ID: 1167305271

View in Genome Browser
Species Human (GRCh38)
Location 19:48704679-48704701
Sequence AAAGAGGCTCGTTCTTGTCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167305268_1167305271 13 Left 1167305268 19:48704643-48704665 CCATCACATGCAGATAATTCCTT 0: 1
1: 1
2: 1
3: 28
4: 472
Right 1167305271 19:48704679-48704701 AAAGAGGCTCGTTCTTGTCTTGG 0: 2
1: 0
2: 0
3: 7
4: 101
1167305269_1167305271 -6 Left 1167305269 19:48704662-48704684 CCTTTCAAAAACAGCAGAAAGAG 0: 1
1: 0
2: 4
3: 41
4: 442
Right 1167305271 19:48704679-48704701 AAAGAGGCTCGTTCTTGTCTTGG 0: 2
1: 0
2: 0
3: 7
4: 101
1167305267_1167305271 17 Left 1167305267 19:48704639-48704661 CCAGCCATCACATGCAGATAATT 0: 2
1: 2
2: 51
3: 1079
4: 10628
Right 1167305271 19:48704679-48704701 AAAGAGGCTCGTTCTTGTCTTGG 0: 2
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167305271 Original CRISPR AAAGAGGCTCGTTCTTGTCT TGG Exonic
912111415 1:106347464-106347486 AATGATGCTCATTCTTCTCTAGG - Intergenic
913248700 1:116893101-116893123 ACAGAGTTTCGCTCTTGTCTTGG + Intergenic
915755994 1:158260400-158260422 AGAGAGGCTCTCTCTTGTCCTGG + Intergenic
918277509 1:182967770-182967792 AAAGAGTCTCACTGTTGTCTAGG + Intergenic
920429917 1:205911903-205911925 ACAGTGGCTCTTTCTTGTGTTGG + Intergenic
921063813 1:211608600-211608622 ATAGAGGCTCTTTCTTCTCCTGG + Intergenic
921182992 1:212646037-212646059 CCACAGGCTCTTTCTTGTCTCGG - Intergenic
921345061 1:214175207-214175229 AAACAGGCTAATTCTTTTCTCGG + Intergenic
921555909 1:216598738-216598760 AAAGAGGCTTGATATGGTCTGGG + Intronic
922181220 1:223234334-223234356 AAAGAGGCTGGTGTTTGTGTTGG - Intronic
1065052351 10:21808500-21808522 AAAGAGGCTCGATAGTGACTAGG + Intronic
1066557487 10:36630905-36630927 AAAGTGGCTTGTACTGGTCTGGG - Intergenic
1072952100 10:99856781-99856803 ATAGACACTCGTTCTTCTCTGGG + Intergenic
1076749645 10:132536378-132536400 AAAGGGGCTTGTTCTGTTCTAGG - Intergenic
1077270274 11:1674550-1674572 AAAGAGGCTGCTCCTCGTCTAGG + Intergenic
1080988620 11:37503281-37503303 AATGAGGATTGTTCTTGTATAGG + Intergenic
1088779620 11:113121668-113121690 CCAGAGGCTCCTTCTTATCTTGG + Intronic
1091185871 11:133647279-133647301 ACAGAGGCTCATTCTTGCCCAGG + Intergenic
1092017242 12:5169554-5169576 AAAATGGCTTGTTCCTGTCTAGG + Intergenic
1096334306 12:50741666-50741688 AAATAGACTGATTCTTGTCTTGG + Intronic
1098934867 12:76466937-76466959 ACAGAGTTTCGTTCTTGTCCAGG - Intronic
1099211898 12:79801048-79801070 AAAAAGGCTCTTTCTTGGCTGGG + Intronic
1101172222 12:102109903-102109925 AAAGAGACTTGTTCTTGTTTAGG + Intronic
1103503928 12:121427514-121427536 ACAGAGTCTCGCTCTTGTCCAGG - Intronic
1106604142 13:31212127-31212149 ACAGAGTCTCGCTCTTGTCCAGG + Intronic
1106876123 13:34075975-34075997 AAAGAGGCACCTTCTAATCTTGG - Intergenic
1111444005 13:88321139-88321161 AAAGATGCTATTTCTTTTCTTGG - Intergenic
1119045056 14:71311348-71311370 AAAGAGGCTTGCTCATGACTTGG - Intergenic
1121431535 14:93891562-93891584 TAAGAGGCTTGTTCAGGTCTAGG + Intergenic
1121433773 14:93905594-93905616 AAATAGATTCCTTCTTGTCTAGG - Intergenic
1121435450 14:93916207-93916229 GAAGAGGCTCTTGCTTGACTTGG + Intergenic
1122128776 14:99593219-99593241 AAGGAGGCCCGCTCTTGTCTAGG - Intronic
1122491001 14:102116246-102116268 AAAGATGCTCGGTCTTGGCCGGG - Intronic
1124456484 15:29847308-29847330 CAAAAGGCTGGTTCTTGGCTGGG - Intronic
1124637730 15:31375631-31375653 AAAGAGGGGCTTCCTTGTCTGGG - Exonic
1127896607 15:63305739-63305761 AAAGAAGAAAGTTCTTGTCTTGG - Exonic
1128669396 15:69563238-69563260 AATGAAGCTTGTTCTTTTCTGGG - Intergenic
1128678800 15:69631339-69631361 AAAGAGGAGGGTTGTTGTCTGGG + Intergenic
1128694380 15:69749454-69749476 GAAGAGACTCGTTCTTCTCCTGG - Intergenic
1129327446 15:74808481-74808503 AAAGAGTTTCGCTCTTGTCCAGG + Intergenic
1147268569 17:39250289-39250311 AAAGAGGCTCTTTTTTGGCCGGG + Intergenic
1148116485 17:45178272-45178294 AAAGAGGATCTTTTTTCTCTGGG + Intergenic
1149154018 17:53604750-53604772 AAAGAGGCTCCTTTTTGGATAGG + Intergenic
1162587537 19:11569924-11569946 CATGAGAATCGTTCTTGTCTGGG - Intronic
1164869098 19:31628581-31628603 AAAGAGCCTTGTTCCTTTCTGGG + Intergenic
1166847926 19:45741319-45741341 ACAGAGTCTCGCTCTTGTCCAGG - Intronic
1167141986 19:47658083-47658105 AAAGAGGCAGAATCTTGTCTTGG - Intronic
1167304661 19:48700725-48700747 AAAGAGGCTCGTTCTTGTCTTGG + Intronic
1167305271 19:48704679-48704701 AAAGAGGCTCGTTCTTGTCTTGG + Exonic
1168564432 19:57411501-57411523 AGAGAGGAGCGTTCTTGTGTGGG + Intronic
1168567295 19:57435688-57435710 AGAGAGGGGCGTTCTTGTGTGGG + Intronic
927038327 2:19203675-19203697 AAGGAGGCTGGGTCTTCTCTAGG - Intergenic
927186121 2:20483865-20483887 AATGAGGTTCATTCTTTTCTGGG + Intergenic
930558083 2:52924902-52924924 AAATAGGCTCAATCATGTCTGGG - Intergenic
944353555 2:198758501-198758523 AAAGAGGCTTGTGCATGCCTTGG - Intergenic
944571815 2:201052580-201052602 ACAGAGTCTCACTCTTGTCTAGG - Intronic
945061411 2:205912336-205912358 AAAGAGGCTCTTTTTTGCATTGG + Intergenic
1168941884 20:1719763-1719785 AAAAAGGCTTCTTCTTGTGTGGG - Intergenic
1169129950 20:3161317-3161339 GTAGAGTCTCTTTCTTGTCTAGG - Intergenic
1171171331 20:23017948-23017970 GAAGAGGCTCGTTCTGGCCAGGG - Intergenic
1173111991 20:40199793-40199815 AAAGAGGAACGTCCTTTTCTTGG + Intergenic
1175726935 20:61324928-61324950 AAACAGGCTCGATGTGGTCTCGG - Intronic
1178308480 21:31509964-31509986 AAAGATGCTAGTTCTGGTCTGGG - Intronic
1181890139 22:26055353-26055375 AAAGAGCCATGTTCTGGTCTTGG + Intergenic
1182663331 22:31940667-31940689 AAAGAACGTGGTTCTTGTCTTGG - Intronic
1184640958 22:45869791-45869813 GGAGAGGCTGGTGCTTGTCTGGG - Intergenic
1185360479 22:50403781-50403803 AAAGTGGCACTTTCTTGTCTGGG + Intronic
950048167 3:9963930-9963952 AGCAAGGCTTGTTCTTGTCTGGG - Exonic
950316458 3:12005173-12005195 AAAGTAGCTCCTTCTTGTATGGG - Intronic
951025827 3:17828363-17828385 AAAGTGGCTAGTTGTTTTCTTGG + Intronic
955961870 3:64348826-64348848 GAAGAGGCTGATTGTTGTCTAGG + Intronic
962722067 3:138185325-138185347 AAAGAAGCCCGTTCTGTTCTGGG + Intergenic
968866327 4:3214557-3214579 AAAGTGGCTTGTTCTTTTCAAGG + Intronic
970235072 4:13950474-13950496 AAAGAAGCCCCTTCTTGCCTGGG + Intergenic
970259225 4:14206650-14206672 AGAGAGGCTCTTTCTTCCCTTGG + Intergenic
970264132 4:14262432-14262454 GATGAGGCTAGTTCTTGGCTGGG + Intergenic
972062236 4:34890105-34890127 ACACAGGCTCTTTCTTATCTGGG - Intergenic
979979323 4:127235277-127235299 AAGAAGGCTCTTTCTTTTCTTGG - Intergenic
983502777 4:168518528-168518550 CACCAGGCTTGTTCTTGTCTGGG + Intronic
987295090 5:16543009-16543031 AAGCAGACCCGTTCTTGTCTTGG - Intronic
987751601 5:22046352-22046374 AAAGATTTTCATTCTTGTCTGGG + Intronic
990255174 5:53960941-53960963 GAAGAGGCTTGTTTTTGTCAGGG + Intronic
990955479 5:61334065-61334087 AAAGAGTCTCTTTCTTTTCAGGG + Intronic
992560297 5:77945778-77945800 AAAGATGATGGTTCTTGCCTTGG + Intergenic
993482076 5:88436223-88436245 AAAAAGGCTCATTCTAGTCACGG - Intergenic
995012676 5:107275576-107275598 AAAGAGACTTCTTCCTGTCTTGG + Intergenic
999519638 5:152338079-152338101 CAAAAGCCTGGTTCTTGTCTGGG + Intergenic
999893099 5:156000302-156000324 AAAGAGGCTTGGGCTTGTTTGGG + Intronic
1003677373 6:8217955-8217977 ACAGAGTCTCGTTGTTGCCTGGG + Intergenic
1004376909 6:15098326-15098348 AAACGGACTCTTTCTTGTCTAGG - Intergenic
1005508003 6:26486848-26486870 ACAGAGTCTCGTTCTTGCCCAGG + Intergenic
1008738040 6:54571247-54571269 CAAAAGGTTTGTTCTTGTCTGGG + Intergenic
1012245960 6:96925661-96925683 ATAGAAGCTCATTCTTGTGTGGG - Intronic
1020178581 7:5903308-5903330 AAAGAGACAGGGTCTTGTCTTGG + Intronic
1020304345 7:6821694-6821716 AAAGAGACAGGGTCTTGTCTTGG - Intronic
1023220713 7:37918208-37918230 AAAGAGTCTGGTTCTTATTTAGG + Intronic
1046875403 8:119249321-119249343 AAGGAGGCTTATTCTTATCTGGG - Intergenic
1052566112 9:30154074-30154096 ACACAGGCTCTTTCTTATCTGGG + Intergenic
1052960304 9:34290239-34290261 AAAGAGGTGCTTTCTTGGCTGGG + Exonic
1055991041 9:82105936-82105958 GAGGAGGGTGGTTCTTGTCTGGG + Intergenic
1056907877 9:90669698-90669720 AATGAGGCTCTTTCTTGTTTGGG + Intergenic
1058837061 9:108866789-108866811 ACAGAGTCTTGTTCTTGTCCAGG + Intergenic
1060720074 9:125970767-125970789 ACAGAGTCTTGCTCTTGTCTAGG + Intergenic
1185539020 X:887351-887373 ATGGAGTCTCGCTCTTGTCTAGG - Intergenic
1186278920 X:7971657-7971679 AAATAGACCCCTTCTTGTCTGGG - Intergenic
1189261884 X:39685185-39685207 AAAGAGCCACTTTCTTGTTTTGG + Intergenic
1190860908 X:54343536-54343558 ACACAGGCTCGTGCTTGTTTTGG + Intronic
1191849470 X:65575341-65575363 AAAGAGGCCAGTGCATGTCTAGG + Intergenic
1199787783 X:151120196-151120218 AAAGAGGCTGGGTCTTGTGTGGG - Intergenic
1199840102 X:151637400-151637422 ACAGAGTCTCGCTCTTGTCCAGG + Intronic