ID: 1167305267

View in Genome Browser
Species Human (GRCh38)
Location 19:48704639-48704661
Sequence AATTATCTGCATGTGATGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 11762
Summary {0: 2, 1: 2, 2: 51, 3: 1079, 4: 10628}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167305267_1167305271 17 Left 1167305267 19:48704639-48704661 CCAGCCATCACATGCAGATAATT 0: 2
1: 2
2: 51
3: 1079
4: 10628
Right 1167305271 19:48704679-48704701 AAAGAGGCTCGTTCTTGTCTTGG 0: 2
1: 0
2: 0
3: 7
4: 101
1167305267_1167305270 1 Left 1167305267 19:48704639-48704661 CCAGCCATCACATGCAGATAATT 0: 2
1: 2
2: 51
3: 1079
4: 10628
Right 1167305270 19:48704663-48704685 CTTTCAAAAACAGCAGAAAGAGG 0: 2
1: 0
2: 2
3: 39
4: 667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167305267 Original CRISPR AATTATCTGCATGTGATGGC TGG (reversed) Exonic
Too many off-targets to display for this crispr