ID: 1167300707

View in Genome Browser
Species Human (GRCh38)
Location 19:48675897-48675919
Sequence AGCTCAGCTCCTTCTCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167300701_1167300707 5 Left 1167300701 19:48675869-48675891 CCTGCCTGGGGGCTCCAGCTGGG No data
Right 1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG No data
1167300699_1167300707 13 Left 1167300699 19:48675861-48675883 CCTTGGGACCTGCCTGGGGGCTC No data
Right 1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG No data
1167300693_1167300707 24 Left 1167300693 19:48675850-48675872 CCCAGCTCTAGCCTTGGGACCTG No data
Right 1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG No data
1167300694_1167300707 23 Left 1167300694 19:48675851-48675873 CCAGCTCTAGCCTTGGGACCTGC No data
Right 1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG No data
1167300703_1167300707 1 Left 1167300703 19:48675873-48675895 CCTGGGGGCTCCAGCTGGGCTCA No data
Right 1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG No data
1167300704_1167300707 -9 Left 1167300704 19:48675883-48675905 CCAGCTGGGCTCAGAGCTCAGCT No data
Right 1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG No data
1167300692_1167300707 25 Left 1167300692 19:48675849-48675871 CCCCAGCTCTAGCCTTGGGACCT No data
Right 1167300707 19:48675897-48675919 AGCTCAGCTCCTTCTCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167300707 Original CRISPR AGCTCAGCTCCTTCTCCGTG GGG Intergenic
No off target data available for this crispr