ID: 1167305061

View in Genome Browser
Species Human (GRCh38)
Location 19:48703436-48703458
Sequence ACTCCTGGAGGATCTCCTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 2, 1: 0, 2: 1, 3: 21, 4: 243}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167305061_1167305065 0 Left 1167305061 19:48703436-48703458 CCGCCAGGAGATCCTCCAGGAGT 0: 2
1: 0
2: 1
3: 21
4: 243
Right 1167305065 19:48703459-48703481 TCACCCTGCACGACCACGTGCGG 0: 1
1: 0
2: 1
3: 7
4: 44
1167305061_1167305069 4 Left 1167305061 19:48703436-48703458 CCGCCAGGAGATCCTCCAGGAGT 0: 2
1: 0
2: 1
3: 21
4: 243
Right 1167305069 19:48703463-48703485 CCTGCACGACCACGTGCGGGAGG 0: 1
1: 1
2: 1
3: 2
4: 55
1167305061_1167305074 26 Left 1167305061 19:48703436-48703458 CCGCCAGGAGATCCTCCAGGAGT 0: 2
1: 0
2: 1
3: 21
4: 243
Right 1167305074 19:48703485-48703507 GAGGCCCAGAAGTTCCTGCGGGG 0: 2
1: 1
2: 1
3: 9
4: 132
1167305061_1167305070 7 Left 1167305061 19:48703436-48703458 CCGCCAGGAGATCCTCCAGGAGT 0: 2
1: 0
2: 1
3: 21
4: 243
Right 1167305070 19:48703466-48703488 GCACGACCACGTGCGGGAGGAGG 0: 1
1: 1
2: 0
3: 6
4: 76
1167305061_1167305072 24 Left 1167305061 19:48703436-48703458 CCGCCAGGAGATCCTCCAGGAGT 0: 2
1: 0
2: 1
3: 21
4: 243
Right 1167305072 19:48703483-48703505 AGGAGGCCCAGAAGTTCCTGCGG 0: 2
1: 0
2: 5
3: 35
4: 294
1167305061_1167305066 1 Left 1167305061 19:48703436-48703458 CCGCCAGGAGATCCTCCAGGAGT 0: 2
1: 0
2: 1
3: 21
4: 243
Right 1167305066 19:48703460-48703482 CACCCTGCACGACCACGTGCGGG 0: 1
1: 0
2: 1
3: 7
4: 75
1167305061_1167305073 25 Left 1167305061 19:48703436-48703458 CCGCCAGGAGATCCTCCAGGAGT 0: 2
1: 0
2: 1
3: 21
4: 243
Right 1167305073 19:48703484-48703506 GGAGGCCCAGAAGTTCCTGCGGG 0: 2
1: 0
2: 3
3: 30
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167305061 Original CRISPR ACTCCTGGAGGATCTCCTGG CGG (reversed) Exonic
900151260 1:1180242-1180264 CCTCCTGGAGGGGCTCCTGCTGG + Exonic
900983652 1:6060574-6060596 ACTCTCGGAGGAGCTGCTGGAGG + Intronic
901680853 1:10912026-10912048 ACTCCTGCAGGATCTCTGGTGGG + Intergenic
901829560 1:11883752-11883774 AGCCCTGGAGGATCTCTTAGGGG - Intergenic
902720273 1:18299712-18299734 ACTCCTGGATGAACTCTGGGTGG - Intronic
902779805 1:18697731-18697753 AATCCAGGAGGACTTCCTGGAGG - Intronic
902798910 1:18817509-18817531 AATCCAGGAGGACTTCCTGGAGG + Intergenic
902882943 1:19384842-19384864 ACTCCAGGAGGACTTCCTGAAGG - Intronic
903271066 1:22188634-22188656 AATCCTGGAGGACCTGCTGGAGG - Intergenic
903311383 1:22459983-22460005 ACTTCTCTAGGATCTTCTGGAGG - Intronic
903438584 1:23370379-23370401 AATCCTGGAGGGTCCCCTAGAGG + Exonic
905161555 1:36039852-36039874 AGTCCTGGATGATCTCCTGTCGG - Exonic
906562200 1:46767367-46767389 ACTCTTAGAGGACTTCCTGGAGG + Intronic
907962766 1:59298276-59298298 GCTCTTGGAGGACCTCCTAGTGG + Intronic
908667693 1:66510628-66510650 AATCCTGGAGGCAATCCTGGAGG - Intergenic
909789269 1:79653622-79653644 ACTCCTTGAGGAACTACTTGAGG - Intergenic
913240009 1:116821744-116821766 AGACATGGAGGATGTCCTGGAGG + Intergenic
913412129 1:118563727-118563749 AGGCCTGGAGGTTCTCCAGGGGG + Intergenic
915265462 1:154713589-154713611 AGGGCTGGAGGATCTGCTGGTGG - Intronic
915476638 1:156156442-156156464 AATCCTGGAGGCCCTTCTGGTGG - Exonic
916210646 1:162357082-162357104 GCTGCTGGAGGAGCTGCTGGAGG - Exonic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
917545044 1:175956815-175956837 TCTTCTGGAGTATCTCCTGAAGG - Intronic
920032607 1:203046265-203046287 ACACCTGCAGGAGCTGCTGGAGG + Intronic
920226480 1:204442760-204442782 CCTCCTTAAGGATCTTCTGGAGG - Intronic
920343621 1:205291892-205291914 ACCCCTGGGGGAACCCCTGGGGG - Intergenic
922803425 1:228374152-228374174 AGTCTTGGAGGACTTCCTGGAGG + Intronic
924380578 1:243460331-243460353 TCTCTAGGAGGATCTCCGGGAGG + Intronic
1063114983 10:3067077-3067099 ACGCCGGGAGCATCTCCCGGGGG - Intronic
1064976065 10:21117173-21117195 TCTCCTGGTGGGTCTCATGGTGG - Intronic
1067251766 10:44592803-44592825 ACTCCTGCAGGAACACCTAGGGG + Intergenic
1067567503 10:47349480-47349502 AGTCCTTCAGGACCTCCTGGAGG - Exonic
1067724527 10:48759868-48759890 ACTCATGGAGCAGCTCTTGGAGG - Intronic
1067732185 10:48820416-48820438 GCCCCTGGAGGTGCTCCTGGAGG + Exonic
1069693326 10:70368982-70369004 ACTCCTGCAGGATTTTCTGAAGG - Intronic
1070580557 10:77716002-77716024 ACTCCTTGAGGATCTCCTTTGGG - Intergenic
1070975006 10:80599567-80599589 ACTCCTGCAGTGGCTCCTGGAGG + Intronic
1071431970 10:85613406-85613428 CCTCCTTGGGGGTCTCCTGGTGG + Exonic
1071842773 10:89490237-89490259 ACTCCTGGAGGAGGTCATGTCGG + Intronic
1072531267 10:96321735-96321757 ACTCCTGGACCATCACCTGATGG + Intronic
1072772083 10:98150639-98150661 ACTACTGGAATATCTCCTGTGGG - Intronic
1072821359 10:98561030-98561052 CCTCCTGGAGGATCTGCCTGAGG - Intronic
1074519856 10:114209240-114209262 ACTCATGGAGGATCTTATGATGG + Intronic
1075423355 10:122322804-122322826 ACTCTTGGAGGGTTTCCTTGGGG - Intronic
1076769683 10:132656213-132656235 CCACCTGGAGGAACTCCTAGAGG + Intronic
1077033165 11:479384-479406 CCTCCAGGAGCATCTGCTGGTGG + Intronic
1077865677 11:6219155-6219177 ACTCCTAGAGGAACTCCTAGAGG + Intronic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1078838193 11:15052200-15052222 TTTCCTGGAGGATTTCCTTGAGG - Intronic
1081508782 11:43746550-43746572 TCTTCTGGAGTATCTCCTGAAGG + Intronic
1081759567 11:45567837-45567859 AATCCTGGAGGGCATCCTGGAGG - Intergenic
1086854619 11:91851310-91851332 ACTACTGGCAGATCTCCTAGAGG - Intergenic
1088620043 11:111672282-111672304 GCTCCTTGAGCTTCTCCTGGTGG - Intronic
1089351750 11:117825245-117825267 CCTTCTGGAGGATCTACTGCTGG - Intronic
1089605941 11:119641385-119641407 ACTGTTGGAGGAACTCTTGGAGG - Intronic
1089976994 11:122741579-122741601 AATCCTCGCGGGTCTCCTGGTGG + Intronic
1090012502 11:123057792-123057814 ATGCCTGGGGGATTTCCTGGTGG - Exonic
1090540093 11:127692321-127692343 TCTTCTGGAGTATCTCCTGAAGG + Intergenic
1090653228 11:128824637-128824659 ACTCCGGGAGCAGCTCCGGGTGG + Intergenic
1090871955 11:130756977-130756999 GCTCCTGGAGGAGGTTCTGGAGG + Intergenic
1095282829 12:40376013-40376035 ACTCCTGAAGGATCTGCCTGAGG - Intergenic
1099184841 12:79505166-79505188 CCTCCGGGAGCCTCTCCTGGGGG - Intergenic
1101828706 12:108240661-108240683 AACCCTGGAGGACATCCTGGAGG + Intronic
1102317532 12:111901556-111901578 ACTGCTGGAGGAGCTTCTGCCGG - Intergenic
1102564131 12:113783508-113783530 ACACCTGGAGGATTTCATGGGGG + Intergenic
1104996601 12:132661742-132661764 ACTCCTGGAGGGACACCAGGTGG - Intronic
1106141935 13:27019049-27019071 AATCCTGGAGGAGATCGTGGGGG - Intergenic
1112288875 13:98127403-98127425 CCTCCTAAAGGATCTCCTTGAGG - Intergenic
1112643710 13:101306082-101306104 CATCCTGGAGGGTCTCCAGGAGG + Intronic
1113759788 13:112839354-112839376 GCTCCTGGAGGAGCTCCAGGAGG - Intronic
1113794810 13:113050808-113050830 ACTCCAGGAGGACTTCCCGGCGG + Intronic
1114267996 14:21083909-21083931 GCTCCTGGAGGAGCTCCTGAGGG + Exonic
1114653562 14:24302271-24302293 ACTCCTGGAGCAGGTCCTGCTGG + Exonic
1115635603 14:35287634-35287656 AGTCTTGGAAAATCTCCTGGGGG - Intronic
1116892635 14:50283359-50283381 ACTCCTGGAGGGTCTTGTGCTGG - Intronic
1122204480 14:100141729-100141751 CCTCCTCTAGGATCTCCTGTTGG - Exonic
1122546332 14:102524697-102524719 ACTCCTGCAGGGACTCCTGGCGG - Intergenic
1122987704 14:105220115-105220137 TCTCCTGAAGCATCTTCTGGAGG + Exonic
1125496730 15:40202590-40202612 ACTCGTGGGGGATCTGCAGGAGG - Exonic
1126168730 15:45676181-45676203 GCTCCTGGATGATCTCCTGCAGG - Exonic
1128680842 15:69650244-69650266 AGGTCTGGAGGATCTGCTGGAGG - Intergenic
1128868814 15:71136770-71136792 ACTCCTGGAGGACCCCCTCCTGG - Intronic
1129362160 15:75030639-75030661 CCTCCTGCTGGATCTCCTGCAGG + Intronic
1130276061 15:82476925-82476947 GCTCCTGCAGGTTCACCTGGAGG + Intergenic
1130307688 15:82725567-82725589 ACTGGTGGAGGAGCTCCTGCCGG + Intergenic
1130468421 15:84204316-84204338 GCTCCTGCAGGTTCACCTGGAGG + Intergenic
1130485325 15:84395434-84395456 GCTCCTGCAGGTTCACCTGGAGG - Intergenic
1130495845 15:84469226-84469248 GCTCCTGCAGGTTCACCTGGAGG - Intergenic
1130590714 15:85208914-85208936 GCTCCTGCAGGTTCACCTGGAGG + Intergenic
1130834944 15:87640854-87640876 GCTCCTGGAGGGGATCCTGGAGG - Intergenic
1131316989 15:91348034-91348056 CATCCTGGAGTGTCTCCTGGAGG + Intergenic
1131953191 15:97704028-97704050 ACACCTGGAGAAGCTCCTGTGGG - Intergenic
1132157351 15:99504922-99504944 CCTCCTGGAGCTCCTCCTGGAGG + Intergenic
1132157350 15:99504922-99504944 CCTCCAGGAGGAGCTCCAGGAGG - Intergenic
1133257903 16:4529278-4529300 CCTCCTGCTGGGTCTCCTGGCGG - Intronic
1133888495 16:9854783-9854805 ACTCCTGGAAGCACTGCTGGAGG - Intronic
1133970555 16:10564738-10564760 CCTCCTGGAGGCTGCCCTGGTGG - Intronic
1134686952 16:16165691-16165713 ACTCCTGGAGGTCAGCCTGGTGG - Exonic
1134833056 16:17338897-17338919 ACTCCTGGAAGGCTTCCTGGAGG - Intronic
1135498758 16:22975622-22975644 TGTGCTGGAGGATCACCTGGGGG - Intergenic
1138070847 16:53991667-53991689 CTTCCTGGAGGATCACCTGTAGG + Intronic
1138190775 16:55012022-55012044 AATCTTGGAGGTCCTCCTGGAGG - Intergenic
1139469253 16:67169656-67169678 ACTCCTGCTGGATGTCCAGGCGG + Exonic
1139619073 16:68122514-68122536 TCTCCTGGTGGCTCTCCAGGGGG + Exonic
1141943248 16:87292608-87292630 ACTGCTGGGGGCTATCCTGGAGG + Intronic
1142034776 16:87856186-87856208 ACTCCTGGAGGCAGTCCTCGGGG - Intronic
1142850701 17:2703462-2703484 TCTCCTGCACCATCTCCTGGGGG + Exonic
1143023254 17:3927501-3927523 GCGGCTGGAGGATTTCCTGGCGG + Intronic
1143321569 17:6071873-6071895 CTTCCCGGAGGATCTCCTGAGGG - Intronic
1145254221 17:21313993-21314015 AGTCATGGAGGGCCTCCTGGGGG + Intronic
1145322381 17:21773969-21773991 AGTCATGGAGGGCCTCCTGGGGG - Intergenic
1147156084 17:38545081-38545103 AGTCCTTGAGGATCTCCTCTGGG + Intronic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1148788444 17:50158585-50158607 AATTCTGGAAGGTCTCCTGGTGG - Intergenic
1148824581 17:50383014-50383036 CCCACTGGAGGATCTCATGGCGG + Exonic
1148911895 17:50947278-50947300 CCTCCTGGAGGGTCTGCAGGGGG + Intergenic
1150097581 17:62391225-62391247 GATCCACGAGGATCTCCTGGAGG + Intronic
1150266104 17:63833327-63833349 ATTCCTGGATGAAGTCCTGGGGG + Exonic
1151305056 17:73257895-73257917 CCTCCTGGGGAATCCCCTGGAGG - Intronic
1152270230 17:79320199-79320221 ACTGCTGGTGTGTCTCCTGGAGG + Intronic
1152803702 17:82344558-82344580 CCTCCTGGAGACCCTCCTGGTGG + Intergenic
1152918201 17:83052549-83052571 CCTCCTGGAGGACCTCCTGGTGG - Intergenic
1152918238 17:83052651-83052673 CCTCCTGGGGGACCTCCTGGTGG - Intergenic
1152918280 17:83052753-83052775 CCTCCTGGGGGACCTCCTGGTGG - Intergenic
1152918321 17:83052855-83052877 CCTCCTGGGGGACCTCCTGGTGG - Intergenic
1152918363 17:83052957-83052979 CCTCCTGGAGGACCTCACGGTGG - Intergenic
1153179011 18:2411829-2411851 ACTCCTGGGCAATTTCCTGGAGG - Intergenic
1153746506 18:8185335-8185357 CCTCCTGGTGGGGCTCCTGGGGG - Intronic
1154426439 18:14275606-14275628 ACTCGTGGAGGTTCTCCAAGAGG + Intergenic
1155516441 18:26628008-26628030 ACTCCTGGCAGATCACATGGTGG - Intronic
1156389547 18:36637758-36637780 ACTTCTGGAGGGTCTCCTCAAGG - Intronic
1156729018 18:40167363-40167385 TCTTCTGGAGTATCTCCTGAAGG - Intergenic
1157943591 18:51955265-51955287 ACTGCTTGAGCAGCTCCTGGAGG - Intergenic
1158348907 18:56544286-56544308 ATTCCTGGAGGATGGCCTGCTGG - Intergenic
1158649760 18:59274214-59274236 ACTCCAGGTGGGTCTCCTGCGGG - Intergenic
1159187213 18:64990702-64990724 CCTCCTGAAGGACCTCCTTGAGG - Intergenic
1162464086 19:10830350-10830372 ACTCCTGGGGGAATCCCTGGGGG - Exonic
1163775030 19:19212660-19212682 ACTCAGGGAGGAGGTCCTGGGGG + Intronic
1163906219 19:20151494-20151516 ACTCCAGGAGGATCTTTGGGGGG - Intergenic
1165622622 19:37260996-37261018 ACCCCTGGAGTAGCCCCTGGAGG + Intergenic
1167145543 19:47679479-47679501 CCTCTTGGAGGCTCTGCTGGAGG - Exonic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1168319075 19:55498223-55498245 ACTCCAGGAGGGCTTCCTGGAGG + Intronic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925180349 2:1813409-1813431 GCTGCTGGAAGCTCTCCTGGGGG - Intronic
927192145 2:20524157-20524179 TCTCCTTGAATATCTCCTGGAGG + Intergenic
928086107 2:28347415-28347437 AATCCTGGAGGGCTTCCTGGAGG + Intergenic
929599244 2:43194626-43194648 ACTCCTGGTGGGCCTTCTGGAGG + Intergenic
930206755 2:48594665-48594687 AGTCCTGGAGGACCTCCAGGAGG + Intronic
930864997 2:56113764-56113786 CCTCCTGAAACATCTCCTGGTGG + Intergenic
932775670 2:74526972-74526994 GCTCCTGCAGGCTCTCCTGCCGG + Exonic
932817139 2:74871092-74871114 ACTGCTCCAGGATCACCTGGAGG + Intronic
934576292 2:95403485-95403507 GCCTCTGGAGGATCTCCTGTGGG + Intronic
934795180 2:97094097-97094119 GCCTCTGGAGGATCTCCTGTGGG - Intronic
939929839 2:148219328-148219350 TCTTCTGGAGTACCTCCTGGAGG + Intronic
942686595 2:178539218-178539240 ACTTCTGGAGGATTGCTTGGAGG + Exonic
943007623 2:182404832-182404854 CCTCCTGAAGGATCTCCATGAGG + Intronic
943618889 2:190125067-190125089 CCTCCTGAAGGACCTTCTGGAGG + Intronic
944317321 2:198296898-198296920 ACTTCTGGAGGCTCTCTTGGGGG + Intronic
944706180 2:202291280-202291302 ACTCCTGGAGAATCTAGTTGTGG + Intronic
944876135 2:203965395-203965417 GCTTCTGGAGGAACGCCTGGTGG + Intergenic
946486158 2:220102845-220102867 ATTCCTGGAGGGCTTCCTGGTGG - Intergenic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
948585080 2:239014498-239014520 ACCCATGGACGAGCTCCTGGAGG + Intergenic
1168862073 20:1052724-1052746 ACTTGTGGAGTATCTCCAGGGGG - Intergenic
1169067799 20:2704278-2704300 ATTCCTGGAGGGTGTCCTAGGGG + Intronic
1170418353 20:16168441-16168463 ATTCCTTGAGGATTTCCTTGGGG + Intergenic
1172811372 20:37650509-37650531 AGTCAGGGAGGGTCTCCTGGAGG + Intergenic
1173005528 20:39137078-39137100 ACTCCGGGACGCTCTCCTGGTGG + Intergenic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1175487580 20:59356484-59356506 CCTTCTGAAGGATCTGCTGGAGG - Intergenic
1175906609 20:62382973-62382995 GCCCCTGGAGGCTCTCCTGATGG + Intergenic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1179933749 21:44590129-44590151 ACTCCGGGAGGTCCTCCTGCTGG + Intronic
1180858403 22:19062601-19062623 ACTGCTGGAGTATGTCCAGGAGG + Intronic
1182122501 22:27797069-27797091 GCGCCTGAAGGATCTCCAGGGGG + Exonic
1182278589 22:29205748-29205770 ACACCTGGCGGGCCTCCTGGCGG + Intergenic
1183592350 22:38787109-38787131 ACACCTGGAGCATGTCATGGTGG + Intronic
1184257329 22:43294697-43294719 ATTCCAGGAGGACTTCCTGGAGG - Intronic
1184988694 22:48153317-48153339 AGTCCTGGAGGGGCTCCGGGTGG + Intergenic
1185234765 22:49705348-49705370 CCTCCTCGTGGTTCTCCTGGGGG - Intergenic
949574184 3:5322842-5322864 ACTCCTGGATGCTCTCAAGGAGG + Intergenic
949935707 3:9113940-9113962 ACTCCTCGGGGGACTCCTGGTGG - Intronic
949966767 3:9363233-9363255 ACTTCAGGCGGATCTCGTGGCGG + Exonic
951242223 3:20300854-20300876 ACTCCAGGAGTAACTCCTAGAGG - Intergenic
952581480 3:34838482-34838504 CCTCCTGGAGGATCTGAGGGAGG + Intergenic
953766417 3:45746873-45746895 GCTCCTGGAGGCACTCCTGCTGG + Intergenic
957788309 3:84908585-84908607 ATTCCTACAGGATATCCTGGTGG - Intergenic
959414919 3:106072355-106072377 ACTGATGGAAGATCTCCAGGTGG + Intergenic
959670249 3:108969056-108969078 AGTCCTTAAGGATTTCCTGGGGG - Intronic
961433219 3:126897972-126897994 ACTCCTGCAGGGTCTCCATGAGG + Intronic
962253814 3:133856754-133856776 ACGCCTGGAGTATCTTCTGCCGG + Intronic
963930950 3:151003859-151003881 ACCCCTGGAGGAACACCTGGGGG + Intergenic
967606348 3:191451694-191451716 GCTCCTTCAGGATCTGCTGGTGG + Intergenic
968058556 3:195711482-195711504 GCTCCTGGTGAGTCTCCTGGAGG + Intergenic
968231866 3:197009119-197009141 TCTCCTGGAGGATCTCAGTGCGG + Intronic
968655334 4:1776108-1776130 TTTCCTGGAGGACTTCCTGGTGG - Intergenic
969523982 4:7694932-7694954 TCTCCTTGAGGCTCTCCTTGAGG + Intronic
972528811 4:39942921-39942943 ACTCCTAAAGGATCTCCTGAAGG + Intronic
974944033 4:68504918-68504940 ACTACTGCAGGAGCTCCTGTAGG - Intergenic
980858962 4:138476157-138476179 ACTCCTGGAAGATGTCCATGGGG + Intergenic
982217511 4:153095047-153095069 ACACCTGGTGGCTCTCCTCGGGG + Intergenic
983269015 4:165539272-165539294 CATCCTGAAGGATCTCCTGATGG + Intergenic
984641765 4:182173806-182173828 ACACATGGAGTATCTCCAGGAGG + Intronic
985635324 5:1033055-1033077 ACACAGGGAGCATCTCCTGGAGG + Intronic
985661611 5:1160007-1160029 AGACCTGGAGGCCCTCCTGGGGG + Intergenic
986376970 5:7142184-7142206 ACTCCAGGAAGATTTCCTGAGGG - Intergenic
987065634 5:14286943-14286965 ACTCCTGCAGGATCTTCAGAAGG - Exonic
987118616 5:14745998-14746020 GCTCCTGGAGGACTTCCTGCTGG - Intronic
987484398 5:18506240-18506262 ACTCCTGAAGGACCTGCTTGGGG - Intergenic
987593208 5:19960499-19960521 TCTCCTGGAATATCTCCTGAAGG + Intronic
992058002 5:73011959-73011981 CCTCCTGAAGGACCTGCTGGAGG + Intronic
994680290 5:102878530-102878552 CCTCCTGAAGGACCTGCTGGAGG - Intronic
996690419 5:126334196-126334218 ACTCCAGGAAGATCAGCTGGGGG + Intergenic
997383720 5:133456156-133456178 ACTCTTGGAGGAGCTCCTCAGGG + Intronic
997972741 5:138417152-138417174 ACCCCTAGAGTTTCTCCTGGAGG + Intronic
1001021722 5:168188774-168188796 GCTCCTGGAGGCTCTCCCTGGGG + Intronic
1002852888 6:1012028-1012050 CCCCCTGGAGGATCTCAGGGAGG + Intergenic
1004102442 6:12627713-12627735 CTTCCTGGAGGATCTGCAGGAGG + Intergenic
1006401881 6:33822487-33822509 AATCCAGGAGGACCTCCTAGAGG - Intergenic
1007325387 6:41055511-41055533 ACTCCAGGAGGGAGTCCTGGGGG - Intronic
1008212953 6:48747668-48747690 ACTGCTAGAGAATTTCCTGGAGG - Intergenic
1008632942 6:53381577-53381599 ATGCCTGGAGGAACTCCTGGGGG - Intergenic
1008813167 6:55530049-55530071 AAACCTGGAGGATCTGGTGGGGG + Intronic
1011456765 6:87558886-87558908 CCTTCTGGAGTATCTCCTGAAGG - Intronic
1011730380 6:90256492-90256514 ATTCCTGAAGGATTTCCAGGAGG + Intronic
1015212188 6:130710939-130710961 CCTCCTGGAGGATCTAGAGGAGG + Intergenic
1016903699 6:149128570-149128592 ACAGCTGGAGGACCTCCTGTGGG - Intergenic
1017002663 6:150006609-150006631 CCTGCTGGAGGCTCTCCTGCTGG - Intergenic
1018796590 6:167190230-167190252 TCTGCTGGAGGATCTGATGGTGG + Intronic
1021378031 7:19932749-19932771 AGTCCTTGAGGACTTCCTGGTGG + Intergenic
1024923470 7:54586800-54586822 CCTCCTGGAGGACCTGCCGGAGG + Intergenic
1024995177 7:55268745-55268767 TCTCCTGGAGGGACTCCTGGAGG - Intergenic
1026900677 7:74035378-74035400 ATTCCTGGTGGAGTTCCTGGAGG + Exonic
1030099674 7:105934347-105934369 AATCCAGGTGGATCACCTGGAGG + Intronic
1033468472 7:141620727-141620749 GCTCCTGGTTGAGCTCCTGGAGG - Intronic
1034656767 7:152735977-152735999 ATCCCTGGAGGGTCACCTGGAGG + Intergenic
1034740281 7:153467101-153467123 TCTCCTGAAGGTTCTCCTGCTGG + Intergenic
1037591217 8:20313539-20313561 CCTCTTTGAGGTTCTCCTGGAGG + Intergenic
1038302221 8:26363016-26363038 ATTCCTGGAAGCTCTCTTGGGGG + Intronic
1038535085 8:28347914-28347936 TTTCCTCGAGGAACTCCTGGAGG - Exonic
1048472405 8:134714853-134714875 TCTCTTGGAGGCTCTCCTGGAGG - Intergenic
1049384014 8:142331787-142331809 TCTCCTGGAACAGCTCCTGGAGG + Exonic
1049622895 8:143606544-143606566 GCTCCTGCAGCATCTGCTGGAGG - Exonic
1049772716 8:144391169-144391191 ACTCCTGGAAGAGCTCGTGGGGG - Exonic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1052240988 9:26273419-26273441 ACACCTGTAAGATTTCCTGGAGG + Intergenic
1052866935 9:33469652-33469674 TGTCCTGTAGGATTTCCTGGAGG + Exonic
1053553657 9:39110598-39110620 AGACCTGGAGGATCCCCTAGGGG + Intronic
1053817766 9:41930745-41930767 AGACCTGGAGGATCCCCTAGGGG + Intronic
1054108019 9:61074414-61074436 AGACCTGGAGGATCCCCTAGGGG + Intergenic
1054612838 9:67256711-67256733 AGACCTGGAGGATCCCCTAGGGG - Intergenic
1056180206 9:84075665-84075687 ACGAATGGAGGATTTCCTGGCGG + Intergenic
1056698440 9:88880430-88880452 CCTCCTGGAGTGTCTCCTGAGGG - Intergenic
1057762142 9:97884887-97884909 CCTCCTGGAGGATCTACCTGAGG + Intergenic
1058833694 9:108841812-108841834 ACTCTAGGAAGATTTCCTGGAGG - Intergenic
1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG + Exonic
1061202803 9:129147253-129147275 AGGCCTGGGGGATCCCCTGGCGG + Intronic
1061263976 9:129495201-129495223 AAGCCTGCAGGATCCCCTGGGGG - Intergenic
1062725890 9:138073303-138073325 ACTTCTGGAAGATTTTCTGGTGG + Intronic
1190494870 X:51019221-51019243 GCTCCTGAAGGAGCTCCTGAAGG - Intergenic
1193359264 X:80561444-80561466 AGTAATGGAGGAGCTCCTGGAGG - Intergenic
1196203940 X:112917684-112917706 ACTCCTGGAGGGTTGCATGGCGG + Intergenic
1200128272 X:153828455-153828477 CCTCCTGGCGGGTCTCCTTGGGG + Intronic
1201784306 Y:17757543-17757565 TCTCCTTGAGGATCTTCTTGAGG + Intergenic
1201817247 Y:18148444-18148466 TCTCCTTGAGGATCTTCTTGAGG - Intergenic