ID: 1167305270

View in Genome Browser
Species Human (GRCh38)
Location 19:48704663-48704685
Sequence CTTTCAAAAACAGCAGAAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 2, 1: 0, 2: 2, 3: 39, 4: 667}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167305266_1167305270 21 Left 1167305266 19:48704619-48704641 CCAAAAGGGCTGCTACACATCCA 0: 2
1: 0
2: 0
3: 12
4: 125
Right 1167305270 19:48704663-48704685 CTTTCAAAAACAGCAGAAAGAGG 0: 2
1: 0
2: 2
3: 39
4: 667
1167305263_1167305270 30 Left 1167305263 19:48704610-48704632 CCCATGGTCCCAAAAGGGCTGCT 0: 1
1: 0
2: 1
3: 16
4: 106
Right 1167305270 19:48704663-48704685 CTTTCAAAAACAGCAGAAAGAGG 0: 2
1: 0
2: 2
3: 39
4: 667
1167305267_1167305270 1 Left 1167305267 19:48704639-48704661 CCAGCCATCACATGCAGATAATT 0: 2
1: 2
2: 51
3: 1079
4: 10628
Right 1167305270 19:48704663-48704685 CTTTCAAAAACAGCAGAAAGAGG 0: 2
1: 0
2: 2
3: 39
4: 667
1167305264_1167305270 29 Left 1167305264 19:48704611-48704633 CCATGGTCCCAAAAGGGCTGCTA 0: 1
1: 0
2: 1
3: 9
4: 181
Right 1167305270 19:48704663-48704685 CTTTCAAAAACAGCAGAAAGAGG 0: 2
1: 0
2: 2
3: 39
4: 667
1167305268_1167305270 -3 Left 1167305268 19:48704643-48704665 CCATCACATGCAGATAATTCCTT 0: 1
1: 1
2: 1
3: 28
4: 472
Right 1167305270 19:48704663-48704685 CTTTCAAAAACAGCAGAAAGAGG 0: 2
1: 0
2: 2
3: 39
4: 667
1167305265_1167305270 22 Left 1167305265 19:48704618-48704640 CCCAAAAGGGCTGCTACACATCC 0: 2
1: 0
2: 0
3: 11
4: 117
Right 1167305270 19:48704663-48704685 CTTTCAAAAACAGCAGAAAGAGG 0: 2
1: 0
2: 2
3: 39
4: 667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167305270 Original CRISPR CTTTCAAAAACAGCAGAAAG AGG Exonic
901168374 1:7236029-7236051 TTTTCATAAACAGCTGAGAGTGG + Intronic
901171534 1:7261860-7261882 CTTTCAAAAATATCAGACAGAGG + Intronic
901308530 1:8250908-8250930 GTCTCAAAAACAGAAAAAAGAGG - Intergenic
901317289 1:8317859-8317881 CTTTTAAAATCAGAAGAAAACGG + Intronic
901643722 1:10705750-10705772 TTTGCAAAAACGTCAGAAAGTGG + Intronic
902550240 1:17214949-17214971 CTTTGAAAACCACCAGGAAGAGG - Intronic
902945502 1:19834254-19834276 ATGGCAATAACAGCAGAAAGGGG + Intergenic
904067169 1:27762277-27762299 CTTTCACAAACATCACATAGAGG - Intronic
904108600 1:28107053-28107075 TCTTCAAAAACAGCAGTAAAAGG + Intergenic
904240750 1:29143463-29143485 CTCTCAAAAAAAACAAAAAGTGG - Intergenic
905853228 1:41289772-41289794 ATTTCAAAAACAGAAGCAACAGG + Intergenic
905949328 1:41934681-41934703 TTCTCAAAAACAACAGATAGAGG - Intronic
906022529 1:42642727-42642749 CTGCCAAAAACAGCAGACAGCGG - Intronic
906343115 1:44998148-44998170 CATTTAAAAACAGCTAAAAGAGG + Intergenic
907065004 1:51472459-51472481 TTTTTAAAAAGAGCACAAAGAGG - Intronic
907367521 1:53974952-53974974 GTTCTAAAAACAGCAGAAAAGGG - Intergenic
907483294 1:54759356-54759378 TTTTCAAAAACGGAAGTAAGAGG - Intronic
908468433 1:64417545-64417567 ACTTAAAAAACAGCAGAAAGGGG - Intergenic
908925257 1:69246712-69246734 GTTTCAAAAACAGGAGAGTGAGG - Intergenic
908970583 1:69824396-69824418 CTTCCAAAAACAAGAGAAACAGG + Intronic
909924930 1:81427606-81427628 GTTTTGAAAACAGCAGAAAAGGG + Intronic
910996221 1:93106886-93106908 GTTTCAAAATCTGGAGAAAGAGG + Intronic
911434840 1:97844503-97844525 CTTATAAAAACAAAAGAAAGGGG + Intronic
912062605 1:105691239-105691261 ATTTAAAAAACAGGGGAAAGAGG - Intergenic
912312505 1:108637907-108637929 CCTTCAAAAACACCACAAAGGGG - Exonic
912668087 1:111601043-111601065 CTCTCCATAACAGCAGAATGTGG + Intronic
912884127 1:113450727-113450749 GTTCGAAAAACAGCAGAAAAGGG + Intronic
913178483 1:116297103-116297125 TTTACAAAAACAGGTGAAAGTGG - Intergenic
913350863 1:117857478-117857500 CTTTCAAAAACAACTGTAAGGGG - Intergenic
913570553 1:120115707-120115729 CTCACGGAAACAGCAGAAAGAGG - Intergenic
914291360 1:146276686-146276708 CTCACGGAAACAGCAGAAAGAGG - Intergenic
914552404 1:148727469-148727491 CTCACGGAAACAGCAGAAAGAGG - Intergenic
914863634 1:151407118-151407140 ATTTCAGAAAAAGGAGAAAGTGG - Intronic
915982604 1:160430431-160430453 CTTTGAAATACAGCCGAGAGGGG + Intergenic
917544522 1:175949452-175949474 CCTCAGAAAACAGCAGAAAGAGG + Intronic
917647931 1:177047240-177047262 ATTTTAAAAAGAGTAGAAAGAGG + Intronic
918215314 1:182388462-182388484 CCTTTACAAACAGAAGAAAGAGG + Intronic
919676388 1:200387772-200387794 CATTCAAAAACAGCAAGAACTGG + Intergenic
919738978 1:200971316-200971338 CCATCAGAAACAGCAGAAAATGG + Intronic
920736422 1:208536958-208536980 ATGCCAAAAACAGGAGAAAGGGG + Intergenic
920843500 1:209574733-209574755 ATTTCAAAGACAGAAGAAAAGGG - Intergenic
920983599 1:210862761-210862783 CTTTCCACAACAGCAGTAACTGG - Intronic
923342102 1:233016382-233016404 TTTACAAAAAGAGGAGAAAGGGG - Intronic
923843654 1:237703521-237703543 CTCACAAAAACAGGAGAAATAGG - Intronic
924154203 1:241159392-241159414 TTTTCAAAAAGAGGAGAAAAGGG - Intronic
924803144 1:247342491-247342513 GTTTCAAAAAAAGGAAAAAGTGG - Intergenic
1062780708 10:203786-203808 CTTCCAGAAACTGCAGAGAGGGG - Intronic
1063187315 10:3663255-3663277 TTTTCAAAATTAGCAGAGAGTGG - Intergenic
1063534159 10:6866648-6866670 ATTTTAAAAAGAGCAGAGAGGGG - Intergenic
1063652003 10:7947168-7947190 ATTTCAATAACAGCAGAAGAGGG - Intronic
1064524576 10:16240673-16240695 GTCTCAAAAACAGCATAAACTGG + Intergenic
1065126646 10:22580347-22580369 GCTTCAAAAACAGCAAGAAGAGG + Intronic
1066326137 10:34360732-34360754 CATACAAAATCAGCAGAAAAAGG + Intronic
1066517835 10:36183760-36183782 CTTTCAAAGACACAAGAAAGAGG - Intergenic
1067152021 10:43743758-43743780 CTTTGAAAAAAAGCACAAATGGG + Intergenic
1067287392 10:44916589-44916611 CTTTCTTAAACAGCAGGAGGTGG - Intronic
1067499982 10:46794955-46794977 CTTTTAAAAACAGACTAAAGAGG + Intergenic
1067534695 10:47100252-47100274 CTTTGAAAAACAGCAGCAAAGGG + Intergenic
1067669343 10:48305545-48305567 CTTTCAGAATCACCAGAAACAGG + Intergenic
1067724312 10:48756967-48756989 CTTTCAAAAACACAAGAGAAGGG - Intronic
1067731527 10:48815434-48815456 GTTTCAAAAAGGGCAAAAAGTGG - Intronic
1067934750 10:50600233-50600255 CTTTCATAACCAGCAGAACCAGG - Intronic
1069283333 10:66682748-66682770 CTTTCAATAACAAAAGGAAGAGG + Intronic
1071022806 10:81079007-81079029 ATTTCAAAAAAATAAGAAAGAGG - Intergenic
1071409043 10:85368865-85368887 GTTTCAAAAACTTGAGAAAGAGG - Intergenic
1071601192 10:86959465-86959487 CTTCCAGACACAGCAGGAAGAGG + Intronic
1071812180 10:89194944-89194966 CCTTCAAGAACAGGAAAAAGAGG + Intergenic
1072044658 10:91642965-91642987 CTTTCAGAAACAGTCTAAAGAGG + Intergenic
1072779840 10:98241311-98241333 GTTTTAAAAAAAGCAGAGAGAGG - Intronic
1074567763 10:114596770-114596792 TTTTGAAAAAAAGGAGAAAGGGG - Intronic
1075229765 10:120665710-120665732 CTTTGACAAACTGGAGAAAGTGG - Intergenic
1075232870 10:120698832-120698854 GTTTCAGAAAGAGAAGAAAGAGG - Intergenic
1075276113 10:121094076-121094098 CATTCAAAAAGAGGAGGAAGGGG + Intergenic
1075656957 10:124168435-124168457 CTTTTAAAAATAGCAGACTGAGG - Intergenic
1076398568 10:130160951-130160973 CTTTCATAAACAGCATGCAGGGG - Exonic
1078646914 11:13149142-13149164 ATTTCAAAAACATCACAGAGAGG + Intergenic
1079354722 11:19720588-19720610 CTTCCAAAGACCGCTGAAAGTGG - Intronic
1080475985 11:32591771-32591793 GTTCTAAAAACAGCAGAAAAGGG - Intronic
1080603991 11:33848854-33848876 CATTCAGAAACAGAAGAAACAGG - Intergenic
1081158683 11:39727324-39727346 ATTTGAAAAACAGCAGAAGCAGG - Intergenic
1084667058 11:70582165-70582187 CTTGCAAAGAAAGCAGAGAGGGG + Intronic
1085005314 11:73083075-73083097 CTTTCATAAACTGCAGAGAATGG + Intronic
1085749343 11:79147121-79147143 CTTTGCAAATCAGAAGAAAGGGG - Intronic
1086749774 11:90477362-90477384 GTTTCACTAACAGTAGAAAGAGG - Intergenic
1087141073 11:94767006-94767028 AGTTCAGACACAGCAGAAAGAGG - Intronic
1088002391 11:104897996-104898018 CTTTCAATTACAGCAGCAAATGG - Intergenic
1089544871 11:119216129-119216151 ATTCCAAAGACAGCAGAGAGGGG - Intronic
1089575641 11:119440914-119440936 TTTTAAAAAACAGAAGAAGGAGG - Intergenic
1090784318 11:130035782-130035804 CTTCTAGAAAGAGCAGAAAGGGG + Intergenic
1091804985 12:3349444-3349466 CTGTCAAAGAAAACAGAAAGAGG + Intergenic
1093193841 12:16106730-16106752 CTTTCAAAAGCAGCAGTATTTGG - Intergenic
1093382809 12:18515264-18515286 CTTCCAAAAATAGAAAAAAGCGG - Intronic
1094373953 12:29770279-29770301 CTTCCAAAAACAGTATAAAATGG + Intronic
1094744157 12:33324500-33324522 CTTTCATAAGCAACAGAAAATGG - Intergenic
1094878399 12:34680025-34680047 CTTTCAAATACTACAAAAAGAGG - Intergenic
1095237426 12:39814328-39814350 TTTTTAAAAACAGTACAAAGAGG - Intronic
1096213564 12:49785566-49785588 ATTTTAAAAACATCTGAAAGGGG + Intergenic
1096421211 12:51459492-51459514 CTTACAAAAACCCCAGAAGGAGG - Intronic
1096448006 12:51712446-51712468 GTTCTAAAAACAGCAGAAAAGGG - Intronic
1098961398 12:76743565-76743587 CTTTGAAAAACTGCATAGAGTGG - Intergenic
1099489464 12:83270367-83270389 CTTTAAAAAACTGCATAAACTGG + Intergenic
1100151738 12:91746151-91746173 CTTTTAACACCAGAAGAAAGTGG + Intergenic
1100692416 12:97052729-97052751 CTTTCAAGAACAGGAGAAAGAGG - Intergenic
1100698514 12:97121123-97121145 CCTGGAAAAGCAGCAGAAAGTGG - Intergenic
1100962610 12:99980113-99980135 CTTTTAAAAGTACCAGAAAGGGG + Intronic
1101488871 12:105193708-105193730 TTTTAAAAAAGAGGAGAAAGAGG - Intronic
1102321129 12:111935395-111935417 CTTTAAAAATCAGCAGATGGCGG - Intronic
1102392274 12:112558831-112558853 TTTTCAAAAATTGCAGGAAGTGG - Intergenic
1102420603 12:112800210-112800232 CTTATAAAAACAGCAGCCAGTGG + Intronic
1102445706 12:113001002-113001024 TTTTTTAAAACAGCAGTAAGAGG - Intronic
1102870377 12:116409514-116409536 TTCTCTTAAACAGCAGAAAGTGG - Intergenic
1102872017 12:116421097-116421119 CTTTCAAAAAAAAAAAAAAGTGG + Intergenic
1104174458 12:126316462-126316484 GTTTCAAGAACAGCTGAAAATGG - Intergenic
1104531669 12:129577257-129577279 CTTGCCAAAACAGCAGCAGGAGG + Intronic
1105974108 13:25458181-25458203 CTTTCAAAAATAGCAGGATTAGG + Intronic
1106539394 13:30676366-30676388 CTTTCAAATACATAAGAAATAGG + Intergenic
1106889507 13:34228223-34228245 CTCTCAGGAACAGGAGAAAGGGG - Intergenic
1107095562 13:36531347-36531369 CCTTGAAACACAGCAGTAAGGGG + Intergenic
1107388875 13:39942603-39942625 CTCTCAGAGGCAGCAGAAAGGGG + Intergenic
1107470677 13:40688381-40688403 ATTTCAAAAAAAGAAAAAAGAGG - Intergenic
1107507671 13:41050847-41050869 CTTTCTAAAAAATCTGAAAGAGG - Intronic
1107541038 13:41389325-41389347 CTTTCAAATACAGCAGTGAATGG - Intergenic
1107888934 13:44897087-44897109 CTTTCAAAAACACCAGTCATTGG + Intergenic
1108483262 13:50897425-50897447 CATTTAAAAACAACTGAAAGAGG + Intergenic
1109010936 13:56943151-56943173 CTTCTGAAAACAGAAGAAAGTGG - Intergenic
1109401325 13:61832794-61832816 CTTCCAAAGTCAGTAGAAAGAGG - Intergenic
1109683887 13:65787916-65787938 GTTCTAAAAACAGCAGAAAAGGG - Intergenic
1110816944 13:79872041-79872063 TTTTTAAAAGCAGCAGCAAGAGG + Intergenic
1111405797 13:87803370-87803392 ATTTCAAAAAAAGCAGAAGAGGG + Intergenic
1111775535 13:92656695-92656717 CTTTCAATAATAGCAAAAACAGG + Intronic
1112460745 13:99601758-99601780 ATTTGAAAAACAGCAGAAGCAGG + Intergenic
1112764085 13:102722280-102722302 CTTTGAAAAACACCAAATAGTGG - Intergenic
1113283920 13:108825011-108825033 CTTTCAAAAACAGAAGAGCAGGG + Intronic
1113581151 13:111430294-111430316 CTTTCAATAAGTGCAGAAAAGGG - Intergenic
1113586349 13:111468540-111468562 CTTCCAAGAAGAGCAGAAAGTGG - Intergenic
1113762850 13:112862151-112862173 CTTTCAGAAGCAGCAGCATGTGG + Intronic
1114285141 14:21234588-21234610 ATGTGAAAAACAGCAGAAACTGG - Intronic
1114390036 14:22297799-22297821 CCTTCAAAGGCAGGAGAAAGTGG - Intergenic
1114917432 14:27285970-27285992 CATTCAAAAAAGGCAGAAACTGG - Intergenic
1116041960 14:39696900-39696922 CTTTCAACTAAAGCATAAAGTGG - Intergenic
1116646449 14:47534945-47534967 CATTCAAAAACAGCTGCAACAGG - Intronic
1117874230 14:60234998-60235020 TTTTAAAAAACAGCAAAAATTGG + Intergenic
1118745628 14:68771022-68771044 CTTTCAGAAACAGCACTAACAGG - Intergenic
1122671615 14:103377098-103377120 TTTTCAAAAACACCATAAAGAGG - Intergenic
1122754234 14:103965292-103965314 CTTTCAAAATCAGCACAAAATGG - Intronic
1122869597 14:104631505-104631527 ATTTCAAAAATACCAAAAAGTGG - Intergenic
1124969305 15:34469367-34469389 CTTTCAAAAATAGCAAAAACAGG + Intergenic
1125546351 15:40508748-40508770 CATTTAAAAACAGCTAAAAGAGG + Intergenic
1125826800 15:42683383-42683405 CTTTAAAAAACTTCAGAAAATGG - Intronic
1126551147 15:49931132-49931154 ATTTCAACAACACCAGAAAAAGG - Exonic
1126875173 15:53033660-53033682 GTTTCAAAAACAGGAAAATGAGG - Intergenic
1127251822 15:57246943-57246965 GTTCTAAAAACAGCAGAAAAGGG - Intronic
1127345024 15:58085856-58085878 CTTTAAAATACTGCAGAAAAAGG - Intronic
1127414633 15:58746051-58746073 CTTTCAAAAAAGGCATGAAGGGG + Intronic
1127708849 15:61575124-61575146 CTTGCATAAGCAGCAGAAATAGG + Intergenic
1127750343 15:62033440-62033462 CTTCAAAAAGCAGCAGAAAAAGG - Exonic
1128462378 15:67880672-67880694 GTTCTAAAAACAGCAGAAACAGG - Intergenic
1128721614 15:69954635-69954657 TCTTCACAAACAGCAGAAGGTGG + Intergenic
1128792576 15:70444010-70444032 ATCTCAAAAACATAAGAAAGAGG + Intergenic
1128914462 15:71547125-71547147 CTTTAACAGAAAGCAGAAAGGGG - Intronic
1130168199 15:81484734-81484756 TTTTCAAAAACAGCAAACATAGG + Intergenic
1130646574 15:85732937-85732959 TTTTCAAAAACGGGAGAATGCGG - Intronic
1132189985 15:99846060-99846082 CTTTCAAAAACAGCAAAAACAGG - Intergenic
1133408603 16:5548935-5548957 TTTTCAGAAACAACAGAGAGAGG - Intergenic
1134465837 16:14476814-14476836 CTTTAAAAAACAACACAAAGAGG + Intronic
1134491241 16:14696982-14697004 GTTTCAAAAACAACAAAAAAGGG + Intergenic
1134496622 16:14736100-14736122 GTTTCAAAAACAACAAAAAAGGG + Intronic
1134913356 16:18049150-18049172 CTTTCACAAAAAGGAAAAAGAGG + Intergenic
1135824704 16:25716432-25716454 CTTTCACCAACAGCAAAGAGGGG - Intronic
1136355527 16:29742945-29742967 GTTTCAAAAACAAAAAAAAGTGG + Exonic
1139092462 16:63665054-63665076 CTTTCATCAACAGCAGGGAGGGG - Intergenic
1139566400 16:67779930-67779952 CACTCAAAAACAGCAGAATGTGG + Intronic
1139849531 16:69942192-69942214 CTGTCAAAAACAAAAAAAAGTGG - Intergenic
1140647240 16:77045940-77045962 CTATCAAAATCACCAGAAAAGGG - Intergenic
1140715280 16:77720892-77720914 TGTGCAAAGACAGCAGAAAGGGG - Intergenic
1141382359 16:83587943-83587965 CTTTCAAAAAAAAAAAAAAGAGG - Intronic
1142725905 17:1813713-1813735 CTTGCAAAAATAGTATAAAGAGG - Intronic
1143791911 17:9303689-9303711 CTTTCAAAATCAGTAGAAATAGG + Intronic
1145063505 17:19747086-19747108 CTTTTAACATCAGCAGAAATAGG + Intronic
1145952786 17:28832775-28832797 CTTTGAATAACAGCAAGAAGGGG + Intronic
1146008579 17:29177681-29177703 CTGTCAATTACAGCAGACAGTGG + Intronic
1146087184 17:29840278-29840300 GTTTCAAAGAATGCAGAAAGTGG - Intronic
1146174711 17:30658411-30658433 CTGTCAAAAAAAAAAGAAAGAGG + Intergenic
1146266836 17:31458423-31458445 CCTCCAAAAGCAGCAGGAAGGGG - Intronic
1146318527 17:31828151-31828173 TAGTCAAAGACAGCAGAAAGAGG + Intergenic
1146348171 17:32074422-32074444 CTGTCAAAAAAAAAAGAAAGAGG + Intergenic
1146579770 17:34026602-34026624 AGTTCAAAAACAGCACAATGAGG - Intronic
1147011393 17:37451681-37451703 CTTACAAAAATCGCAGAAATGGG + Intronic
1149271293 17:54980810-54980832 CTTTAAAACACAGTAGAAACAGG + Intronic
1149680424 17:58503345-58503367 CTTTTAAATACCTCAGAAAGAGG + Intronic
1150441569 17:65195784-65195806 CTTTCAAAAAACGCTGATAGTGG - Intronic
1152935830 17:83136137-83136159 CATCCAAGAACTGCAGAAAGAGG + Intergenic
1203169518 17_GL000205v2_random:135149-135171 GGTGCAAGAACAGCAGAAAGGGG - Intergenic
1154536091 18:15464042-15464064 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154536329 18:15467444-15467466 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154536445 18:15469145-15469167 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154536559 18:15470847-15470869 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154536677 18:15472548-15472570 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154536794 18:15474248-15474270 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154536915 18:15475949-15475971 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537037 18:15477650-15477672 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537155 18:15479351-15479373 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537275 18:15481052-15481074 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537387 18:15482752-15482774 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537501 18:15484453-15484475 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537616 18:15486154-15486176 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537729 18:15487855-15487877 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537841 18:15489554-15489576 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154537952 18:15491255-15491277 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154538067 18:15492956-15492978 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154538185 18:15494657-15494679 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154538300 18:15496357-15496379 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154538419 18:15498058-15498080 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154538640 18:15501460-15501482 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154538758 18:15503161-15503183 CTTCCATATACTGCAGAAAGAGG - Intergenic
1154538870 18:15504862-15504884 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154538992 18:15506564-15506586 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154539106 18:15508265-15508287 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154539337 18:15511667-15511689 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154539457 18:15513368-15513390 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154539569 18:15515069-15515091 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154539678 18:15516770-15516792 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154539796 18:15518471-15518493 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154539910 18:15520171-15520193 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154540023 18:15521872-15521894 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154540139 18:15523573-15523595 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154540376 18:15526977-15526999 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154540730 18:15532081-15532103 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154540847 18:15533782-15533804 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154540990 18:15535778-15535800 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154541107 18:15537479-15537501 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154541227 18:15539180-15539202 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154541347 18:15540881-15540903 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154541462 18:15542585-15542607 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154541579 18:15544286-15544308 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154541699 18:15545987-15546009 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154541820 18:15547688-15547710 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154541941 18:15549389-15549411 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154542064 18:15551089-15551111 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154542411 18:15556192-15556214 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154542526 18:15557894-15557916 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154542646 18:15559595-15559617 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154542761 18:15561296-15561318 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154542881 18:15562997-15563019 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154542998 18:15564698-15564720 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154543117 18:15566399-15566421 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154543233 18:15568100-15568122 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154543350 18:15569800-15569822 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154543467 18:15571502-15571524 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154543576 18:15573203-15573225 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154543693 18:15574903-15574925 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154543810 18:15576603-15576625 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154543924 18:15578304-15578326 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154544042 18:15580004-15580026 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154544157 18:15581705-15581727 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154544278 18:15583406-15583428 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154544395 18:15585107-15585129 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154544626 18:15588509-15588531 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154544747 18:15590210-15590232 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154544860 18:15591911-15591933 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154544977 18:15593610-15593632 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154545097 18:15595312-15595334 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154545213 18:15597013-15597035 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154545329 18:15598714-15598736 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154545444 18:15600415-15600437 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154545553 18:15602115-15602137 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154545667 18:15603816-15603838 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154545781 18:15605519-15605541 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154545898 18:15607220-15607242 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546013 18:15608923-15608945 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546125 18:15610625-15610647 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546240 18:15612326-15612348 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546360 18:15614027-15614049 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546482 18:15615728-15615750 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546596 18:15617429-15617451 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546716 18:15619131-15619153 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546826 18:15620832-15620854 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154546942 18:15622533-15622555 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154547060 18:15624234-15624256 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154547176 18:15625935-15625957 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154547295 18:15627636-15627658 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154547524 18:15631038-15631060 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154547642 18:15632738-15632760 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154547759 18:15634440-15634462 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154547875 18:15636141-15636163 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154547990 18:15637842-15637864 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154548109 18:15639543-15639565 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154548452 18:15644647-15644669 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154548682 18:15648048-15648070 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154548793 18:15649749-15649771 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154548909 18:15651459-15651481 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549023 18:15653161-15653183 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549140 18:15654863-15654885 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549260 18:15656565-15656587 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549380 18:15658266-15658288 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549494 18:15659967-15659989 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549609 18:15661668-15661690 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549722 18:15663369-15663391 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549843 18:15665071-15665093 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154549963 18:15666773-15666795 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154550080 18:15668484-15668506 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154550196 18:15670185-15670207 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154550314 18:15671886-15671908 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154550435 18:15673588-15673610 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154550551 18:15675290-15675312 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154550668 18:15676991-15677013 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154550903 18:15680395-15680417 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154551021 18:15682098-15682120 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154551142 18:15683799-15683821 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154551255 18:15685500-15685522 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154551370 18:15687202-15687224 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154551490 18:15688904-15688926 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154551607 18:15690605-15690627 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154551953 18:15695709-15695731 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154552178 18:15699110-15699132 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154552295 18:15700811-15700833 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154552407 18:15702511-15702533 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154552524 18:15704212-15704234 CTTCCAGATACTGCAGAAAGGGG - Intergenic
1154552638 18:15705913-15705935 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154552754 18:15707614-15707636 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154552982 18:15711016-15711038 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154553104 18:15712717-15712739 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154553219 18:15714418-15714440 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154553334 18:15716119-15716141 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154553569 18:15719522-15719544 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154553684 18:15721226-15721248 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154553803 18:15722926-15722948 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154553920 18:15724627-15724649 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154554036 18:15726330-15726352 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154554155 18:15728031-15728053 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154554393 18:15731434-15731456 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154554508 18:15733135-15733157 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154554627 18:15734835-15734857 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154554740 18:15736536-15736558 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154554857 18:15738237-15738259 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154554975 18:15739939-15739961 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154555095 18:15741639-15741661 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154555451 18:15746744-15746766 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154555567 18:15748445-15748467 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154555682 18:15750146-15750168 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154555797 18:15751858-15751880 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154556107 18:15756451-15756473 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154556457 18:15761557-15761579 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154556578 18:15763258-15763280 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154556696 18:15764977-15764999 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154556813 18:15766677-15766699 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154556938 18:15768381-15768403 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154557058 18:15770082-15770104 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154557171 18:15771782-15771804 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154557282 18:15773482-15773504 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154557400 18:15775184-15775206 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154557514 18:15776885-15776907 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1154557630 18:15778587-15778609 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1156877302 18:42030474-42030496 TTTTAAAGGACAGCAGAAAGAGG + Intronic
1156881598 18:42087037-42087059 CTTTTAAAAATAGAGGAAAGGGG - Exonic
1157581741 18:48777721-48777743 CTTTCTCAAACAGCAGGAAGAGG + Intronic
1160961533 19:1723947-1723969 CTTAAAAAAACAACAGACAGGGG - Intergenic
1164792087 19:30995917-30995939 CTTTCTAAGCCAGGAGAAAGGGG + Intergenic
1164913456 19:32030463-32030485 CTTTCAAAACATGCAGAAAAGGG - Intergenic
1164985635 19:32646418-32646440 TTTTCTAAAACAGGAGAAAAAGG + Intronic
1165284417 19:34829180-34829202 CTTTCAGAAAGTGGAGAAAGGGG + Intergenic
1165637555 19:37354853-37354875 CTTCAAATCACAGCAGAAAGAGG - Intronic
1165978161 19:39694933-39694955 ATTTAAATAACAGCATAAAGTGG - Intergenic
1166155212 19:40906117-40906139 CTTAAAAAAACAACAGAAATGGG + Intergenic
1167087468 19:47320176-47320198 GTTTAAACACCAGCAGAAAGCGG - Exonic
1167223978 19:48224278-48224300 TTTTTAAAAACAGCAAAGAGAGG + Intronic
1167304660 19:48700709-48700731 CTTTCAAAAACAGCAGAAAGAGG + Intronic
1167305270 19:48704663-48704685 CTTTCAAAAACAGCAGAAAGAGG + Exonic
1168083977 19:54031498-54031520 GTTCTAAAAACAGCAGAAAAGGG + Intergenic
924977200 2:188849-188871 GTTTCCAAAACATCACAAAGAGG - Intergenic
925798115 2:7568751-7568773 ATTTAAAAAACAACAGAAAAAGG + Intergenic
926496834 2:13599696-13599718 TTTCCAAATATAGCAGAAAGAGG + Intergenic
926516736 2:13855881-13855903 CTTTCAGAAAAGGGAGAAAGGGG + Intergenic
927527266 2:23756611-23756633 ATTTAAGAAGCAGCAGAAAGAGG - Intronic
928060122 2:28103744-28103766 CTCTCATAAAGAGCAGAAATGGG - Intronic
928889098 2:36181184-36181206 TTTCCAATATCAGCAGAAAGTGG - Intergenic
929341922 2:40830225-40830247 CTTGCAAAAGCAACAGACAGAGG - Intergenic
930838772 2:55824232-55824254 CTCTCACAAACAGAAGAAAGTGG + Intergenic
931084979 2:58819970-58819992 CTTTCAAAATCAGGAACAAGAGG + Intergenic
932608388 2:73179503-73179525 GTTTTAAAAAAAGAAGAAAGGGG + Intergenic
932647561 2:73519797-73519819 TTTTCAGAGAAAGCAGAAAGTGG - Exonic
933428975 2:82150642-82150664 CTTTCAAAAACATCAACTAGTGG + Intergenic
934545273 2:95209179-95209201 CTTTGAAAAACAAGAGAGAGTGG + Intronic
934677128 2:96257610-96257632 CTTTCATAAAAAGTAGAAATGGG + Intronic
934848496 2:97679906-97679928 CTTTTAAAAAAAGCAGTAATGGG + Intergenic
934887300 2:98036254-98036276 CTTTAAAGAAAAACAGAAAGAGG - Intergenic
935306622 2:101742956-101742978 CTTTCAAAAAGAGCAGGACGTGG - Intronic
935611561 2:105031145-105031167 CTCTGAAAAACAGAAGAAAGTGG - Intergenic
936475570 2:112836812-112836834 CTTTCAAAAGCAGAAGTAGGAGG + Exonic
937289621 2:120774264-120774286 TTTACAAAAACAGCAGGGAGGGG - Intronic
937420423 2:121750099-121750121 TTTTCAAAAACAGTGCAAAGTGG + Intronic
938047718 2:128138036-128138058 CTTTCAAAGTAAACAGAAAGGGG - Intronic
938396174 2:130950092-130950114 CCTTCAAACACAGCTGAAGGAGG + Intronic
938613712 2:132975840-132975862 CTTTAGAAAACAGGATAAAGGGG - Intronic
938755453 2:134375073-134375095 CTATCAAAAACAGAATCAAGAGG - Intronic
939260864 2:139807195-139807217 CTCACAATCACAGCAGAAAGCGG + Intergenic
939532475 2:143381848-143381870 TTTTTAAAAAAAGCATAAAGGGG + Intronic
939625337 2:144470067-144470089 CTTTCAAAATCACCTGTAAGTGG - Intronic
940039440 2:149344828-149344850 CTTTAAAAAACATCTGGAAGAGG - Intronic
940332466 2:152490174-152490196 CTTGCAAAAAAAGGGGAAAGAGG + Intronic
940358435 2:152770620-152770642 TTTTCAAAAACACAAAAAAGGGG + Intergenic
940506809 2:154566047-154566069 CTTTCAAAAACTGAGAAAAGTGG - Intergenic
940596781 2:155804492-155804514 CCCTCAAAAACTCCAGAAAGTGG - Intergenic
940776400 2:157888980-157889002 CTTTAAAAAAAAAAAGAAAGTGG - Intronic
940852706 2:158703508-158703530 ATTTCAAAAACAGTAACAAGAGG - Intergenic
941372538 2:164683881-164683903 TTGTGTAAAACAGCAGAAAGGGG - Intronic
941504752 2:166328408-166328430 CTTTCAAATACAGTAGAGGGTGG - Intronic
941658203 2:168167189-168167211 CTTTCAAACACAGGAGAGAAAGG + Intronic
942041334 2:172066723-172066745 CACTCAAAATCAGCAGGAAGAGG - Intronic
942042097 2:172077296-172077318 CTTTGAAATAGAGCAGAAAAAGG + Intronic
942196242 2:173523245-173523267 CTTAAAAAAACAGCAAAAAAGGG - Intergenic
942561083 2:177219293-177219315 GTTCTAAAAACAGCAGAAAAGGG + Exonic
943463006 2:188193200-188193222 CTTTTAAAAATAAGAGAAAGGGG - Intergenic
943705671 2:191031495-191031517 GTTTCAAGACCAACAGAAAGGGG - Exonic
944192308 2:197016009-197016031 TTTCTAAAAACAGCAGAAAAGGG + Intronic
944893513 2:204141260-204141282 TTTTCAAAAACAAATGAAAGTGG + Intergenic
945917837 2:215722900-215722922 CTTTTAAAAAAAACAGAAACAGG - Intergenic
945964734 2:216174878-216174900 GTTCTAAAAACAGCAGAGAGGGG - Intronic
946098466 2:217297080-217297102 ATTTTAGAAAAAGCAGAAAGAGG + Intronic
946731652 2:222715876-222715898 ATATAAAATACAGCAGAAAGCGG + Intergenic
946767269 2:223052299-223052321 CTTTCAGAAACATTTGAAAGAGG + Intronic
946927281 2:224638310-224638332 CCCTAAAAAACAGCAGCAAGAGG - Intergenic
947084700 2:226437832-226437854 CTTTTAAAAGTAGAAGAAAGAGG + Intergenic
947511614 2:230759824-230759846 CTTTCAAAATCAGTAGGAACAGG - Intronic
948416515 2:237810021-237810043 TTTTTAAAAAAGGCAGAAAGAGG + Intronic
948654869 2:239470349-239470371 AATTCATAAAGAGCAGAAAGAGG - Intergenic
1169196367 20:3684721-3684743 ATCTCAAAAACATCGGAAAGAGG - Intergenic
1169655954 20:7923246-7923268 CTTTGGAAAACAGCAAAAACTGG + Intronic
1169884891 20:10388419-10388441 CATTCAAAAAAAGAAAAAAGAGG - Intergenic
1170575210 20:17657361-17657383 CCATCAAAAACAGCAGAAGGAGG + Intronic
1171213949 20:23338395-23338417 ATTGCAAAAACAAGAGAAAGAGG + Intergenic
1172141540 20:32725726-32725748 CTTTCAAAAACAGTACAGAGCGG - Intronic
1172643112 20:36453630-36453652 CTTTAAAAAAAAGAAAAAAGAGG + Intronic
1172669050 20:36621417-36621439 GTTCTAAAAACAGCAGAAAAAGG + Intronic
1173012774 20:39197329-39197351 CTGTCACAATCAGTAGAAAGTGG + Intergenic
1173127086 20:40347325-40347347 CCTTATGAAACAGCAGAAAGTGG + Intergenic
1173350384 20:42239756-42239778 CTTTCAAGGACAGAAGAAAATGG + Intronic
1173577548 20:44122980-44123002 CTTCCAAAGGCACCAGAAAGTGG - Intronic
1173817171 20:45997232-45997254 ATTGCAAAAACAGGAGAGAGAGG + Intergenic
1173873269 20:46354881-46354903 CCTTCAAATACAGCAAAGAGAGG + Exonic
1173955676 20:47030756-47030778 CTTTCAAAAAAAGGAGACACCGG - Intronic
1174336261 20:49863130-49863152 CCTTAAAAAACAGGAGAAACTGG - Intronic
1175346097 20:58277513-58277535 CTTTTGAAAACATCAGAAACAGG + Intergenic
1176402237 21:6324000-6324022 GGTGCAAGAACAGCAGAAAGGGG + Intergenic
1176434920 21:6665104-6665126 GGTGCAAGAACAGCAGAAAGGGG - Intergenic
1176459182 21:6992174-6992196 GGTGCAAGAACAGCAGAAAGGGG - Intergenic
1177962584 21:27686112-27686134 CTTTTAAAAACTGTAAAAAGAGG - Intergenic
1178126548 21:29521878-29521900 CTTTCAAAAGAAGAGGAAAGAGG - Intronic
1178292074 21:31377288-31377310 CTTCAAATAACAGAAGAAAGTGG + Intronic
1179323420 21:40315517-40315539 TTTTCAAGAACAGAAGTAAGAGG + Intronic
1180068007 21:45422411-45422433 CCTTCAAAAGCTGCAGGAAGAGG - Intronic
1180686330 22:17669945-17669967 CTTTCATAAACAAAAGAAAATGG + Intronic
1181327925 22:22065337-22065359 ATTTCATAAAAAGGAGAAAGAGG - Intergenic
1181373731 22:22439829-22439851 CTTTCAAAACCAGATGCAAGGGG + Intergenic
1181428899 22:22865029-22865051 CTTCCAAAAATATAAGAAAGGGG + Intronic
1183072281 22:35404719-35404741 CTCTCAAAGAAAGCAGGAAGAGG - Intronic
1183256192 22:36763962-36763984 CCTTCAACAACTGCAGCAAGTGG - Exonic
1184135805 22:42549189-42549211 CTCACAAAAGCAGCAGCAAGCGG - Intergenic
949794820 3:7837023-7837045 TTTACAAAAGCAGCAGCAAGAGG + Intergenic
951803376 3:26622183-26622205 CTTTCTAAATCAGAAGAAGGTGG - Intergenic
953274288 3:41479664-41479686 CTGTGAAAAACAGCAGAGACAGG + Intronic
953428325 3:42814928-42814950 ATTTCAGAAACAGCAAACAGAGG + Intronic
953452091 3:43014003-43014025 CTTTGAAAAGCGGCAGGAAGGGG + Intronic
953531352 3:43742256-43742278 CTTTGGTATACAGCAGAAAGTGG - Intergenic
954240026 3:49286256-49286278 CTTTCAGAAACAGAAGGCAGTGG - Exonic
955295534 3:57731903-57731925 TGTTCACAAACAGCAGGAAGAGG + Intergenic
955427197 3:58804278-58804300 GTTTCAATAAAAGGAGAAAGGGG - Intronic
955737031 3:62049897-62049919 CTTTGAAAAACATCAGAAAATGG + Intronic
955824730 3:62934051-62934073 CTTTCAAAAAAATCAAAATGAGG + Intergenic
956339828 3:68210104-68210126 CCTTCAAAAACAGGAGTTAGTGG - Intronic
956919764 3:73914693-73914715 TTTTTAAAAACAATAGAAAGTGG + Intergenic
957028782 3:75215626-75215648 GTTCTAAAAACAGCAGAAAAGGG + Intergenic
957492336 3:80944588-80944610 CTATTCACAACAGCAGAAAGAGG - Intergenic
957507787 3:81146592-81146614 CATTCAAAGACAGCACCAAGAGG - Intergenic
957656944 3:83092519-83092541 CTTTTAAAAACACCACAAATTGG - Intergenic
958979340 3:100703001-100703023 CTTTAACAAACAGAAGAAAAAGG + Intergenic
959144183 3:102524108-102524130 CTTTAATAAAAAGCATAAAGAGG + Intergenic
959379889 3:105629230-105629252 ATTTCTACTACAGCAGAAAGAGG + Intergenic
960855223 3:122095595-122095617 CTATCAACAACAGCAGGAAATGG - Intronic
962002361 3:131311859-131311881 CTCTCTAAAACAACAGACAGTGG - Intronic
962040319 3:131700603-131700625 CTTTCAAAAAAGGAAGAAAGAGG - Intronic
963512851 3:146270639-146270661 ATTTGAAAAACAGCTGAAATGGG + Intergenic
963519468 3:146346228-146346250 CTTTATAAAATAACAGAAAGGGG - Intergenic
963821330 3:149897950-149897972 CTTTAGGAGACAGCAGAAAGTGG + Intronic
964459394 3:156906123-156906145 CTTTAGAAAACACAAGAAAGCGG - Intronic
964478766 3:157121118-157121140 TTTTTAACAACAGCAAAAAGGGG - Intergenic
964676788 3:159291888-159291910 ATTTTAAAAAAAGAAGAAAGAGG + Intronic
964819457 3:160755000-160755022 CTCCCGAGAACAGCAGAAAGGGG - Intergenic
964842130 3:161005768-161005790 CTTTGAAAAACAGGATAAATAGG + Intronic
964943885 3:162194717-162194739 ATGTCAAAAACAACAGAAACAGG + Intergenic
966693962 3:182770221-182770243 GTTTCAAAAATAGAAGAAATGGG - Intergenic
967427611 3:189345371-189345393 TTTTAAAAAAAAGCAGAAAAAGG - Intergenic
967552889 3:190819754-190819776 CTCACAAGAACAGCAAAAAGTGG - Intergenic
967799171 3:193635904-193635926 TTTTTAAAAACTGAAGAAAGTGG - Intronic
969879330 4:10160023-10160045 ATTTCAAGGACAGCAGAATGGGG - Intergenic
971062705 4:22990463-22990485 CTATCAGAAACAGCAGAAGAGGG - Intergenic
971132793 4:23832198-23832220 ATTTGAACAACACCAGAAAGTGG + Intronic
971784801 4:31086200-31086222 TGTTAAAAAACAGGAGAAAGTGG - Intronic
972003671 4:34070923-34070945 CTTATTAAAACAGCAGATAGTGG + Intergenic
974722120 4:65753952-65753974 AGTTCAAGAACAGCAGAAATAGG - Intergenic
975290196 4:72669390-72669412 CTTTCAAAAATAACTGAAACAGG - Intergenic
976154689 4:82129650-82129672 GTTCTAAAAACAGCAGAAAAGGG + Intergenic
976275661 4:83274775-83274797 CTTGGAAAAACAGGAGAAAGGGG - Intronic
976751308 4:88453398-88453420 CTCTCAAAAAAAAAAGAAAGTGG - Intergenic
977196967 4:94075349-94075371 TTTTCAAAAAAATAAGAAAGGGG + Intergenic
977514606 4:98005904-98005926 CTTTCAAAAAATGGAAAAAGAGG - Intronic
977574560 4:98662352-98662374 ATTTCAAAAACAGACTAAAGGGG - Intergenic
977821271 4:101474948-101474970 CTTACAAAAACAGAACACAGAGG + Intronic
978228011 4:106362208-106362230 CTGCCAAAAACAGAAGAGAGTGG + Intergenic
978334123 4:107647543-107647565 CTTTAAAAAAAAGCATAGAGAGG - Intronic
979579101 4:122334705-122334727 ATTTCAAAAACAGGTGAAAATGG - Intronic
980854103 4:138418465-138418487 CATCCAAACATAGCAGAAAGGGG + Intergenic
981118543 4:141020918-141020940 CTGTTAAAAACAACATAAAGTGG + Intronic
981675085 4:147333663-147333685 TTTTCTACAACAGCAGAAAATGG + Intergenic
982283513 4:153710920-153710942 TTATCAAAGACAGCAGAAAAAGG - Intronic
982467304 4:155746930-155746952 CTCTCAAAATCATCAGAAAGAGG - Intergenic
983728603 4:170963904-170963926 CTTTTTAAAAAAGCAGAATGTGG + Intergenic
984247359 4:177291360-177291382 CTTTTAAAAAAAACAGAAATAGG - Intergenic
984251750 4:177344443-177344465 CTTTCAGAGACAGAAGAAACAGG - Intronic
984524308 4:180839609-180839631 CTAACAAAAACAAGAGAAAGAGG - Intergenic
984711947 4:182893284-182893306 CTTTCTAATACAGCAGAGGGTGG + Intronic
984742082 4:183174549-183174571 CTCTAGAAAATAGCAGAAAGGGG - Intronic
984810091 4:183788326-183788348 CTTTAAAAAACAGTGGAAGGGGG + Intergenic
985031526 4:185795288-185795310 CCCTCAAAAATAGAAGAAAGAGG + Intronic
985420340 4:189779011-189779033 CATCCAAAAAGAGCAGAAAATGG + Intergenic
985581037 5:695252-695274 CTTACAAAATCACCAGAAACAGG + Intergenic
985595662 5:786584-786606 CTTACAAAATCACCAGAAACAGG + Intergenic
986868646 5:12020042-12020064 ATTGCTAAAACAGTAGAAAGAGG - Intergenic
988778763 5:34500270-34500292 CTTGCAAAAACATCACAGAGCGG + Intergenic
989740642 5:44766888-44766910 CTTTCAAACCCAGCTGAAAGTGG - Intergenic
990275935 5:54196542-54196564 CTTACAAATAAAGCAGTAAGTGG + Intronic
991092832 5:62709729-62709751 CTTTCAAAGACAGCAAATTGTGG + Intergenic
991287382 5:64992831-64992853 CTTTAAAAAAGTGTAGAAAGTGG - Intronic
992856460 5:80866570-80866592 CTTAGAAATACAACAGAAAGGGG - Intronic
993173292 5:84449262-84449284 TTTTCATAAACAGAAGAAAATGG - Intergenic
993486679 5:88495607-88495629 CTTTGAAAAACACCTGAAATAGG - Intergenic
993760295 5:91786798-91786820 GTTTCAAAAGCAGAGGAAAGTGG + Intergenic
993911432 5:93689587-93689609 CCTTCAAATCCAGCAGAAATGGG + Intronic
993982440 5:94558702-94558724 CTTGAGAAAACAGCAGAAACAGG + Intronic
994499286 5:100554727-100554749 CTTACAAAAACATCAGAAGAAGG - Intronic
995328869 5:110923823-110923845 CTTTCAAAGAGAGAAGAAAAAGG - Intergenic
996138671 5:119877155-119877177 TTTTCAAAAACAGAAAAAAAGGG - Intergenic
996470165 5:123851372-123851394 CTTTCCAAACCTGGAGAAAGAGG - Intergenic
996863530 5:128091465-128091487 CTTTCAAATACTGTACAAAGGGG + Intronic
998101983 5:139442092-139442114 CTTTCAGAAACAGAAGAAGATGG + Intronic
999035075 5:148339542-148339564 CTTTTAAAAACATCAATAAGCGG + Intronic
999349458 5:150854884-150854906 CTTTGAGAAAGAGAAGAAAGGGG - Intronic
999538685 5:152548115-152548137 CTTTCAAAGAAATCAGAAAGTGG - Intergenic
1000078053 5:157813336-157813358 ATTTAAAAAACAATAGAAAGGGG + Intronic
1000499006 5:162024196-162024218 CTTTTAAAAATAACTGAAAGAGG + Intergenic
1001317366 5:170653330-170653352 CCTTGGAAAAGAGCAGAAAGTGG + Intronic
1002507350 5:179688946-179688968 CTCAAAAAAACAACAGAAAGAGG + Intronic
1002798199 6:493903-493925 CTCTCAAAACCAGCAGGGAGAGG - Intronic
1003016806 6:2474703-2474725 CATTCAAAAACAGCACAAATGGG + Intergenic
1003098759 6:3161232-3161254 ATTTAAAAAATAGCAGACAGGGG - Intergenic
1003202874 6:3978525-3978547 CTTTCATAAACAGCATGCAGGGG - Intergenic
1004127371 6:12886868-12886890 CTTCAAAAAACAGTAGCAAGAGG + Intronic
1004128885 6:12900243-12900265 TGTTTAAAAACAACAGAAAGAGG - Intronic
1004358812 6:14952835-14952857 CTTTTATAAACAACAGAAAATGG + Intergenic
1004377804 6:15105777-15105799 CAGTCAATAACAGCACAAAGTGG + Intergenic
1005010297 6:21329302-21329324 TTTGCAAAAACAGCAGAAGCAGG + Intergenic
1005527662 6:26667038-26667060 CTCTCTGAAACAGCAGAGAGAGG + Intergenic
1005543132 6:26834640-26834662 CTCTCTGAAACAGCAGAGAGAGG - Intergenic
1005927700 6:30457531-30457553 ATTTCAAAGACAGCACCAAGGGG + Intergenic
1006602052 6:35232831-35232853 CCTTCTAAAAGAGAAGAAAGGGG - Exonic
1006615693 6:35325073-35325095 CATAAGAAAACAGCAGAAAGGGG - Intergenic
1007701859 6:43770505-43770527 TTTTGGAAACCAGCAGAAAGAGG + Exonic
1007955389 6:45913554-45913576 GTCACAGAAACAGCAGAAAGTGG + Intronic
1008458366 6:51738719-51738741 CTCTCAAAAACTGCACACAGTGG + Intronic
1008515812 6:52318209-52318231 CTTTCAAGACAAGAAGAAAGAGG + Intergenic
1008913390 6:56760796-56760818 CCTTCAATAACAACATAAAGTGG + Intronic
1009874975 6:69494525-69494547 CTTTCCAAAACTTGAGAAAGAGG + Intergenic
1011653133 6:89525469-89525491 CTTTGGACAACAGCAGCAAGAGG - Intronic
1012412571 6:98975724-98975746 CTTCCAGTAACAGCAGCAAGAGG - Intergenic
1012632472 6:101489117-101489139 ATTTGAAAAACAGCAGAATGGGG - Intronic
1015575074 6:134662454-134662476 TTTTTAAAAACAGAAGAAATAGG + Intergenic
1015703159 6:136058146-136058168 CTTTCCAAAGCACCAGATAGGGG + Intronic
1015740759 6:136450965-136450987 TTTTGAGAAACAGCAGAAACTGG + Intronic
1017018611 6:150121679-150121701 CATTTAAAAATAACAGAAAGAGG - Intergenic
1017229781 6:152061598-152061620 GTTTCTAAAACAGAAGAATGTGG + Intronic
1017338873 6:153296373-153296395 CATTCAAAAATAGCAAATAGTGG - Intergenic
1018910907 6:168100541-168100563 CTTTCAAAGACGGGAGAAAGGGG + Intergenic
1018949705 6:168371124-168371146 CTTTCAAAGATGACAGAAAGGGG - Intergenic
1018991201 6:168675649-168675671 GGTGCAAAAACAGCAGGAAGGGG - Intergenic
1021413242 7:20352282-20352304 TTTTCAAGAACGGCAGAAACAGG - Intronic
1022785862 7:33636026-33636048 ATTTTAAAAACACAAGAAAGTGG + Intergenic
1023003097 7:35831921-35831943 CATTAAAAAATAGCAAAAAGAGG - Intronic
1023291009 7:38669045-38669067 ATTACAAGAACAGCAGCAAGAGG - Intergenic
1023475632 7:40574908-40574930 GATACAGAAACAGCAGAAAGAGG + Intronic
1023765923 7:43510726-43510748 CTTTCAAAAAGAGGAGACGGTGG + Intronic
1024041381 7:45558654-45558676 CTTTCAAACATACCAAAAAGTGG + Intergenic
1026475187 7:70729045-70729067 CTTTCACAAAGAACAGAAAGTGG - Intronic
1026559017 7:71432665-71432687 CATTAAAAAACAGAAGAAAGAGG + Intronic
1026617342 7:71917224-71917246 CTTTCAGAAACAACAGGATGAGG + Intronic
1026975891 7:74497999-74498021 CTATAAAAAACACAAGAAAGCGG - Intronic
1027193050 7:76009065-76009087 GGTTTAAAAACAGCAGGAAGAGG - Intronic
1027296921 7:76784422-76784444 GTTTAAAAAACAACGGAAAGTGG + Intergenic
1027329429 7:77076068-77076090 GTTACAAAAACAGTAGAGAGAGG + Intergenic
1028326138 7:89527296-89527318 CTTTCAAATATAGAACAAAGTGG + Intergenic
1028475752 7:91251339-91251361 CTCTCAAGAACAGAAGCAAGGGG - Intergenic
1028499477 7:91502643-91502665 CTTTCAAAAACAGAGCATAGGGG - Intergenic
1028811795 7:95096362-95096384 CTTGCAACAAGAGCAAAAAGAGG - Intronic
1029103877 7:98158036-98158058 GTTGCAAAGACAGCAGAGAGAGG - Intronic
1029786334 7:102795294-102795316 GTTACAAAAACAGTAGAGAGAGG - Intronic
1030043389 7:105472623-105472645 CTTTCAAAAAAAGAATAAAATGG + Intronic
1030166822 7:106563693-106563715 CTTAAATAAACAGTAGAAAGAGG - Intergenic
1030361660 7:108601643-108601665 CTTTAAAAAACAACAAAAATGGG + Intergenic
1030459573 7:109815324-109815346 CTTCCAGAAACAGAAGAGAGTGG - Intergenic
1030618516 7:111763982-111764004 TGATCAAAAACAGCAGCAAGTGG - Intronic
1031910278 7:127509610-127509632 CTTTCAAAACCAGAAGAATTGGG + Intergenic
1032067483 7:128782510-128782532 CTTTCTAAAAAACCAGAAATGGG - Intergenic
1032644563 7:133808374-133808396 CATTCAGAAACAGCAGCAACAGG - Intronic
1033087687 7:138357416-138357438 CTTGCAAAAAAAGCAGACACAGG - Intergenic
1033451138 7:141463272-141463294 CTTCCAGAACCAGCAGGAAGAGG + Intronic
1033685566 7:143637855-143637877 ATTTCAAAAATAGCAGAACTTGG - Intronic
1033688736 7:143717072-143717094 ATTTCAAAAATAGCAGAACTTGG - Intronic
1033699048 7:143819766-143819788 ATTTCAAAAATAGCAGAACTTGG + Intergenic
1034530842 7:151695572-151695594 CTTGCAAAATCAGTTGAAAGAGG - Intronic
1034578147 7:152019336-152019358 GTTGAAAAAACAGGAGAAAGGGG + Intronic
1035966378 8:4196670-4196692 CTCTTAAAAGCAGTAGAAAGAGG - Intronic
1036099309 8:5760042-5760064 CTTTCAAAAACTTTAAAAAGAGG - Intergenic
1036110106 8:5889570-5889592 TTTTCACAAAAAGCAGAAAGGGG + Intergenic
1037487118 8:19358108-19358130 CTTTCTAAAACAGCAGCAATAGG + Intronic
1038842602 8:31199554-31199576 CCATAAAAGACAGCAGAAAGTGG - Intergenic
1040056207 8:43059038-43059060 CATTCAAATACAGAAGAAAAGGG - Intronic
1040513660 8:48117225-48117247 CTTGCAGAAATAACAGAAAGGGG - Intergenic
1040662261 8:49587674-49587696 CTTTCAAAAACTACAAAAGGAGG + Intergenic
1040756872 8:50786717-50786739 CTTTTCAACACAGCAGAATGTGG + Intronic
1041355071 8:56992173-56992195 CTTTCAAGATCAGCAGTAAAAGG + Intronic
1041362143 8:57065726-57065748 TTTTCACAAACAGGAGAAGGAGG - Intergenic
1042049948 8:64692642-64692664 CCTTCAAAGACAGCAGAAGAGGG + Intronic
1042770132 8:72371229-72371251 CTTTCATATACAGAAGAAATTGG - Intergenic
1043202348 8:77385920-77385942 CTTTCACAAAGAGAAGAAACTGG - Intergenic
1044412987 8:91904858-91904880 CTTAAAAAGAAAGCAGAAAGAGG - Intergenic
1044510975 8:93078513-93078535 CTTTCAAAAAAAAAAAAAAGAGG - Intergenic
1045931263 8:107629629-107629651 ATTTGAAAAACAGCAGAAGCAGG + Intergenic
1046366908 8:113245545-113245567 ATTACAATAACAGCAGAAAGGGG - Intronic
1046849995 8:118961414-118961436 CTTTCAAATACATCAGGAATAGG - Intergenic
1047859584 8:128950335-128950357 CTTTGTAAAAGAGCAGTAAGAGG - Intergenic
1048059426 8:130902608-130902630 CTTTCAAATGCAGAAAAAAGAGG + Intronic
1049450538 8:142659196-142659218 CTTTCACACACATCAGAAATAGG + Intronic
1050006440 9:1136449-1136471 CTTTAAAAAACTGAAGAGAGGGG - Intergenic
1050328316 9:4519028-4519050 CTTATAAATACAGCTGAAAGGGG - Intronic
1050721342 9:8594236-8594258 CTTTAAAAAACAGCAGACTTTGG - Intronic
1051378689 9:16432558-16432580 CTTTCGTAAACAGAAGGAAGAGG + Intronic
1052050112 9:23836818-23836840 CTTTCAAAGCCAGCATAATGTGG - Intergenic
1052228084 9:26113980-26114002 CTTTCAACATCAGGAGAAATGGG - Intronic
1053100586 9:35368779-35368801 CTTTCAATAAAAGAAGAAGGGGG - Intronic
1053475014 9:38376490-38376512 CTTTCAACAACAGAGGAGAGTGG + Intergenic
1053544694 9:39010406-39010428 CTTGATAAAGCAGCAGAAAGAGG + Intergenic
1053809130 9:41833888-41833910 CTTGATAAAGCAGCAGAAAGAGG + Intergenic
1054426649 9:65079343-65079365 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1054426683 9:65079739-65079761 CTTCCAGATACTGCAGAAAGAGG - Intergenic
1054621462 9:67353540-67353562 CTTGATAAAGCAGCAGAAAGAGG - Intergenic
1055046318 9:71928888-71928910 CTCTTAGAAACAGCAGAAAGAGG - Intronic
1055826423 9:80330732-80330754 CTTTTATAACCAACAGAAAGGGG - Intergenic
1056451506 9:86721619-86721641 CTTTCAAAACCCTCAGAAACTGG - Intergenic
1056452686 9:86731858-86731880 CTTCCAAACATTGCAGAAAGAGG + Intergenic
1056540930 9:87570775-87570797 ATTTCAGGAACAGCAGAGAGGGG + Intronic
1057145876 9:92759366-92759388 ACTTTAAGAACAGCAGAAAGTGG - Intronic
1057344617 9:94238185-94238207 CTTTCAAAAACACAGGAATGAGG - Intergenic
1057347583 9:94264901-94264923 CAATCAAAAACAACAGAAAAAGG - Intronic
1057431504 9:94998839-94998861 GTATCAAAACCAGAAGAAAGGGG - Intronic
1057714217 9:97477153-97477175 GTTGCAAAAATAGCACAAAGAGG + Intronic
1059159114 9:112017330-112017352 CTTTCAAAAAAAGGAGCAAAGGG - Intergenic
1059605808 9:115833838-115833860 CTTTCAATAAGATGAGAAAGAGG - Intergenic
1060712543 9:125882853-125882875 GTTTCAAATACTGCAGAAAATGG + Intronic
1060828755 9:126700949-126700971 CTTCCCACAACAGCAGAAAATGG + Exonic
1061229111 9:129302476-129302498 CTTACAGAAAAAGGAGAAAGAGG + Intergenic
1061842388 9:133366859-133366881 TTATCACAAACACCAGAAAGTGG + Intronic
1203436616 Un_GL000195v1:143543-143565 GGTGCAAGAACAGCAGAAAGGGG + Intergenic
1186243859 X:7599434-7599456 CTTTGAAAAAAAATAGAAAGAGG - Intergenic
1186459444 X:9736452-9736474 CTTTAAAAAAAAGTATAAAGTGG - Intronic
1186584930 X:10862916-10862938 TTTGGAAAAACAGCAGAAACAGG - Intergenic
1186670905 X:11766372-11766394 CTTTCAAAAACTGCTAAAACAGG + Intronic
1187176171 X:16898073-16898095 CTTTCACATACAGCAAAGAGAGG + Intergenic
1187203203 X:17155848-17155870 CTTTCAAAAAGAGCTGAAGATGG - Intergenic
1187283406 X:17880343-17880365 CTTACAAAATCAGAAGAAAATGG + Intergenic
1187538357 X:20164952-20164974 CTTTGCAAAACAGCTGAGAGCGG - Exonic
1188693715 X:33161575-33161597 GTTTCAGAAACAGCAAAAGGTGG - Intronic
1189098905 X:38168804-38168826 CTTTCCAAAACAGACAAAAGAGG + Intronic
1189415534 X:40809577-40809599 ATCTCAGAAACAGTAGAAAGGGG - Intergenic
1189539286 X:41969664-41969686 ATAGCAAAAACAGCTGAAAGTGG - Intergenic
1189999314 X:46670214-46670236 ATTTCAAAAAAAGGAAAAAGAGG + Intronic
1190070060 X:47272278-47272300 CTTTCAGAAGCAGCTGAATGGGG + Intergenic
1190637275 X:52448150-52448172 CTTTCAATAAAAGCAAAAATGGG + Intergenic
1190638492 X:52459807-52459829 CTTTCAATAAAAGCAAAAACCGG - Intergenic
1190653147 X:52586725-52586747 CTTTCAATAAAAGCAAAAATGGG - Intergenic
1190678165 X:52800622-52800644 CTTTCAATAAAAGCAAAAACCGG + Intergenic
1190679778 X:52815632-52815654 CTTTCAATAAAAGCAAAAATGGG - Intronic
1191000114 X:55650765-55650787 ATTTAGAAAACAGCAGAAACAGG + Intergenic
1191897922 X:66013327-66013349 TTTCCAATAACAGCACAAAGGGG - Intergenic
1191921018 X:66256954-66256976 TTTTCAAAAACAAGAGAAAGAGG + Intronic
1193296498 X:79839792-79839814 CTTTAAAATAGAGGAGAAAGTGG - Intergenic
1193595769 X:83443101-83443123 CTTTCACATAGAGCAGAATGAGG - Intergenic
1193974195 X:88097592-88097614 CTTTCAAAAACAAAATAAAGAGG + Intergenic
1194033337 X:88842115-88842137 CTTTAAAAATCAGGAGAGAGTGG + Intergenic
1195059766 X:101182906-101182928 CTTCCAAAAACAGAAGAGAATGG - Intergenic
1195340659 X:103903270-103903292 CATTTCAAAACAGGAGAAAGGGG - Intergenic
1195784255 X:108501423-108501445 CTTATCAAAACAGCAAAAAGGGG - Intronic
1195796913 X:108660028-108660050 CATTTAAAAATAGTAGAAAGAGG - Intronic
1196073975 X:111554376-111554398 CTATTAAAAAAAGGAGAAAGTGG + Intergenic
1196214655 X:113036174-113036196 CTTTCAAAAACAGAAGAGAAGGG - Intergenic
1196249495 X:113443537-113443559 CTTCCAAAAATAGAAGAGAGGGG + Intergenic
1196299211 X:114035769-114035791 GTGTCAACAACAGCAGACAGAGG - Intergenic
1196481142 X:116150882-116150904 CCTTCAAAAACTGGAGATAGGGG + Intergenic
1197344102 X:125311113-125311135 CTTTTACAAACAGCAGACAGAGG + Intergenic
1198050966 X:132953295-132953317 CTTTAAAAAAAATCAGAAATTGG - Intronic
1199413675 X:147555328-147555350 CTTTCACAAACAGAACAATGTGG - Intergenic
1200387602 X:155908671-155908693 CTTTCCAAAATAGAAGAAAAGGG - Intronic