ID: 1167304658 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:48700685-48700707 |
| Sequence | AATTATCTGCATGTGATGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 11762 | |||
| Summary | {0: 2, 1: 2, 2: 51, 3: 1079, 4: 10628} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1167304658_1167304661 | 17 | Left | 1167304658 | 19:48700685-48700707 | CCAGCCATCACATGCAGATAATT | 0: 2 1: 2 2: 51 3: 1079 4: 10628 |
||
| Right | 1167304661 | 19:48700725-48700747 | AAAGAGGCTCGTTCTTGTCTTGG | 0: 2 1: 0 2: 0 3: 7 4: 101 |
||||
| 1167304658_1167304660 | 1 | Left | 1167304658 | 19:48700685-48700707 | CCAGCCATCACATGCAGATAATT | 0: 2 1: 2 2: 51 3: 1079 4: 10628 |
||
| Right | 1167304660 | 19:48700709-48700731 | CTTTCAAAAACAGCAGAAAGAGG | 0: 2 1: 0 2: 2 3: 39 4: 667 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1167304658 | Original CRISPR | AATTATCTGCATGTGATGGC TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||