ID: 1167293504

View in Genome Browser
Species Human (GRCh38)
Location 19:48636759-48636781
Sequence CCCCGCACGCAGGTTTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167293496_1167293504 16 Left 1167293496 19:48636720-48636742 CCTGAGTAATTGAGTAGATTAAG 0: 1
1: 0
2: 0
3: 9
4: 131
Right 1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1167293495_1167293504 24 Left 1167293495 19:48636712-48636734 CCTAAACACCTGAGTAATTGAGT 0: 1
1: 0
2: 1
3: 18
4: 155
Right 1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG 0: 1
1: 0
2: 0
3: 3
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167293504 Original CRISPR CCCCGCACGCAGGTTTCTAT GGG Intronic
907357703 1:53889873-53889895 CGCAGCACGCAGGTTTCTCTGGG - Intergenic
912567672 1:110599901-110599923 CCCTGCACCCAGGTTTCTGGTGG + Intronic
915831707 1:159137353-159137375 CCCAGCACGTAGGTTTTAATAGG - Intronic
1070838824 10:79469076-79469098 CCCCTCACGCATGTGTTTATTGG - Intergenic
1071832034 10:89381414-89381436 CCCCACACACAGGTTTCATTGGG + Intronic
1077996221 11:7454612-7454634 CCCCGTAGGCAGTTTCCTATTGG - Intronic
1089076844 11:115745287-115745309 CCACGCAGGGAGGTTTCTCTTGG + Intergenic
1090415586 11:126538103-126538125 CCACCCATGCAGGTTTCTAATGG - Intronic
1103967069 12:124646704-124646726 CCCCGCGCTCGGGTTTCTGTGGG - Intergenic
1122347970 14:101072149-101072171 CCCAGCAGCCAGGTGTCTATAGG + Intergenic
1137531841 16:49282763-49282785 CCCCGCACGCTGGGTTTTAAGGG - Intergenic
1141887795 16:86904635-86904657 CCCAGCACACAGGTATCTCTGGG + Intergenic
1148788089 17:50155738-50155760 CCCAGCACGCAGGTGGCTTTGGG + Intergenic
1156447104 18:37245260-37245282 CCCCTGAGGCAGGTTCCTATTGG - Intronic
1158548849 18:58417820-58417842 CCACCCAGGCAGGTTTCTGTGGG - Intergenic
1161140908 19:2647247-2647269 CCCAGCACCCACGTTCCTATGGG - Intronic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
1167504449 19:49863728-49863750 CCACGCACGCAGGCTTGTACCGG - Exonic
926822729 2:16871074-16871096 TGCTCCACGCAGGTTTCTATAGG + Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
938382872 2:130846493-130846515 CCCCGCAGGCAGGTTCCTGAGGG - Intronic
945415024 2:209560026-209560048 CCCTGCACACAGATTTATATTGG - Intronic
1171211939 20:23324018-23324040 ACCTGCACCCAGGTTTCTAGAGG - Intergenic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1179495928 21:41771306-41771328 CCTTGCACGCAGCTTTCTCTTGG - Intergenic
1181842215 22:25673601-25673623 GCCCAAACGCAGGTTTCTATAGG + Intronic
1183464415 22:37972562-37972584 CCCAGCACCCAGGTTGCTGTCGG - Exonic
950658577 3:14452595-14452617 CCCCGCTCCCAGGTTACTCTTGG + Intronic
999684270 5:154088453-154088475 CCCCACACTCAGCTTTCTACAGG + Intronic
1002717408 5:181236190-181236212 CCCTGTACTGAGGTTTCTATTGG + Intergenic
1005955419 6:30660049-30660071 CCCCGGACGCAGGTTTCCTGTGG - Exonic
1008952027 6:57172195-57172217 CCCCACGCGAAGGTTCCTATCGG - Intergenic
1016969758 6:149750554-149750576 CCCCGCACGGAGCTTTCCACTGG - Intronic
1018942532 6:168319196-168319218 CCCCGCGCGCAGGTGCCTAGAGG - Intronic
1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG + Intergenic
1029524659 7:101087581-101087603 CCCGGCACGCAGGTCTCCACAGG - Exonic
1036556416 8:9863843-9863865 CCCAGGACGCAGATTTCTACAGG - Intergenic
1062589555 9:137267228-137267250 CCCCGGGCGCAGGTTTCTGCAGG + Exonic
1188287105 X:28341127-28341149 CCACTCACGCACTTTTCTATGGG + Intergenic