ID: 1167304658

View in Genome Browser
Species Human (GRCh38)
Location 19:48700685-48700707
Sequence AATTATCTGCATGTGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11762
Summary {0: 2, 1: 2, 2: 51, 3: 1079, 4: 10628}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167304658_1167304661 17 Left 1167304658 19:48700685-48700707 CCAGCCATCACATGCAGATAATT 0: 2
1: 2
2: 51
3: 1079
4: 10628
Right 1167304661 19:48700725-48700747 AAAGAGGCTCGTTCTTGTCTTGG 0: 2
1: 0
2: 0
3: 7
4: 101
1167304658_1167304660 1 Left 1167304658 19:48700685-48700707 CCAGCCATCACATGCAGATAATT 0: 2
1: 2
2: 51
3: 1079
4: 10628
Right 1167304660 19:48700709-48700731 CTTTCAAAAACAGCAGAAAGAGG 0: 2
1: 0
2: 2
3: 39
4: 667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167304658 Original CRISPR AATTATCTGCATGTGATGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr