ID: 1167308417

View in Genome Browser
Species Human (GRCh38)
Location 19:48721866-48721888
Sequence CCCTCCCCCTGCAGAGCGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167308417_1167308431 22 Left 1167308417 19:48721866-48721888 CCTCCCGCTCTGCAGGGGGAGGG 0: 1
1: 0
2: 2
3: 38
4: 296
Right 1167308431 19:48721911-48721933 GGCCAGGGCCCAGCTGATAGTGG 0: 1
1: 0
2: 2
3: 32
4: 259
1167308417_1167308425 1 Left 1167308417 19:48721866-48721888 CCTCCCGCTCTGCAGGGGGAGGG 0: 1
1: 0
2: 2
3: 38
4: 296
Right 1167308425 19:48721890-48721912 CCCACGCGGCTGGCGGCCCGCGG 0: 1
1: 0
2: 2
3: 5
4: 128
1167308417_1167308427 6 Left 1167308417 19:48721866-48721888 CCTCCCGCTCTGCAGGGGGAGGG 0: 1
1: 0
2: 2
3: 38
4: 296
Right 1167308427 19:48721895-48721917 GCGGCTGGCGGCCCGCGGCCAGG 0: 1
1: 0
2: 3
3: 45
4: 337
1167308417_1167308428 7 Left 1167308417 19:48721866-48721888 CCTCCCGCTCTGCAGGGGGAGGG 0: 1
1: 0
2: 2
3: 38
4: 296
Right 1167308428 19:48721896-48721918 CGGCTGGCGGCCCGCGGCCAGGG 0: 1
1: 0
2: 1
3: 16
4: 147
1167308417_1167308423 -6 Left 1167308417 19:48721866-48721888 CCTCCCGCTCTGCAGGGGGAGGG 0: 1
1: 0
2: 2
3: 38
4: 296
Right 1167308423 19:48721883-48721905 GGAGGGTCCCACGCGGCTGGCGG 0: 1
1: 0
2: 2
3: 34
4: 180
1167308417_1167308422 -9 Left 1167308417 19:48721866-48721888 CCTCCCGCTCTGCAGGGGGAGGG 0: 1
1: 0
2: 2
3: 38
4: 296
Right 1167308422 19:48721880-48721902 GGGGGAGGGTCCCACGCGGCTGG 0: 1
1: 0
2: 2
3: 12
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167308417 Original CRISPR CCCTCCCCCTGCAGAGCGGG AGG (reversed) Exonic