ID: 1167293496

View in Genome Browser
Species Human (GRCh38)
Location 19:48636720-48636742
Sequence CTTAATCTACTCAATTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167293496_1167293502 15 Left 1167293496 19:48636720-48636742 CCTGAGTAATTGAGTAGATTAAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1167293502 19:48636758-48636780 TCCCCGCACGCAGGTTTCTATGG 0: 1
1: 0
2: 1
3: 2
4: 31
1167293496_1167293504 16 Left 1167293496 19:48636720-48636742 CCTGAGTAATTGAGTAGATTAAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1167293496_1167293500 -10 Left 1167293496 19:48636720-48636742 CCTGAGTAATTGAGTAGATTAAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1167293500 19:48636733-48636755 GTAGATTAAGGTTGGGAAGATGG 0: 1
1: 0
2: 0
3: 25
4: 234
1167293496_1167293507 30 Left 1167293496 19:48636720-48636742 CCTGAGTAATTGAGTAGATTAAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1167293507 19:48636773-48636795 TTCTATGGGACCCCACCCCACGG 0: 1
1: 0
2: 0
3: 12
4: 93
1167293496_1167293501 6 Left 1167293496 19:48636720-48636742 CCTGAGTAATTGAGTAGATTAAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1167293501 19:48636749-48636771 AAGATGGACTCCCCGCACGCAGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167293496 Original CRISPR CTTAATCTACTCAATTACTC AGG (reversed) Intronic
906843641 1:49166429-49166451 GTTAAACCACTAAATTACTCTGG - Intronic
907731690 1:57072763-57072785 TTTAATTTACTTAAATACTCGGG + Intronic
909047232 1:70725357-70725379 CTTAATTTCATCATTTACTCTGG + Intergenic
909398530 1:75198217-75198239 CTATATCTTCTCATTTACTCTGG + Intergenic
912138027 1:106684935-106684957 TTTAATCGACTCAGTTCCTCAGG - Intergenic
915702558 1:157810055-157810077 TTTATTTTACTCAATTTCTCAGG - Intronic
917073871 1:171183040-171183062 CTTAACCTAATCATTTTCTCAGG - Intergenic
917418431 1:174836211-174836233 CCTAATCTACTCAATTTGCCTGG - Intronic
918676382 1:187291070-187291092 CTTAATCTATTCAATTCTTAAGG - Intergenic
921103827 1:211955719-211955741 TTTAATCTTCACAACTACTCTGG + Intronic
921740503 1:218679380-218679402 CTTAATCTTTTCAATTGCTCAGG - Intergenic
924449850 1:244168133-244168155 CTTAATTTTCTCAATCTCTCTGG + Intergenic
1063376800 10:5558799-5558821 CTGAGTCTGCTCAGTTACTCAGG - Intergenic
1067564105 10:47324533-47324555 CTTAATCCTCTCACTTACCCTGG - Intronic
1069155615 10:65027281-65027303 CTTAATCTTCTAACTTACTTTGG - Intergenic
1073772179 10:106746867-106746889 CCTTGACTACTCAATTACTCAGG + Intronic
1076210212 10:128634627-128634649 CTCCATCTACCCAATTTCTCAGG + Intergenic
1079068457 11:17320122-17320144 CTTTATCTACTCACTTACTTTGG + Intronic
1079467389 11:20743950-20743972 CATCATCTACTCAGTTACTCAGG + Intronic
1080307040 11:30847936-30847958 CTTAATCCTCTCAACTACCCTGG - Intronic
1080652880 11:34236595-34236617 CTCAATCCACTGATTTACTCCGG + Intronic
1082082302 11:48021620-48021642 CTTAATCTACACAATGGCTGAGG - Intronic
1082285649 11:50315383-50315405 CATAATCTTCTGAATTACTTTGG + Intergenic
1086047585 11:82550942-82550964 CTTCATTTAATCAATCACTCAGG + Intergenic
1089218614 11:116851952-116851974 CATCATCCACTCAATTCCTCGGG + Intronic
1091330498 11:134727970-134727992 CTTAATCTACTTCTTTTCTCTGG + Intergenic
1091419449 12:323502-323524 CTTACTTTACTCCTTTACTCTGG - Intronic
1095977908 12:47952254-47952276 TTTAATCTCCTCCATTACTGAGG - Intergenic
1098893895 12:76035684-76035706 TTTAATCTACACATTTAGTCAGG + Intergenic
1102129847 12:110518459-110518481 CTTAAACTACCCAATGATTCAGG - Intronic
1105983155 13:25539539-25539561 CTTAATCTTCCCAATAACCCTGG + Intronic
1109975299 13:69823876-69823898 TTTAATTTACTCTATTACACTGG - Intronic
1110108088 13:71705269-71705291 CTTTATTTATTCAATGACTCTGG + Intronic
1110627392 13:77666638-77666660 CTTAATCTCCTCAAATATCCAGG + Intergenic
1111065986 13:83092133-83092155 CATTATTTACTCACTTACTCTGG - Intergenic
1111385664 13:87523240-87523262 CTTAAGCAAGTCAATAACTCAGG - Intergenic
1111570575 13:90079068-90079090 CATCATCTACTCAATTATTCAGG + Intergenic
1120127379 14:80761759-80761781 TTTAATCTACTCATTAACTGAGG + Intronic
1121334138 14:93066778-93066800 CTTACTCAACTGAAATACTCAGG + Intronic
1122326295 14:100882562-100882584 CCTGATCTACTCAATGAGTCAGG - Exonic
1124588008 15:31027370-31027392 CACAATCTACTCATATACTCAGG + Intronic
1126095202 15:45083513-45083535 ATTAATCTACACAAGTCCTCAGG - Intergenic
1126701881 15:51375334-51375356 CTAAATCTACACAAATATTCTGG + Intronic
1127423390 15:58831320-58831342 CTTAAGCTACTCAATTTATTAGG + Intronic
1131713789 15:95086438-95086460 CTTCATTTACTCAATTGCCCTGG + Intergenic
1134360723 16:13528738-13528760 CTTTATCAACTCAATTAATTAGG - Intergenic
1135192172 16:20363585-20363607 CTTCTTCTGCTTAATTACTCTGG - Intronic
1137024895 16:35463741-35463763 CTTTACCTACTCAATCACTGAGG + Intergenic
1149999027 17:61420797-61420819 CTTAATCCACACAACTGCTCTGG + Intergenic
1153729335 18:7992351-7992373 CTTAATCTCATCAATTTCTGTGG - Intronic
1154113648 18:11592104-11592126 TTTAATCTACTGAATTCCTTTGG + Intergenic
1155674355 18:28411457-28411479 TTTAATTTTCACAATTACTCTGG + Intergenic
1155775123 18:29752018-29752040 CTTAATCCACACACTTCCTCTGG + Intergenic
1155854611 18:30817080-30817102 CTTATTCTACTTAATTTCTCTGG - Intergenic
1156877173 18:42028756-42028778 TTTAATCTTCCCAATTACCCTGG - Intronic
1159719084 18:71863354-71863376 CTTAATATTCTCAGTTATTCTGG + Intergenic
1159844476 18:73442345-73442367 CTCAGTCTTCTCATTTACTCTGG + Intergenic
1167293496 19:48636720-48636742 CTTAATCTACTCAATTACTCAGG - Intronic
1168362479 19:55753777-55753799 ATTAACTTACTCAATTTCTCAGG + Intergenic
926547608 2:14261305-14261327 CTTAGTCTACTAAAGCACTCAGG - Intergenic
931922159 2:67032136-67032158 CTTAATCTACTCCATCAATCTGG - Intergenic
936913798 2:117618738-117618760 TTTAATCTTCCCAACTACTCTGG - Intergenic
937569750 2:123341877-123341899 ATTAATTTTATCAATTACTCTGG - Intergenic
939089718 2:137765475-137765497 CTTAATCTTCTCAAATAAACAGG - Intergenic
939264540 2:139854209-139854231 CCTATTCTACCCAATAACTCAGG - Intergenic
939737780 2:145870456-145870478 TTTACTCTACACAATTACTTTGG - Intergenic
940528916 2:154854586-154854608 TTTAATCTATTCTATTATTCGGG + Intronic
943078062 2:183222192-183222214 ACTAATCTAATCAATTAATCTGG - Intergenic
943141358 2:183986515-183986537 CTTAGTCTATTCAATTAATGAGG - Intergenic
944974572 2:205033877-205033899 CTCAATCTCGTCAATTACTGTGG - Intronic
945311628 2:208320600-208320622 CTTAATCCACTGATTTACTGTGG + Intronic
947089528 2:226494765-226494787 CTTGGACTACTCAATAACTCAGG - Intergenic
1168959029 20:1855764-1855786 CTTTCTCTACTGAATCACTCAGG + Intergenic
1169406864 20:5328829-5328851 CTTATTTCTCTCAATTACTCAGG + Intergenic
1171995426 20:31727214-31727236 CTCAATCTACTCAGTTGCTAGGG - Intergenic
1174953534 20:55069311-55069333 TTTTGTCTACTAAATTACTCCGG + Intergenic
1178124027 21:29498387-29498409 CTTAACCTACTCCCTTACTAGGG - Intronic
1181200080 22:21212298-21212320 CTTCATCTACTCACTGGCTCGGG - Intronic
951440354 3:22715571-22715593 TCTTCTCTACTCAATTACTCAGG - Intergenic
953720725 3:45352558-45352580 GTTACTGAACTCAATTACTCCGG - Intergenic
954165311 3:48752403-48752425 CATACTCTACACAATTACTGAGG + Intronic
955101898 3:55858857-55858879 CTCAATCTACTCACTTGCTGAGG + Intronic
957294374 3:78318050-78318072 CTTAAAATACTCACATACTCTGG + Intergenic
957549750 3:81688673-81688695 GTTAATCTTTTCAATTACTATGG + Intronic
958087548 3:88830386-88830408 CTTAACCTCCTCAAATGCTCAGG - Intergenic
959160146 3:102713637-102713659 CTTATTCTACTTAATTAATCTGG + Intergenic
959195648 3:103177743-103177765 TTTAATCTATTCAGTCACTCTGG - Intergenic
959448015 3:106464401-106464423 CTTAATTTCTTCATTTACTCTGG + Intergenic
964070590 3:152627719-152627741 CTTAATCTCCACAATAACTGAGG - Intergenic
970738859 4:19209005-19209027 CTTAATCTGCTTAATTATTATGG - Intergenic
974273106 4:59678440-59678462 CTTAATCTACTGAGTGACTTTGG + Intergenic
975165295 4:71171743-71171765 CTCCATCTACTTGATTACTCTGG + Intergenic
975822350 4:78284887-78284909 CTTAAAGCACTCAATTAATCCGG + Intronic
976108511 4:81644946-81644968 CTTAATCTTCTCCTTTAGTCAGG - Intronic
977053890 4:92164514-92164536 CTTGATCTAGTCTATTACTAAGG - Intergenic
978833972 4:113125010-113125032 CTTAATCTAATCAATTTATTTGG + Intronic
979342918 4:119549107-119549129 CTTTATTTAATAAATTACTCGGG - Intronic
980844485 4:138307623-138307645 CTTAATCGACTCAGTTCCACAGG - Intergenic
981112491 4:140951945-140951967 ATTTTTCTACTTAATTACTCTGG - Intronic
981614106 4:146628495-146628517 TTTAATCTACTCAATAACCTGGG + Intergenic
982640476 4:157952321-157952343 CTTAATTGACTCAGTTTCTCAGG - Intergenic
982891911 4:160864507-160864529 CTCAATTTTCTCAATTTCTCAGG - Intergenic
983480496 4:168268032-168268054 CTTAAACTACTTAATTTCACAGG - Intronic
984245567 4:177271577-177271599 CCTAATCTTTTCAATGACTCCGG - Intergenic
990800818 5:59600374-59600396 CTTACTCTCCTCATTTACACAGG - Intronic
994525010 5:100895357-100895379 CATACTTCACTCAATTACTCAGG - Intronic
994756338 5:103797977-103797999 CTTAATCTACTCTATTTATGAGG - Intergenic
1001261329 5:170232307-170232329 CCTAAACTCCTCAATTTCTCAGG + Intergenic
1004514777 6:16313207-16313229 CATCATCTTCTCAATTTCTCTGG + Intronic
1006240140 6:32670786-32670808 CTTAAGCTAATCAAAGACTCAGG - Intergenic
1007887802 6:45251780-45251802 AGTAATTCACTCAATTACTCTGG - Intronic
1009298925 6:61990184-61990206 TTTAATCTACTGAATTACCTTGG - Intronic
1013484107 6:110579090-110579112 CTTAATTTCATCATTTACTCAGG - Intergenic
1013687844 6:112606616-112606638 CATAACCTACTTAATTACACAGG - Intergenic
1015272917 6:131355788-131355810 CTTTATCTACACAACTACACTGG - Intergenic
1017180011 6:151542569-151542591 CATAATGTACTCAATCACTTTGG + Intronic
1021410480 7:20325001-20325023 ATTTATCTACTCACTTACTGAGG + Intergenic
1028179390 7:87700199-87700221 CTTAATTTACTTAATGAGTCTGG - Intronic
1029800673 7:102944162-102944184 CTGTATTAACTCAATTACTCAGG + Intronic
1030373313 7:108725597-108725619 CTTATTTTACTCCATTACTAAGG + Intergenic
1034624724 7:152483915-152483937 TTTAATCTTCTCATTTACTCTGG + Intergenic
1036255203 8:7200654-7200676 CTTTATTTAGTCAATTAATCAGG + Intergenic
1036362284 8:8086842-8086864 CTTTATTTAGTCAATTAATCAGG - Intergenic
1036413477 8:8525235-8525257 CTTAATATGATCCATTACTCAGG + Intergenic
1036896274 8:12638325-12638347 CTTTATTTAGTCAATTAATCAGG + Intergenic
1037445741 8:18964096-18964118 CTAAATCTAATGAATAACTCGGG + Intronic
1040536230 8:48313414-48313436 ATTAATCTACTCAACTTCTAGGG - Intergenic
1050175418 9:2864952-2864974 CATTAACTACTCAATTATTCAGG + Intergenic
1052226669 9:26097253-26097275 CTAAAACTCCTCCATTACTCTGG - Intergenic
1052272146 9:26638050-26638072 CTGAATCTACTCAAATGCTCTGG + Intergenic
1052310594 9:27064218-27064240 TTTCATCTACTCAAGTCCTCTGG + Intergenic
1053565620 9:39247569-39247591 CTCAATTTCCTCAATTCCTCAGG + Intronic
1055141123 9:72878071-72878093 CTTTATCTTGTCAATTGCTCTGG - Intergenic
1057334801 9:94147318-94147340 GTTCATCTTCTCAATTACACAGG + Intergenic
1058504640 9:105655759-105655781 CTTAATCTCCTGAAATACTTAGG + Intergenic
1186111836 X:6266020-6266042 CTTAATCTCCCCAATGACTGAGG - Intergenic
1187348660 X:18491130-18491152 ATGAATTTACTCAATTGCTCTGG + Intronic
1194330413 X:92577777-92577799 CTTAATCTTCTTATTTACCCAGG + Intronic
1199870803 X:151896795-151896817 ATTAATCTACTCTACTGCTCTGG + Intergenic
1200639118 Y:5696847-5696869 CTTAATCTTCTTATTTACCCAGG + Intronic
1201463300 Y:14252500-14252522 TTTAAAATACTCAAGTACTCCGG - Intergenic