23342070-23342092 CTGCGGGTAGGGAGGAGTCATGG + Exonic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1021970686 7:25962934-25962956 GTGTGGGAAGGGCTGAGAGGTGG + Intergenic
1021988445 7:26119647-26119669 CTGAGGGAGGTGAGGAGAAATGG + Intergenic
1022530130 7:31061744-31061766 CTGTGGGAGGCAAGGAGAGAGGG + Intronic
1022538231 7:31111500-31111522 TGGAGGGAAGGGAGGAGAGGAGG + Intergenic
1022805284 7:33815173-33815195 CTGGGGGAAGCGTGGAGAGGAGG + Intergenic
1023060174 7:36319167-36319189 CTGCTGGAAGGGAGAAGAGCGGG + Intergenic
1023279592 7:38555965-38555987 TTGTGGGGAAGGAGGAGGGAAGG + Intronic
1023533240 7:41181379-41181401 ATGTGTGAAGGGAGGACAGCTGG + Intergenic
1023580206 7:41673539-41673561 ATGTGGGAGGGGAGGACACATGG + Intergenic
1023664690 7:42510594-42510616 CTGTGGGAAGTGAGGAGCCCTGG + Intergenic
1023674716 7:42617470-42617492 CTGTGTGCAAGCAGGAGAGAGGG - Intergenic
1023821863 7:43985103-43985125 GCTTGGGAGGGGAGGAGAGAGGG + Intergenic
1023921890 7:44636252-44636274 CTGGGGGAAGGGATGTCAGATGG + Intronic
1023935560 7:44737522-44737544 AGGTGGGCAGGGAGGAGAGAAGG - Intergenic
1024022449 7:45384613-45384635 CTAAGGAAAGGAAGGAGAGAGGG - Intergenic
1024555600 7:50600581-50600603 CAGAGGGAAGGAAGGAGAGAGGG + Intronic
1025146952 7:56513550-56513572 CCATTGGAATGGAGGAGAGATGG - Intergenic
1025175366 7:56798178-56798200 CTTTGGGAAGGCAGGGTAGAAGG - Intergenic
1025198872 7:56949954-56949976 CTGGTAGAAGGGAGGAGGGAGGG - Intergenic
1025673074 7:63626979-63627001 CTGGTAGAAGGGAGGAGGGAGGG + Intergenic
1025696434 7:63778235-63778257 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1025913214 7:65844545-65844567 CTTTGGGAAGGCAGGGTAGAAGG + Intergenic
1025936430 7:66041438-66041460 ATTTAGGAAGTGAGGAGAGAGGG + Intergenic
1025957360 7:66193225-66193247 GGGAGGGAAGGAAGGAGAGAGGG + Intergenic
1026161924 7:67877131-67877153 CAGTGAGAAGGGAGCAGTGAAGG + Intergenic
1026605920 7:71815778-71815800 GGGTGGGAAGGGAGGAAAGGGGG - Intronic
1026739031 7:72966977-72966999 CTGGGGAAGGGGAGGAGAGAAGG - Intronic
1026790051 7:73325609-73325631 CTGGGAAAGGGGAGGAGAGAAGG - Intronic
1026907137 7:74069026-74069048 CTGGGGGGAGGGAGGAGGGAAGG + Intronic
1026928439 7:74209893-74209915 TGGGGGGAAGGGAGGGGAGACGG - Exonic
1027104702 7:75398096-75398118 CTGGGGAAGGGGAGGAGAGAAGG + Intronic
1027582127 7:80011109-80011131 ATGTGGAAAGGGTGGAGAGTGGG + Intergenic
1027588496 7:80088335-80088357 GGGTGGGAAGGGAGGAGAATTGG - Intergenic
1028408422 7:90501423-90501445 CTTTTGGAAGCGAGGTGAGAGGG + Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028903485 7:96126789-96126811 ATTTGGGAAGACAGGAGAGATGG + Intronic
1028960055 7:96738524-96738546 GTGTGGGAAAGGAGGAGGAAAGG + Intergenic
1029601093 7:101563885-101563907 CTGTGGAGAGGGAGGAGGGAAGG - Intergenic
1029750130 7:102538525-102538547 GCTTGGGAGGGGAGGAGAGAGGG + Intronic
1029768081 7:102637633-102637655 GCTTGGGAGGGGAGGAGAGAGGG + Exonic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1029968328 7:104763818-104763840 TTGTTGGAAGGGAGAAGAGCAGG - Intronic
1030006336 7:105124273-105124295 CAGCGGGAAGGAAGGAAAGAGGG - Intronic
1030053477 7:105560456-105560478 CGGGGGCACGGGAGGAGAGAGGG + Intronic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030170404 7:106596169-106596191 GGATGGGAAGGAAGGAGAGAGGG + Intergenic
1030328510 7:108247835-108247857 CTGGAGAAAGGGAGGAAAGAGGG + Intronic
1030943306 7:115682495-115682517 GAGTGGGAAGTGAGGAGACAGGG - Intergenic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1031856125 7:126924622-126924644 CAGAAGGAAGGGAGGAAAGAAGG - Intronic
1032231622 7:130079768-130079790 GTGTGGGAAGGGAGGAGGTAGGG - Intronic
1032244496 7:130198063-130198085 GGGTGGGAAGGAAGGAGAAAAGG - Intronic
1032488950 7:132309522-132309544 GTGTGGGCAGAGAGGAGAGGAGG - Intronic
1032928505 7:136637891-136637913 TGGTGGGAAGAGGGGAGAGAAGG - Intergenic
1032969239 7:137139614-137139636 TTGTGGGGTGGGAGGAGAGGGGG + Intergenic
1033154580 7:138946022-138946044 AAGAGGGAGGGGAGGAGAGAAGG - Intronic
1033346080 7:140526536-140526558 GAGTGGGAAGGAAGGAGAGGTGG - Intronic
1033396226 7:140976396-140976418 GGGTGGGAATGGAGGAGACAGGG - Intergenic
1033451007 7:141462469-141462491 ATGTGGGGAGAGAGGAGAGCTGG + Intronic
1033459029 7:141528734-141528756 CTGTTGGAGAGGAGGGGAGATGG - Intergenic
1033595627 7:142856040-142856062 CCCAGGGATGGGAGGAGAGAGGG - Intronic
1033639387 7:143246703-143246725 ATGTGGGAAGGGAAGGGATATGG - Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1034062754 7:148108089-148108111 CTCTGGGGAGGGAGGAGACAGGG + Intronic
1034076754 7:148239398-148239420 CTATGGGAAGAGAAGAGAGAGGG + Intronic
1034204753 7:149305606-149305628 CAATGGGAAGGGGGCAGAGAAGG + Intergenic
1034215059 7:149398763-149398785 GTGAGGGAAGGGAGGAGAACGGG - Intergenic
1034379057 7:150673868-150673890 GTGGGGGAAGGGGGGAGGGATGG - Intergenic
1034459619 7:151191303-151191325 CCTTGGGAATGCAGGAGAGAGGG - Intronic
1034776123 7:153828273-153828295 CTGTGGCATAGCAGGAGAGAGGG + Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035012418 7:155731216-155731238 CTGATGGAAGGTAGGAAAGAAGG + Intronic
1035038085 7:155908372-155908394 CTGAGGGCAGGGAGGAGAGGGGG - Intergenic
1035061151 7:156070633-156070655 CTGCAGGAAGGGAGGGGAGGCGG - Intergenic
1035218605 7:157390693-157390715 CTGTGGGAAGGCAGAGGAAAAGG - Intronic
1035265827 7:157689986-157690008 GTGTGGGAAAGGAGGAGGGAAGG - Intronic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035400716 7:158563704-158563726 ATGTGTGAGGGGAGAAGAGAGGG + Intronic
1035559388 8:593490-593512 CTGAGGGGAGGGATGTGAGAGGG + Intergenic
1035700645 8:1637167-1637189 CTCTGGGAAAGGAGGATAGGAGG - Intronic
1035746698 8:1966290-1966312 GCGTGGGAAGTGAGGAGAGTGGG - Intergenic
1035776253 8:2191148-2191170 AGGGAGGAAGGGAGGAGAGAAGG - Intergenic
1035989088 8:4468223-4468245 CTGGGGAAAGGAAGGAGAGCTGG + Intronic
1036579640 8:10061999-10062021 GTGGGGGAAGGGAGGAAAGGAGG + Intronic
1036682501 8:10885832-10885854 CCTGGGGAAGGGAGAAGAGATGG + Intergenic
1036693043 8:10956763-10956785 CTGTGGCCAGTGAGGACAGAAGG + Intronic
1037018348 8:13936859-13936881 CTGTGGGTGGGGTGGAGGGAGGG - Intergenic
1037098045 8:15008767-15008789 CGGAGGGAGGGGAGGAGGGAGGG + Intronic
1037098056 8:15008791-15008813 CGGAGGGAGGGGAGGAGGGAGGG + Intronic
1037339809 8:17832254-17832276 CGGGAGGAAGGGAGGAGGGAGGG + Intergenic
1037766946 8:21777965-21777987 CAGTGGGGAGGATGGAGAGAGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037935538 8:22912902-22912924 GTGTGGGAAGGCAGGTGAGGAGG - Intronic
1038103607 8:24408496-24408518 ATATGGGAAGGGAGGAAATAGGG + Intergenic
1038138528 8:24816899-24816921 ATGTGGGAAGAGAAAAGAGAAGG - Intergenic
1038373510 8:27015194-27015216 TAGTGGGAAGGAAGGAGAAAGGG + Intergenic
1038486350 8:27937761-27937783 CTGTGGGAGGGCAAGAGAGAAGG - Intronic
1038599869 8:28929352-28929374 TTGTGAGAAGGGAAGTGAGAAGG + Intronic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1038967924 8:32596231-32596253 CTGTAGGAAGTAAGAAGAGATGG + Intronic
1039140803 8:34385641-34385663 CTAAGGGAAGGAAGGAGAGGTGG + Intergenic
1039428530 8:37506529-37506551 GTGAGGGAAGGTAGGAGGGAGGG + Intergenic
1039439205 8:37583284-37583306 GTGTGGGTCGGGGGGAGAGATGG - Intergenic
1039803673 8:40981253-40981275 CCGTGGGCAGGGAGGAGGGATGG + Intergenic
1040425745 8:47284285-47284307 CTGTAGGCAGGCAGGAGAAATGG - Intronic
1040436785 8:47398872-47398894 CTGAGGCAAGTGAGGAGAGAGGG + Intronic
1041465961 8:58157872-58157894 CTCAGGGAAGAGAGGTGAGATGG - Intronic
1041516135 8:58700699-58700721 CCCTGGGAAGGAAGGAAAGAAGG + Intergenic
1041628195 8:60055099-60055121 AAGTGGGAGGGAAGGAGAGAGGG + Intergenic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042224411 8:66504320-66504342 CTCTCGGAAAGGAGGAGTGAGGG - Intronic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042407225 8:68419832-68419854 GTGGGGGAAGGGGGGAGGGATGG + Intronic
1042487984 8:69367513-69367535 TGGTGGGAAGGGAGGAAAGTAGG - Intergenic
1042530176 8:69806639-69806661 CAGTGGGAAGGGAGTGGAGGTGG - Intronic
1043636181 8:82385786-82385808 ATGTGGGAAGTGAGTAGAAATGG + Intergenic
1043822895 8:84890347-84890369 CTCTGGGGAATGAGGAGAGATGG + Intronic
1044144260 8:88692048-88692070 TTGTGGGGTGGGAGGAGGGAGGG - Intergenic
1044462053 8:92457191-92457213 GGGTGGGAAGGGAGGGGAAAAGG + Intergenic
1044503728 8:92992234-92992256 CTGGGGGAGTGGAGGAGAAATGG + Intronic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045010175 8:97951895-97951917 CTGCGGGAAAGGAGGAGACTAGG + Intronic
1045165007 8:99593915-99593937 GTGAGGGAGGGGTGGAGAGATGG + Intronic
1045251145 8:100484369-100484391 CTGGGGGAAGGGAAGACAGCAGG + Intergenic
1045304833 8:100950654-100950676 CCGTGGGGGGGGGGGAGAGATGG + Intronic
1045412019 8:101929369-101929391 AGGAGGGAAGGGAGGAGGGAGGG + Intronic
1045550100 8:103163840-103163862 TTGTGGGAAGGAAGGAAGGAAGG - Intronic
1046812288 8:118546085-118546107 CTGTGTGAAGGCAGGAATGATGG - Intronic
1046860707 8:119088157-119088179 TAGTGGGAAGGAAGGAGAGTGGG + Intronic
1047164415 8:122421193-122421215 TTGGGGGCAGGGAGGACAGAGGG + Intergenic
1047297811 8:123586892-123586914 CTGTGGGAAGGGATGAGGCTGGG + Intergenic
1047497999 8:125422275-125422297 ATGTGAGGAGGGAGGAGAGAGGG + Intergenic
1047846697 8:128813960-128813982 GAGTGTGAAGGGAGGACAGAGGG - Intergenic
1047907977 8:129493178-129493200 GTGTGGGAGGGGAGGACAAAGGG + Intergenic
1047928602 8:129704416-129704438 CAGAGGGAAGGGAGGAGAGAAGG - Intergenic
1047938603 8:129806043-129806065 GTGGGGGAAGGGAGGAGGGGAGG - Intergenic
1047986774 8:130243554-130243576 GTGTGGGAACAGAGGGGAGAGGG - Intronic
1048337322 8:133512707-133512729 CTGAGGGTCGGGAGGAGACAGGG + Intronic
1048607099 8:135980465-135980487 GTGTCTGAAGGGGGGAGAGATGG + Intergenic
1048767496 8:137860834-137860856 CTGGAGGAAGGGAGGAGAGTTGG + Intergenic
1048964330 8:139604407-139604429 CTGTGGGACGGGAGGAGGTGGGG + Intronic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049210737 8:141385342-141385364 TTCTGGGAAGGGACAAGAGACGG - Intergenic
1049621410 8:143599896-143599918 CAGGGGGAGGGGAGGAGAGATGG - Exonic
1049976755 9:867347-867369 CTCTGGGAAGCCAGGAGAGCGGG + Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1051312868 9:15795199-15795221 CTGGGGGAAGGAAGTAGGGAAGG + Intronic
1051626346 9:19102990-19103012 TGGCCGGAAGGGAGGAGAGAAGG - Exonic
1051798270 9:20900879-20900901 CAGTGGAGAGGTAGGAGAGAAGG + Intronic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052670455 9:31550936-31550958 CTCTGGGATGGAAGGAGAAATGG + Intergenic
1053123829 9:35563920-35563942 CGGGGCTAAGGGAGGAGAGAAGG + Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053302311 9:36960821-36960843 CTGTGGGAAGAGAGGAATGCAGG - Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053658843 9:40249093-40249115 CTGAGGCAAGTCAGGAGAGAGGG + Intronic
1053857060 9:42348506-42348528 CTGTTGGTATGGAGGACAGAAGG + Intergenic
1053909212 9:42878365-42878387 CTGAGGCAAGTCAGGAGAGAGGG + Intergenic
1054359503 9:64100062-64100084 CTGAGGCAAGTCAGGAGAGAGGG + Intergenic
1054370963 9:64395383-64395405 CTGAGGCAAGTCAGGAGAGAGGG + Intronic
1054525755 9:66127129-66127151 CTGAGGCAAGTCAGGAGAGAGGG - Intronic
1054678594 9:67885112-67885134 CTGAGGCAAGTCAGGAGAGAGGG + Intronic
1055101202 9:72467489-72467511 CTGTGGGAAGAAAGAACAGAGGG - Intergenic
1055206600 9:73738247-73738269 CAGGGGTTAGGGAGGAGAGAGGG - Intergenic
1055430822 9:76241602-76241624 ATGTGAGAAGGGAAGAAAGAAGG - Intronic
1055581927 9:77715041-77715063 ATGTGAGAAGGCAGGAAAGATGG + Intergenic
1055859661 9:80732901-80732923 CTGTGGGGTGGGAGGCGGGAAGG - Intergenic
1056067522 9:82952587-82952609 CTGAGGGATGGGAGGAGAGTAGG + Intergenic
1056097217 9:83267299-83267321 CATTGGGAGGGGAGGAGGGAGGG + Intronic
1056153067 9:83806561-83806583 CTGTGGGGAGGCAGAAGAGTAGG + Intronic
1056185558 9:84131248-84131270 GTGGGGGAAGGGGGGAGAGATGG - Intergenic
1056246465 9:84700391-84700413 ATGTGTGGTGGGAGGAGAGAAGG + Intronic
1056524762 9:87432954-87432976 CTGTTGGAAGGAAGGAAGGAAGG + Intergenic
1056869724 9:90266290-90266312 ATGAGGGAAGGAAGGAAAGAAGG - Intergenic
1057185169 9:93053324-93053346 CTGTGGGGAGGGAGGAGGCGAGG + Intergenic
1057312304 9:93950035-93950057 CTGTGGAAAGGGAGGCCTGAGGG - Intergenic
1057448663 9:95137369-95137391 CAGGGGGAAGGGAGAAGGGAGGG + Intronic
1057723683 9:97553718-97553740 ATTTGGGAAGAGAGGATAGAGGG + Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057912794 9:99033389-99033411 GGGTGGGAGGGGAGGGGAGATGG + Intronic
1058177994 9:101760491-101760513 CTGTGGGAAAGAGGGAGGGATGG + Intergenic
1058465768 9:105225583-105225605 AGATGGGAAGGGAGGAGGGAGGG + Intergenic
1058533081 9:105926131-105926153 CTGTGGGAATAGGGGAGCGAAGG + Intergenic
1058618613 9:106861374-106861396 TTGGGGGGAGGGAGGAGAAAGGG + Intergenic
1058827295 9:108786583-108786605 CTTAGGGAAGGGAGAAGGGAGGG + Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059427666 9:114231226-114231248 CTGGGGGAAGGGAGGATGGCAGG + Intronic
1059521419 9:114945867-114945889 TGTTGGGGAGGGAGGAGAGAAGG + Intergenic
1059672241 9:116502745-116502767 ATGAGGGAAGGAAGGAGAGAAGG + Intronic
1059713699 9:116893697-116893719 AGGAGGGAAGAGAGGAGAGAGGG - Intronic
1059735411 9:117095064-117095086 CTTTGTGGAGGTAGGAGAGAAGG + Intronic
1059994058 9:119892467-119892489 GGGAGGGAAGGGAGGAGGGAGGG + Intergenic
1059994085 9:119892547-119892569 TGGGGGGAAGGGAGGAAAGAAGG + Intergenic
1060068816 9:120528935-120528957 CTTTGGGTGGGGTGGAGAGAGGG - Intronic
1060198362 9:121637567-121637589 TTGGAGGAAGGGAGGGGAGAGGG + Intronic
1060369828 9:123058038-123058060 CCGTGGAAAGAGAGGGGAGAGGG + Intronic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060894866 9:127211131-127211153 GTGTTGGAAGGAATGAGAGAGGG + Intronic
1060966932 9:127716748-127716770 CTGCAGGGAGGGAGGAGAGGCGG - Exonic
1061108710 9:128552237-128552259 CTGCGGGGAGGGAGGTGAGGCGG + Intergenic
1061177215 9:129004954-129004976 ATGAGGGAAGGAGGGAGAGAAGG + Intronic
1061177223 9:129004982-129005004 ATGAGGGAAGGAGGGAGAGAAGG + Intronic
1061274593 9:129562121-129562143 CAGTGGGAAGGCAGGGGTGAGGG + Intergenic
1061375292 9:130220411-130220433 CTGCAGGCAAGGAGGAGAGAGGG + Intronic
1061485134 9:130916701-130916723 CAGTGGGATGGGAGGACAGAGGG + Intronic
1061509482 9:131051798-131051820 CACTGGGAAAGGAGGAGGGAGGG + Intronic
1061574122 9:131495536-131495558 TTATGGGGAGGGAGCAGAGACGG + Intronic
1061636914 9:131917289-131917311 CCCAGGGAAGGGAGGAGAGAGGG + Intronic
1061847298 9:133394901-133394923 CTGTGGGCAGGAAGGAGGGGAGG + Intronic
1061931248 9:133834243-133834265 CGGGGGGATGGGAGGAGGGATGG - Intronic
1062266682 9:135689732-135689754 CTTTGGTGAGGGAGGTGAGAGGG - Intergenic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062357401 9:136171302-136171324 AGGTGGGAAGAGACGAGAGAGGG - Intergenic
1062733395 9:138121357-138121379 TGGGGGGATGGGAGGAGAGAGGG - Intronic
1203694741 Un_GL000214v1:87571-87593 CTGAGGCAAGTCAGGAGAGAGGG - Intergenic
1203446624 Un_GL000219v1:63175-63197 GAGAGGGAAGGAAGGAGAGAGGG - Intergenic
1203446672 Un_GL000219v1:63349-63371 AGGAGGGAAGGAAGGAGAGAGGG - Intergenic
1203704808 Un_KI270742v1:29861-29883 CTGAGGCAAGTCAGGAGAGAGGG + Intergenic
1203559195 Un_KI270744v1:35950-35972 CTGAGGCAAGTCAGGAGAGAGGG - Intergenic
1203641532 Un_KI270751v1:16492-16514 CTGAGGCAAGTCAGGAGAGAGGG + Intergenic
1185464356 X:346071-346093 GGGTGGGAGGGGAGGAGGGAGGG + Intronic
1185492537 X:528790-528812 CAGAGGGAAGGAAGGAAAGAAGG - Intergenic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185621734 X:1454084-1454106 GGGTGGGAAGGGCGGGGAGATGG + Intergenic
1185708478 X:2282702-2282724 GAGAGGGAAGGAAGGAGAGAGGG + Intronic
1185734296 X:2485610-2485632 CAGAGGGAAGGAAGGAGGGAGGG + Intronic
1185737849 X:2506692-2506714 CTGGCTGGAGGGAGGAGAGAAGG - Intergenic
1185766764 X:2732096-2732118 CTGTAGGAAGGGAGGAACGGAGG - Intronic
1185772212 X:2773381-2773403 CGGAGGGAAGGAAGGAGAGAGGG + Intronic
1185896063 X:3860047-3860069 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1185901182 X:3898473-3898495 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1185906296 X:3936911-3936933 GGCTGGGAAGGGAGCAGAGAAGG - Intergenic
1186184943 X:7011497-7011519 ATGAGGGAAGGAAGGAGGGAGGG - Intergenic
1186269193 X:7866489-7866511 AGGTAGGAAGGGAGGAAAGAAGG - Intergenic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187047356 X:15660323-15660345 TTTTTGGAAGGGAGGAGGGATGG + Intronic
1187097211 X:16161544-16161566 ATATGGGAAGGGGGCAGAGAAGG + Intergenic
1187296395 X:18005346-18005368 CTGGAAGATGGGAGGAGAGAGGG + Intergenic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1188002442 X:24995103-24995125 CTCTGGGAAGGGAAAGGAGAGGG + Intronic
1188603363 X:31996911-31996933 CTATGGGAAGGGAAGAGGAAAGG + Intronic
1189012928 X:37064537-37064559 GGTTGGGAAGGGAGGAGAAAGGG - Intergenic
1189185059 X:39047642-39047664 ATGAGAGCAGGGAGGAGAGAAGG - Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189288860 X:39871136-39871158 ATGTGGGAGGGAGGGAGAGAGGG + Intergenic
1189323807 X:40101260-40101282 TTGTGGGAGGGCAGGAGAGGAGG - Intronic
1189710727 X:43809045-43809067 CTGGGGAAAGGAAGGAGGGATGG - Intronic
1190031700 X:46979400-46979422 CTCAGGGAGGTGAGGAGAGAGGG + Intronic
1190276771 X:48904241-48904263 CGGTGGTAAGGGAGGAGAGAAGG + Exonic
1190690322 X:52908185-52908207 CAGCAGGAAGGGAAGAGAGATGG - Exonic
1190695661 X:52947607-52947629 CAGCAGGAAGGGAAGAGAGATGG + Exonic
1191131839 X:57022253-57022275 CTGTAGGCAAGGAGGAGGGAAGG - Intergenic
1192174687 X:68878361-68878383 ATGTCTGAAGGGAAGAGAGATGG + Intergenic
1192217944 X:69177081-69177103 CTGTGGGAAGTCAGGACAGTGGG - Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192478201 X:71461867-71461889 AGGTGGGGAGGGAGGAGAGCTGG + Intronic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192639438 X:72848002-72848024 CTGTGGGTAGTGAGGAGCCAGGG + Intronic
1192642273 X:72872803-72872825 CTGTGGGTAGTGAGGAGCCAGGG - Intronic
1193877095 X:86873881-86873903 CCTTGGGAAAGGATGAGAGAAGG - Intergenic
1194937759 X:99971190-99971212 CTGTGGGGATGGGGGAGGGATGG + Intergenic
1195093638 X:101486521-101486543 CTGAAGGATGGCAGGAGAGATGG - Intronic
1195234910 X:102887792-102887814 AGGTGGGAAGGAAGGAGGGAAGG - Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195756135 X:108200602-108200624 GTGTGGGGTGGGGGGAGAGATGG + Intronic
1196892572 X:120305659-120305681 CCATGGGGAGGGAGGGGAGAGGG + Intronic
1197116024 X:122834912-122834934 GGGTGGGAGGGGAAGAGAGAGGG - Intergenic
1197722239 X:129753133-129753155 TTGGGGGCAGGGAGGAGAAAAGG - Intronic
1197753932 X:129982341-129982363 CACTGGGAGGGGAGGAGAGGAGG - Intronic
1197815994 X:130499377-130499399 CAGAAGGAAGGGAGGAGGGAAGG - Intergenic
1197844432 X:130786066-130786088 TTGTGGGAGGGAGGGAGAGAGGG - Intronic
1198194482 X:134346135-134346157 CTGTTGGAAGGTAGGGGAGTAGG - Intergenic
1198397672 X:136237862-136237884 GTGTGGGGAGGGGGGAGGGATGG - Intronic
1199215946 X:145260502-145260524 GTGTGAGAAGGGAGGCAAGAGGG + Intergenic
1199432433 X:147776552-147776574 TTGTGGGAAGGGAAGCTAGAAGG + Intergenic
1199433766 X:147789687-147789709 CTGAGAGAAGGGAGGGGAGTGGG - Intergenic
1199610224 X:149606513-149606535 CTGTGGGAGTTGAGAAGAGAGGG - Intronic
1199944171 X:152652462-152652484 CTGGGGGGAGGGAGGAGGGAAGG - Intronic
1199974523 X:152885244-152885266 AAGAGGGAAGGAAGGAGAGATGG - Intergenic
1200015957 X:153164082-153164104 GTGTGGGAAGGGAGGAAGGTGGG - Intergenic
1200111926 X:153744784-153744806 CTGTGGGTCTCGAGGAGAGATGG + Intergenic
1200385787 X:155889629-155889651 ATGTGGTAAGGGATGAAAGAAGG + Intronic
1201427287 Y:13866415-13866437 GTGTGGGAATGAAGGAGACATGG + Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic
1201452987 Y:14136206-14136228 CAGAGGGAAGGAAGGAGAGAGGG - Intergenic
1201727703 Y:17171542-17171564 GTGTGGGAAGAGAGAAGAAAGGG + Intergenic
1202302006 Y:23426543-23426565 CTGGGAGTAGGGAGAAGAGATGG - Intergenic
1202568805 Y:26244055-26244077 CTGGGAGTAGGGAGAAGAGATGG + Intergenic