ID: 1167293495

View in Genome Browser
Species Human (GRCh38)
Location 19:48636712-48636734
Sequence ACTCAATTACTCAGGTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167293495_1167293504 24 Left 1167293495 19:48636712-48636734 CCTAAACACCTGAGTAATTGAGT 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1167293495_1167293502 23 Left 1167293495 19:48636712-48636734 CCTAAACACCTGAGTAATTGAGT 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1167293502 19:48636758-48636780 TCCCCGCACGCAGGTTTCTATGG 0: 1
1: 0
2: 1
3: 2
4: 31
1167293495_1167293498 -10 Left 1167293495 19:48636712-48636734 CCTAAACACCTGAGTAATTGAGT 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1167293498 19:48636725-48636747 GTAATTGAGTAGATTAAGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 129
1167293495_1167293501 14 Left 1167293495 19:48636712-48636734 CCTAAACACCTGAGTAATTGAGT 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1167293501 19:48636749-48636771 AAGATGGACTCCCCGCACGCAGG 0: 1
1: 0
2: 0
3: 1
4: 28
1167293495_1167293499 -9 Left 1167293495 19:48636712-48636734 CCTAAACACCTGAGTAATTGAGT 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1167293499 19:48636726-48636748 TAATTGAGTAGATTAAGGTTGGG 0: 1
1: 0
2: 0
3: 10
4: 148
1167293495_1167293500 -2 Left 1167293495 19:48636712-48636734 CCTAAACACCTGAGTAATTGAGT 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1167293500 19:48636733-48636755 GTAGATTAAGGTTGGGAAGATGG 0: 1
1: 0
2: 0
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167293495 Original CRISPR ACTCAATTACTCAGGTGTTT AGG (reversed) Intronic
907720735 1:56969698-56969720 ATCCAATGACTCAGGGGTTTAGG - Intergenic
916753491 1:167745006-167745028 ACTCACTTACTGAGGCTTTTTGG + Intronic
918369204 1:183841647-183841669 ACTGTAGTACTCAGGTGTATTGG + Intronic
918809393 1:189095617-189095639 ACTCAATTCCTCAATTATTTGGG - Intergenic
921463166 1:215453261-215453283 ACTGTTTTACTCAGATGTTTTGG + Intergenic
923013338 1:230106384-230106406 ACTCAGAGCCTCAGGTGTTTAGG - Intronic
924262619 1:242247658-242247680 ACTCAGTTTTTCAGGTTTTTTGG + Intronic
1066037423 10:31507944-31507966 AGTCAATTATTCTGGTTTTTTGG + Intronic
1072077959 10:91997589-91997611 AATCACTTACTCAGGTGTAATGG + Exonic
1072160048 10:92757497-92757519 GCTCAATTCTTCAGGAGTTTGGG + Intergenic
1073602262 10:104858428-104858450 ACTCAAGTATTCATCTGTTTTGG + Intronic
1073663644 10:105505904-105505926 AGTCACTTACTCTGGGGTTTGGG + Intergenic
1076061246 10:127416013-127416035 AGACAAATAATCAGGTGTTTCGG - Intronic
1079525250 11:21379050-21379072 ACTCAATTAATCAGTTTTTTTGG + Intronic
1079570901 11:21942336-21942358 ACTCAAATCCCCAGGTGTTGTGG + Intergenic
1079647442 11:22883267-22883289 AATAAATTAGTCAGGTGTTGTGG + Intergenic
1079825006 11:25180010-25180032 ACTCAAATACTGAAGTGTGTAGG + Intergenic
1080038368 11:27732928-27732950 ACACAATTAGCCAGGTGTTGTGG - Intergenic
1081158049 11:39718850-39718872 TCTCAAGTACTCAGGTGGTAAGG + Intergenic
1081924846 11:46816951-46816973 ACAAAATTACTCAGGTGTGGTGG + Intronic
1086047586 11:82550950-82550972 AATCAATCACTCAGGTGTTGAGG + Intergenic
1089151968 11:116371365-116371387 AATCAATTAATCTGTTGTTTGGG - Intergenic
1090097521 11:123757515-123757537 ACTGAATTACTCAGGTTTAGAGG + Intergenic
1092353715 12:7777384-7777406 ACTAAATTACCCAGGTGTGGTGG - Intergenic
1092873734 12:12830583-12830605 CCTCAATTAAGCAGGTGGTTAGG + Intergenic
1093870555 12:24285911-24285933 ACATAATTATTCAAGTGTTTTGG - Intergenic
1094155844 12:27336134-27336156 ACTGAGTTACTCGGGTGCTTGGG + Intronic
1094469040 12:30785784-30785806 ACTCAATTATGCATTTGTTTGGG + Intergenic
1095189080 12:39235054-39235076 TCCCAGCTACTCAGGTGTTTGGG + Intergenic
1095705571 12:45233291-45233313 ACTCTATTACTAGGGTGCTTTGG - Intronic
1096353869 12:50923684-50923706 ACTCGATTACTCAGCTAATTTGG - Exonic
1096380395 12:51152565-51152587 ACTGAAGTATTTAGGTGTTTGGG + Intronic
1096399851 12:51296863-51296885 ACACACTTACTCAGTTGTTAAGG + Intronic
1097539870 12:60927518-60927540 ACTCACTTAGTAAGGTATTTGGG - Intergenic
1098347299 12:69519188-69519210 TGTCAAATACTGAGGTGTTTTGG + Intronic
1100336371 12:93633945-93633967 ACCCAAATACCCAGGTGTTGAGG + Intergenic
1102935126 12:116890079-116890101 AATCAATTAGTCAGGTGTTGTGG - Intergenic
1104129573 12:125880199-125880221 ACTCAACTATTGAGCTGTTTGGG + Intergenic
1108032260 13:46244851-46244873 ACAAAATTACTAATGTGTTTAGG - Intronic
1109044118 13:57386093-57386115 ATTCAATTATTCAGGTATCTTGG + Intergenic
1110858732 13:80324785-80324807 AGTCAATTACTTAGGTGAGTGGG + Intergenic
1110953815 13:81527228-81527250 TCACATTTACTCAGATGTTTTGG + Intergenic
1111176343 13:84601275-84601297 ACTAAATTAGTCAGGTGTGGTGG + Intergenic
1111894232 13:94120787-94120809 AATCAATGAATCAGGTGTTCAGG + Intronic
1113500620 13:110771011-110771033 ACTCAATTAGTGAATTGTTTGGG - Intergenic
1115012607 14:28567716-28567738 ACTCAATTTTTTGGGTGTTTTGG + Intergenic
1117982473 14:61355829-61355851 ACTGAACTATACAGGTGTTTTGG - Intronic
1118732892 14:68681679-68681701 ACGATATTACACAGGTGTTTGGG - Intronic
1122241216 14:100368981-100369003 CCTCAATGACTGAGGTGTTTTGG - Intronic
1125515073 15:40314262-40314284 ACTGAATTCCTCAAGTATTTTGG - Intergenic
1125588338 15:40838139-40838161 ACAAAATTAGTCAGGTGTTGTGG + Intergenic
1127094090 15:55495580-55495602 AAACAATTACCTAGGTGTTTTGG + Intronic
1128337227 15:66794852-66794874 ACTGCCTTACTCAGGTGTGTAGG - Intergenic
1128661399 15:69503646-69503668 ACTCAAGTACAAAGGTGTCTGGG + Intergenic
1131240286 15:90735524-90735546 ACTAAATTCTTCATGTGTTTAGG - Intronic
1136478051 16:30525531-30525553 ACTCCTTCACTCAGGGGTTTGGG - Exonic
1137635763 16:49985081-49985103 ACACAAATACTCAGGTGTGGTGG + Intergenic
1139048462 16:63092951-63092973 ACTGAATTACACAAGTGTCTGGG - Intergenic
1139198553 16:64949577-64949599 ACAAAATTATTCAGGTGTGTTGG - Intronic
1141365923 16:83442964-83442986 ACTAAATAATTCAGCTGTTTAGG - Intronic
1142718520 17:1761548-1761570 ACAAAATTACCCAGGTGTGTTGG - Intergenic
1144662099 17:17077786-17077808 CCTCAATCACTCATGTGATTTGG + Intronic
1145290740 17:21543788-21543810 ACTCAATTCATTATGTGTTTTGG - Intronic
1147842144 17:43379237-43379259 ACGCAGTTGCTCAGGTGCTTCGG - Intergenic
1148354118 17:46963967-46963989 AGTCAATTACACAGGTGTGATGG - Intronic
1148705104 17:49623159-49623181 ACACAATTAGTCAGGTGTGGTGG - Intronic
1149759532 17:59217051-59217073 AATCAATTACACAAGAGTTTAGG - Intergenic
1150321365 17:64217145-64217167 ACTCAATTACCCAGCAGTTTGGG - Intronic
1151454233 17:74216531-74216553 ACTCACTTTCTGGGGTGTTTGGG + Intronic
1156097852 18:33557653-33557675 AGTGAATTACTCATGTGTTTTGG + Intergenic
1157910897 18:51616710-51616732 ACAAAATTAGTCAGGTGTGTTGG - Intergenic
1158238536 18:55349311-55349333 AGTCAAATACACAGGTGTTTGGG + Intronic
1162553869 19:11374540-11374562 ACTCGATTCCTCAGGTGAATGGG - Intergenic
1165559079 19:36663383-36663405 AGTGAATCACTCAGGTGTCTGGG + Intronic
1167293495 19:48636712-48636734 ACTCAATTACTCAGGTGTTTAGG - Intronic
925328477 2:3040515-3040537 AGTGAATTTCTCAGCTGTTTTGG - Intergenic
927531612 2:23810322-23810344 ACATGATTCCTCAGGTGTTTTGG + Exonic
929105166 2:38358144-38358166 ACTCTATTTCACAAGTGTTTAGG + Intronic
930238686 2:48912782-48912804 ACTCAATTACTAAGGTTTACAGG + Intergenic
930798202 2:55415196-55415218 TCCCAACTACTCAGATGTTTAGG + Intronic
930870677 2:56167663-56167685 ACTGAAATACTAAGGTGTTTGGG + Intergenic
930962626 2:57279069-57279091 ACTCAATTTCTAAATTGTTTTGG - Intergenic
931934921 2:67186404-67186426 AATCAATTACCCAGGGGTCTAGG + Intergenic
931957764 2:67447205-67447227 ACTTTATTCCTCAGGTGCTTTGG + Intergenic
939415945 2:141897319-141897341 ACTCAATTGTTCAGATGTCTAGG + Intronic
939602747 2:144213639-144213661 AATCAATTTCTCATGTGTGTGGG - Intronic
941045402 2:160670001-160670023 TCCCAGTTACTCAGGAGTTTAGG - Intergenic
942351146 2:175054731-175054753 ACTCTATTTATCAGCTGTTTGGG + Intergenic
946956608 2:224937149-224937171 ACTTAAATACTCATGTGTATTGG + Intronic
947123030 2:226836711-226836733 ATTCAATTATCGAGGTGTTTGGG + Intronic
948003264 2:234586223-234586245 ACACAATTAGTCAGGTGTGGTGG - Intergenic
1169648243 20:7838342-7838364 AATCTATTATTCAGGTCTTTAGG + Intergenic
1172311479 20:33921714-33921736 AGGCAATTACTCAGGTGTGTGGG - Intergenic
1174586707 20:51614451-51614473 ACTAAATTAGTCAGGTGTGGTGG - Intronic
1176209531 20:63911788-63911810 TCCCAGTTACTCAGGTGGTTGGG - Intronic
1177420784 21:20853853-20853875 ACTAAGTTCCTCAGGTGATTTGG - Intergenic
1178153830 21:29828317-29828339 AATCAATTACTAAGGTTTTTCGG - Intronic
1182624351 22:31635011-31635033 ACAAAATTACTCAGGTGTGGTGG + Intronic
949166611 3:950416-950438 ACTCCATTACTGATGTGGTTTGG + Intergenic
951090575 3:18568795-18568817 ATTCACTTATTCAGTTGTTTTGG + Intergenic
952054543 3:29428710-29428732 ACTAAATGAATCAGCTGTTTAGG + Intronic
954948827 3:54450834-54450856 ACTCATTTATTCAGGTGTCAGGG + Intronic
955906272 3:63810999-63811021 ACAAAATTACTCAGGTGTGGTGG - Intergenic
957913277 3:86651078-86651100 ACACAATTATTAAAGTGTTTTGG + Intergenic
957955153 3:87177001-87177023 AATCACTTACTTAGGTATTTTGG + Intergenic
960254242 3:115494602-115494624 ACTCAAATAATCTGGTATTTGGG + Intergenic
961983808 3:131110354-131110376 TCTCAATTACTGAGCTCTTTTGG - Intronic
962115566 3:132502805-132502827 AGACAAGTACTCAAGTGTTTAGG - Intronic
962503224 3:136017311-136017333 AATGAATTTCTCAGGTGATTTGG + Intronic
962601626 3:136995544-136995566 ACTCTATTACCAAGGTGTCTGGG - Exonic
962842267 3:139245827-139245849 ACAAAATTAGTCAGGTGTTGTGG - Intronic
962972167 3:140412166-140412188 ACAAAATTAATCAGGTGTTGTGG - Intronic
967444156 3:189545158-189545180 CCTCAATTTGTCAGATGTTTAGG + Intergenic
970744325 4:19276844-19276866 ACTCAGACACTCAGATGTTTTGG + Intergenic
972519187 4:39837756-39837778 TCTCAAATGCTTAGGTGTTTGGG + Intronic
973937691 4:55865472-55865494 ACTCAATTACCAAGATGTTGGGG - Intronic
975382768 4:73721254-73721276 ACTCAATTATTGATATGTTTTGG - Intergenic
980164662 4:129210693-129210715 ACTCAATTAATCTGAAGTTTTGG - Intergenic
981092175 4:140743115-140743137 AGTCAAATACTCAGGCTTTTTGG - Intronic
981880518 4:149605792-149605814 ACTCAGTGACTCAGGAGTTGGGG - Intergenic
983077214 4:163341433-163341455 AAGCAATTACTAAAGTGTTTTGG - Intronic
985156656 4:186996165-186996187 ACTCAATCTCAGAGGTGTTTAGG - Intergenic
986057408 5:4152372-4152394 ACTCATTTGCTTAGGAGTTTGGG - Intergenic
987546577 5:19317999-19318021 ACAGAATTCCTCAGGTGTTGGGG - Intergenic
988851471 5:35185382-35185404 TCTCAATCAAACAGGTGTTTGGG - Intronic
990359664 5:55006138-55006160 ACCCTATTACTCACGTGTTATGG - Intronic
990674777 5:58171606-58171628 ATGCCATTACTCAGGTCTTTTGG + Intergenic
997763419 5:136473071-136473093 ATTCTATTCCTCAGGTCTTTTGG - Intergenic
998716249 5:144888491-144888513 ACAAAATTAGCCAGGTGTTTTGG + Intergenic
999371641 5:151058930-151058952 ACGCCATTACACAGGTGTTCAGG - Intronic
999846832 5:155491436-155491458 ACTAAACTTCTCACGTGTTTTGG - Intergenic
1000028666 5:157382503-157382525 ACTCCAGTGCTCAGGTTTTTAGG + Intronic
1001305116 5:170566798-170566820 GTTCAATTTCTCAGGTGCTTTGG - Intronic
1004094340 6:12538147-12538169 ACAAAATTACCCAGGTCTTTTGG - Intergenic
1004801671 6:19155262-19155284 CCTCAAATACTCAGCTTTTTTGG + Intergenic
1006514884 6:34540181-34540203 ACTCAGCTACTCAGGAGATTGGG + Intronic
1008240662 6:49107178-49107200 CCTCAGTTACTAAGCTGTTTTGG - Intergenic
1010478365 6:76317914-76317936 ACAAAATTAGTGAGGTGTTTTGG - Intergenic
1016583113 6:145651787-145651809 CCTCAGCTACTCAGGTGGTTAGG + Intronic
1017979198 6:159384452-159384474 AATCAAATAATCAGTTGTTTGGG - Intergenic
1018670490 6:166172896-166172918 ATTCAAATAGTCAGGTGTTTTGG + Intergenic
1021287341 7:18796957-18796979 ACTCAGATAACCAGGTGTTTAGG - Intronic
1021885620 7:25135472-25135494 CCTCAATTAACTAGGTGTTTGGG + Exonic
1022060785 7:26792473-26792495 ACTAAATTATTAATGTGTTTGGG - Intronic
1028661678 7:93284240-93284262 TATCAAATAATCAGGTGTTTGGG - Intronic
1030020620 7:105271782-105271804 CCTCAATTAGTCAGTTGTTTTGG + Intronic
1033004523 7:137547063-137547085 ACAAAATTACCCAGGTGTTTTGG - Intronic
1033103855 7:138501140-138501162 AATGCATTACTCATGTGTTTAGG - Intronic
1035937881 8:3862708-3862730 CCTCCCTTACTCAGTTGTTTTGG - Intronic
1036599928 8:10251228-10251250 ACTTAATTTCTGAAGTGTTTGGG + Intronic
1038560874 8:28578652-28578674 ATTGAAGTACTCAGGTGTTTAGG - Intergenic
1042264962 8:66899229-66899251 CCTCAATTACTCATGTGATGTGG + Intronic
1043093942 8:75941117-75941139 AATCAAGTACTTAGGTGATTTGG - Intergenic
1043724619 8:83594748-83594770 AGTCAAATAATAAGGTGTTTTGG - Intergenic
1046841366 8:118861411-118861433 ACTGAATAACTCCAGTGTTTTGG + Intergenic
1047170388 8:122486843-122486865 ACTCAGTTACTCTGGAGGTTTGG + Intergenic
1047817244 8:128477990-128478012 AATCATTTACCCAGTTGTTTAGG + Intergenic
1048265302 8:132980330-132980352 ACTCAATTACTCATATGTGATGG + Intronic
1049130055 8:140831249-140831271 ACTAACTTACTCAGATGTTTTGG + Intronic
1049704518 8:144034772-144034794 ACAAAATTAGTCAGGTGTGTTGG - Intronic
1050275720 9:3997040-3997062 ACTCAATTTTTAAGGTGTCTAGG - Intronic
1051622317 9:19064118-19064140 ACAAAATTACTCAGGTGTTGTGG - Intronic
1052460962 9:28762436-28762458 ACTAAATTCCTCAGGTACTTAGG - Intergenic
1053262083 9:36676196-36676218 ACTAACTTAGTCATGTGTTTTGG - Intronic
1055110847 9:72557792-72557814 ACTCAAGTCTTCCGGTGTTTTGG + Intronic
1058069596 9:100588140-100588162 ACTCAGTTACTCAGATGTTTGGG + Intergenic
1058333947 9:103802277-103802299 AAGCAATTGCTCAAGTGTTTTGG - Intergenic
1060110607 9:120904052-120904074 CCTCAGTTAATCAGGTGTTACGG + Exonic
1188523258 X:31061545-31061567 ACTGGAAGACTCAGGTGTTTGGG - Intergenic
1189706419 X:43763211-43763233 ATTCAATTCCTCATGTATTTAGG + Intergenic
1192017406 X:67346673-67346695 ACACAATTGCTCAGGTCTTTTGG + Intergenic
1197583362 X:128312035-128312057 ATTCTAATCCTCAGGTGTTTAGG - Intergenic
1198880805 X:141278962-141278984 ACTCAATTACTCTGTTGCTTTGG - Intergenic
1200851493 Y:7888244-7888266 ACTCACTTCCTCTGGTATTTGGG + Intergenic
1201705873 Y:16936124-16936146 ACACAATTAGGCAGGTGTTGTGG - Intergenic