ID: 1167311047

View in Genome Browser
Species Human (GRCh38)
Location 19:48738272-48738294
Sequence TTTGATACTGAATATTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167311047_1167311048 13 Left 1167311047 19:48738272-48738294 CCTTGTCAATATTCAGTATCAAA 0: 1
1: 0
2: 0
3: 29
4: 254
Right 1167311048 19:48738308-48738330 TGATTTCTCTTTCTCCTAATTGG 0: 1
1: 5
2: 8
3: 44
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167311047 Original CRISPR TTTGATACTGAATATTGACA AGG (reversed) Intronic
907729708 1:57054092-57054114 TTTGAAACTGAAAAATTACAAGG + Intronic
907789077 1:57644059-57644081 CTTGATTCTGAATGTTGACAAGG - Intronic
908686742 1:66729202-66729224 TTTGATTCAGTGTATTGACATGG + Intronic
909153993 1:72047029-72047051 TTTGATACTAAGTATGGAAAGGG - Intronic
910137720 1:83992149-83992171 TTTGGCACTGATTTTTGACAAGG + Intronic
910680977 1:89864113-89864135 TTTGATCCTCACTATTGACATGG - Intronic
911113768 1:94221440-94221462 TGTGATACTGAATACTGTGATGG + Intronic
911130854 1:94386477-94386499 TTTGCTACTTATTATTTACAAGG + Intergenic
912124453 1:106516839-106516861 TTGACTACTGAATATTGCCATGG - Intergenic
913024682 1:114825283-114825305 TTTCCAACTGAATTTTGACAAGG + Intergenic
914219239 1:145663655-145663677 ATTGATACTTAATATTGTCATGG + Intronic
914326682 1:146624285-146624307 TATGATACTGGATGTTGTCAAGG - Intergenic
914471822 1:147986525-147986547 ACTGATACTTAATATTGTCACGG + Intronic
916614278 1:166423414-166423436 TTGGATATAGTATATTGACAAGG - Intergenic
918781816 1:188709196-188709218 TTTGAGAGTGAATATTGCAATGG - Intergenic
921480663 1:215661359-215661381 TTTGGCACTGCATGTTGACAAGG + Intronic
921742994 1:218707794-218707816 TTTTATACCATATATTGACATGG + Intergenic
922354350 1:224761823-224761845 TCTGATTCAGAATATGGACAGGG - Intergenic
923304775 1:232678394-232678416 CTTGACACTGAACACTGACATGG - Intergenic
924850120 1:247820198-247820220 TCTGATACTGAATCCTGACAAGG - Intergenic
1062775553 10:143447-143469 TTTTCTATTGAATTTTGACATGG + Intronic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808871 10:447269-447291 TGTGATCCTGAATATCGACGGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1064448658 10:15421274-15421296 TTTGATGCTGAATATTTTGAAGG - Intergenic
1065452189 10:25870562-25870584 TTTAATACTGAAAATTAACTAGG + Intergenic
1066642943 10:37574469-37574491 GTTGATACTGGCTATTGAGATGG + Intergenic
1068402196 10:56543754-56543776 TCTGATACTAAATATGTACATGG + Intergenic
1069174068 10:65268423-65268445 TTTTATATTAAATATTGATAAGG + Intergenic
1069522219 10:69131862-69131884 TTTGATACTGGATATAGTTATGG - Intronic
1069614128 10:69795808-69795830 TATGATTCTGTGTATTGACAGGG - Intergenic
1071207493 10:83298144-83298166 TGTGATACTGATTATTTAAATGG + Intergenic
1074733570 10:116403518-116403540 TTTGATACAGAAAATTAGCATGG + Intergenic
1075275408 10:121088674-121088696 TTTTGTACTGAAGATTGAGAAGG - Intergenic
1075623839 10:123947751-123947773 TTTGAAGCAGAAGATTGACATGG - Intergenic
1075900679 10:126040797-126040819 TATGAAACTGAACATTTACAGGG + Intronic
1077918940 11:6629145-6629167 TTTGATACTGAATATTGGAGAGG - Intronic
1079554825 11:21746382-21746404 TATGATACAGAATATTTTCAGGG + Intergenic
1079955451 11:26857516-26857538 CTTCATGGTGAATATTGACATGG + Intergenic
1080225349 11:29953917-29953939 TCTGATACTGAAACTTGTCAGGG + Intergenic
1082785833 11:57316023-57316045 ATTAATAGTGAATATAGACAGGG - Intronic
1084621755 11:70275948-70275970 TTTGATAAAGAATATCTACAGGG - Intronic
1085487350 11:76876685-76876707 ATTGACACTAAATGTTGACAAGG - Intronic
1085936454 11:81151854-81151876 TTTCATAATGAATATTGCCAAGG - Intergenic
1086090953 11:83004281-83004303 TCTGAAACTGAAATTTGACATGG - Intronic
1086669117 11:89525925-89525947 TATAAAACTGAATATTGATATGG - Intergenic
1091004138 11:131937104-131937126 TTTGATACACAATACAGACAGGG - Intronic
1093005357 12:14045356-14045378 TTTGAGACTGAATTAGGACAGGG - Intergenic
1093013608 12:14134106-14134128 TTGAATATTGATTATTGACAAGG - Intergenic
1093595823 12:20957943-20957965 TTTGAGACAGAAAATTAACATGG + Intergenic
1096935719 12:55272224-55272246 TTTGAAACTATATATTGATAAGG - Intergenic
1097495659 12:60329008-60329030 TTTCAGACTGAATACTGAGAGGG + Intergenic
1098790785 12:74819165-74819187 CATGATACTGATTATTTACATGG + Intergenic
1099529860 12:83764561-83764583 TTTGATATCAAATATTGACAAGG - Intergenic
1099775056 12:87115695-87115717 TTTGAAACTGAAAGTTGATAAGG - Intergenic
1099884917 12:88516901-88516923 GATGATACTAAATATTGGCAAGG + Intronic
1103237050 12:119382182-119382204 TTAATTACTGAACATTGACAAGG - Intronic
1103669168 12:122597604-122597626 TTTGAGACTGGACAATGACAAGG + Intronic
1108038240 13:46314450-46314472 AGTGATACCAAATATTGACAAGG + Intergenic
1109311237 13:60696643-60696665 TTTTAAACTGAAGAGTGACATGG - Intergenic
1109671944 13:65620424-65620446 TCTGAAACTGAAAAATGACAAGG + Intergenic
1109768422 13:66935766-66935788 TTTTATAATTAATATTGAAAAGG - Intronic
1112395698 13:99028884-99028906 CTAGATACTGAATATTCAAAGGG + Intronic
1113720113 13:112549527-112549549 TTTAACCCTGAATATTTACAGGG - Intronic
1114822440 14:26037591-26037613 TTTCATAAAGAATATTGATATGG - Intergenic
1116184874 14:41586507-41586529 TTTGATATATAATATTAACAAGG + Intergenic
1116428932 14:44823040-44823062 TTTGAGACAGAAAATTAACAAGG + Intergenic
1116699205 14:48217141-48217163 TTTGATACTGAATATCAAGCAGG + Intergenic
1120769144 14:88359538-88359560 TTTGTTACTGTATATTGTTAGGG - Intergenic
1120796159 14:88635459-88635481 TTTGTCTCTGAATATTAACAGGG + Intronic
1123977575 15:25567736-25567758 TTTGTCACTGAATTTTGATAAGG - Intergenic
1124041155 15:26105248-26105270 TTTAATACTGAATGTTTATATGG - Intergenic
1125355050 15:38808593-38808615 TTTGAAGCTGAATCTTGACTAGG - Intergenic
1130830801 15:87596670-87596692 TTTGATAATGTATATTAAGAAGG - Intergenic
1131334154 15:91531458-91531480 GTTGGTCCTGAATATTGACTGGG - Intergenic
1131775398 15:95790958-95790980 TTTGATACTTAATTTAAACATGG - Intergenic
1138722243 16:59096167-59096189 TAGGATGATGAATATTGACAAGG + Intergenic
1139520166 16:67477962-67477984 TTTAAAACTGTTTATTGACAGGG - Intronic
1140006882 16:71086660-71086682 TATGATACTGGATGTTGTCAAGG + Intronic
1140595595 16:76406273-76406295 TTTGCTGCTGAATATGAACATGG - Intronic
1142407134 16:89896521-89896543 TTTGAGACTGCATGTTGCCACGG - Intronic
1144097340 17:11912786-11912808 TCTGATACTGAAAACAGACAAGG - Intronic
1145299607 17:21623408-21623430 TTGAATACTGAATATTGATTGGG + Intergenic
1145350674 17:22079859-22079881 TTACATACTGAATATTGATTGGG - Intergenic
1147489362 17:40850155-40850177 TTTCAGACTGAATATTTTCATGG + Intergenic
1149592944 17:57845933-57845955 TTTGTTATTGAATAAAGACAGGG + Intronic
1149740882 17:59044615-59044637 TTGTATACAGAATAATGACAAGG - Intronic
1149772072 17:59330626-59330648 TTTGATAAAGAATGTTGGCACGG - Intergenic
1150898505 17:69241272-69241294 TCTAATTCTGAATATTGAGAAGG - Intronic
1152802687 17:82339124-82339146 TTTTATACTAAATATGGGCATGG - Intergenic
1152902674 17:82952640-82952662 TTTGAGACAGAAAATTAACAAGG + Intronic
1155076522 18:22361692-22361714 TTTAATGCTTAATCTTGACAAGG + Intergenic
1155824081 18:30417090-30417112 TGTGATGCTTAATATTCACAGGG - Intergenic
1155856727 18:30844100-30844122 TCTGTTTCTGATTATTGACAGGG - Intergenic
1159082496 18:63751516-63751538 TTTGATATTGAATATGGTCATGG - Intergenic
1159759928 18:72412093-72412115 TTTCATACTGCAAATTGACTTGG - Intergenic
1160002553 18:75040300-75040322 TTAGATACTGGATATTGATAGGG + Intronic
1160457164 18:79009515-79009537 TTTAATAGTAATTATTGACAGGG + Intergenic
1163396169 19:17062996-17063018 TTTGCTGGTGATTATTGACATGG + Intronic
1167311047 19:48738272-48738294 TTTGATACTGAATATTGACAAGG - Intronic
925323746 2:2999012-2999034 TTTCATTCTGCATATTGAGAAGG + Intergenic
926408829 2:12580936-12580958 TTTGATAGAGAAGATTAACATGG + Intergenic
927669772 2:25059377-25059399 TTTAAGACTGAATATTGGCCGGG - Intronic
928934587 2:36662189-36662211 TTTTTTAGTGAATAATGACAAGG + Intergenic
930606487 2:53498546-53498568 TTTCATTCTGAACATTGAAATGG + Intergenic
930726129 2:54683260-54683282 TTTGATTCTGAAGATTGCGATGG + Intergenic
932314516 2:70770735-70770757 TCTGATACTGCATACTGAGAAGG + Intergenic
933000455 2:76915833-76915855 AATGATATTGAATATTGATAAGG - Intronic
933036737 2:77409502-77409524 TTTAATACTGAATTTTGATGGGG + Intronic
933470249 2:82713526-82713548 TTTGATACTGAATTTTTATAAGG + Intergenic
935319777 2:101875053-101875075 CTTGATACTGAAGATTGACCAGG + Intronic
937545175 2:123007928-123007950 TTTGAAACTGTATAAAGACATGG + Intergenic
939310073 2:140464453-140464475 TTGGATGGTGAATATTGAAATGG - Intronic
939381534 2:141442806-141442828 TTTTATACTGAATAAAGAAAAGG - Intronic
939539610 2:143476996-143477018 TGTGACAATGGATATTGACAGGG - Intronic
940105161 2:150091390-150091412 TTTGATACTGACTATGGGAAAGG - Intergenic
940623058 2:156138544-156138566 TTAGCTGCTCAATATTGACATGG + Intergenic
942588119 2:177509293-177509315 TTTGATGCTAAATTTTAACAAGG + Intronic
943357756 2:186879039-186879061 TTTGATACTAAAGCTAGACAAGG - Intergenic
943701217 2:190989970-190989992 GATGAAACTGAATATTGGCAAGG - Intronic
947247953 2:228070952-228070974 TTTGATACTGAACAATGCCCAGG - Intronic
947783005 2:232787028-232787050 TTTTTTTCTGAATATTGAAATGG + Intronic
1170374522 20:15685865-15685887 TTTGCTACTCGATATTGAAATGG + Intronic
1176650292 21:9540224-9540246 TTGAATACTGAATATTGATTGGG + Intergenic
1177235512 21:18385006-18385028 TGTGAAACTGAATAGTGCCATGG - Intronic
1178859383 21:36276233-36276255 GTTGAAACTGAATGTTGGCAGGG + Intronic
1182775036 22:32824783-32824805 TTTGATACTGAGTAAAGACATGG + Intronic
1184201915 22:42975640-42975662 TTTTTTAAAGAATATTGACAAGG - Intronic
949812297 3:8018925-8018947 TTTGAAACTGAAGATTGATTTGG + Intergenic
949822520 3:8131556-8131578 TTTGATACTTAATCTTGGAAAGG - Intergenic
952094067 3:29927123-29927145 TTTCATACTAAATAATGAGAAGG + Intronic
952246935 3:31605351-31605373 TTTGATAATAAATGTTGATATGG + Intronic
952421915 3:33139862-33139884 TTTTATAATGAATATTAACAAGG - Intronic
955470617 3:59282622-59282644 TATGATGGTGAATATTGACTGGG - Intergenic
956416793 3:69039880-69039902 TTGGGAACTGGATATTGACACGG + Intronic
957171866 3:76747755-76747777 TTTTATATAGAATACTGACAAGG - Intronic
957574322 3:81988552-81988574 TTTGAAACTGAAGTTTGACTTGG - Intergenic
957934394 3:86923623-86923645 TTTGATACTCATTCTGGACATGG + Intergenic
958514798 3:95100465-95100487 CTTGATACTAAGTATTGGCAAGG + Intergenic
959142634 3:102505172-102505194 TTTGATTCTGAATAATACCAAGG + Intergenic
960559295 3:119065456-119065478 TTTGATTCTAAAAACTGACAAGG - Intronic
960799731 3:121526179-121526201 TTTGATACTGAACAATGCCTTGG - Intronic
962059073 3:131906054-131906076 TTTGATTCTGAATTCTGATATGG - Intronic
962428919 3:135301557-135301579 TTGGAAACTGAGTATTGCCAGGG + Intergenic
963507447 3:146205045-146205067 TTCAATTCTGTATATTGACAGGG - Intronic
964158784 3:153620548-153620570 TTTATTACTGAAAATTGATATGG - Intergenic
964377025 3:156057994-156058016 TTTGATACTGTATAGTGATAGGG - Intronic
965383514 3:168018735-168018757 TTTGTTAATCAAAATTGACAGGG - Intronic
965846076 3:172963143-172963165 TTTGATGCTGAATATTACCCTGG + Intronic
966026754 3:175293262-175293284 TTTGACACTGAATAACTACAAGG + Intronic
966098311 3:176233500-176233522 TTTGATACCAAAATTTGACAAGG + Intergenic
966335782 3:178866293-178866315 TATGATTCTCAATGTTGACAAGG + Intergenic
969143990 4:5104072-5104094 TTTGATATTAACTATTGATATGG + Intronic
970585017 4:17506717-17506739 TTTAATAGTGAAAGTTGACATGG - Intronic
971631925 4:29003720-29003742 TTTGATAACGAATCTTGACCAGG + Intergenic
971724482 4:30292458-30292480 TATGATATTGATTATTCACATGG + Intergenic
971999244 4:34008689-34008711 TTTGCTACTGAAGATTGACTTGG + Intergenic
972376420 4:38476108-38476130 CATGATTCTGAAGATTGACATGG - Intergenic
974433216 4:61825297-61825319 TTTGATACTTAATCTTGGGAAGG - Intronic
976048878 4:80986529-80986551 TTTGATTGTGTATATTAACATGG - Intergenic
976211865 4:82679824-82679846 TTTCAGACTGAAAATGGACATGG - Intronic
977139845 4:93355367-93355389 GTTAATACTGAATGTTGACTGGG + Intronic
977237976 4:94531850-94531872 TTTATTACAGAATACTGACAGGG - Intronic
977267457 4:94872758-94872780 TTTACTGCTGAATATTTACATGG - Intronic
982878035 4:160671868-160671890 TTGGATACTGAAAATTGGAATGG - Intergenic
983220855 4:165043241-165043263 TTTGGTAGTGGATATTTACAGGG + Intergenic
983269762 4:165547489-165547511 TTTGATATTGAATGTGAACAAGG - Intergenic
984115343 4:175673489-175673511 TTTGAAACTGAATTTTCACAAGG + Intronic
984517175 4:180754564-180754586 TTTTCAAATGAATATTGACATGG - Intergenic
984643836 4:182199457-182199479 TAAGATACTGAATAATGAAATGG - Intronic
985224811 4:187748484-187748506 TTTGCTTCTGCATATTGGCAAGG + Intergenic
986528827 5:8712382-8712404 TTTGATACAAAATATTTGCATGG - Intergenic
987624392 5:20378835-20378857 TTTGTTACTGAATTTTTACTAGG - Intronic
988239817 5:28595199-28595221 TTTTAAACTTAATATTGAGAAGG - Intergenic
988256031 5:28821344-28821366 TTTTATTTTGAATATTAACATGG - Intergenic
989269633 5:39516942-39516964 CTTGATACTGAATGATGAAAAGG - Intergenic
989437990 5:41436890-41436912 TTAGATACTTAATATAGTCAAGG + Intronic
989542606 5:42635052-42635074 TTTGATACTGGGTTCTGACATGG + Intronic
990933871 5:61125623-61125645 TTTAAAACTGTGTATTGACAAGG + Intronic
991072887 5:62504524-62504546 TTTATTTCTGAATATTTACATGG + Intronic
992357526 5:76001275-76001297 TTGCATACAGAATTTTGACAAGG + Intergenic
992823022 5:80517774-80517796 TTTGAAACTGGATATTGGCCAGG + Intronic
993707854 5:91191823-91191845 TTTAATACAGGATTTTGACATGG - Intergenic
993834868 5:92806758-92806780 TTTGATGCTGAATAATTATATGG + Intergenic
994890087 5:105622438-105622460 TTTGATATTGTATATAGAAATGG - Intergenic
995085327 5:108102272-108102294 TTTGATACTGAAAACAGATACGG - Intronic
995192482 5:109332523-109332545 TTTTATAGTGAACATTGACAGGG - Intergenic
996589337 5:125128425-125128447 TTTGAAACTGAGAATTGTCATGG + Intergenic
998286325 5:140864302-140864324 TATGATATTAAATATTGTCATGG - Intronic
998769610 5:145526963-145526985 TTTAATACTGAACAATGTCAAGG + Intronic
998962802 5:147506931-147506953 TTTGAAGCTGAGTATAGACATGG + Intronic
1003972904 6:11316108-11316130 TTGGATGCTGACTATTTACAAGG + Intronic
1004533879 6:16480676-16480698 TTTGTAACTGAATAGTGCCAAGG - Intronic
1005626716 6:27669309-27669331 TTTCATTCTCAATATTGAAAGGG + Intergenic
1006960060 6:37920077-37920099 TTTTATACTAAATACTAACAAGG - Intronic
1008066599 6:47056065-47056087 ATTGATACTGATTATTAATAAGG + Intergenic
1008273163 6:49513450-49513472 TCTGAATCTGAATATTGAAAGGG + Intronic
1010770729 6:79826501-79826523 CTTTATAGTAAATATTGACATGG - Intergenic
1011555270 6:88566628-88566650 TTCTATACTGAACATTGAGAAGG - Intergenic
1011890117 6:92148199-92148221 TATTATACTGAATATTTAAAGGG - Intergenic
1011929176 6:92688739-92688761 TGAGACAATGAATATTGACAGGG - Intergenic
1011940419 6:92835878-92835900 ATTGATGCTGACTATTGACAGGG + Intergenic
1014934347 6:127368988-127369010 TTTGATACTATACATTGACAAGG - Intergenic
1015826809 6:137322279-137322301 TGTGTTACTGAATAGTGAAACGG - Intergenic
1016900703 6:149097785-149097807 ACTGATACTGTATATTGCCAAGG + Intergenic
1017338800 6:153295315-153295337 TTTGATACTGCCTGTTTACAAGG - Intergenic
1018656574 6:166042681-166042703 TTTGATATTTAAAATTGAGAAGG + Intergenic
1020467844 7:8501281-8501303 TTTGTTACTGAGTAATGAAATGG + Intronic
1021863756 7:24933401-24933423 TTTGTTACTGAATAATTTCATGG + Intronic
1023741426 7:43284570-43284592 ATTGATCTTGAAAATTGACAAGG - Intronic
1024424123 7:49206128-49206150 TTTTATTCTGAATAGTAACAAGG - Intergenic
1024832116 7:53473105-53473127 TTTTATATTGAAAATTTACATGG + Intergenic
1025276910 7:57590516-57590538 TTGAATACTGAATATTGATTGGG + Intergenic
1025620539 7:63166252-63166274 TGTGATTTTGAATATTGCCATGG + Intergenic
1026309198 7:69169009-69169031 TTTGATATTGAGTAGAGACAAGG - Intergenic
1026603840 7:71799176-71799198 TTTTGTACTGAATATTGTCATGG + Intronic
1026964060 7:74428077-74428099 TTATATACAGAGTATTGACATGG - Intergenic
1027828072 7:83141820-83141842 TTTGATACTTTATTTTGAAAAGG - Intronic
1028209107 7:88051808-88051830 TTTCATATTGACTATTGAAAGGG + Intronic
1028909010 7:96186673-96186695 TTTGATATTAAATGTTCACAAGG + Intronic
1030554942 7:111012035-111012057 TCTGTTACTCAATATAGACAGGG - Intronic
1030740038 7:113098226-113098248 TTTGATACTGCATAGTTACTAGG - Intergenic
1030770375 7:113467716-113467738 TATGATACAGAATATTTCCATGG - Intergenic
1030861401 7:114635383-114635405 TTTGAAAGGGAATACTGACATGG - Intronic
1030941744 7:115659389-115659411 AATGATACTGATTTTTGACAAGG + Intergenic
1031500121 7:122504114-122504136 TTTCATACTTATTTTTGACAAGG + Intronic
1032131967 7:129236869-129236891 TTTGTTAATGAATATGAACAGGG - Intronic
1032663402 7:134011063-134011085 TTTGACTCTGAAAATTAACAGGG - Intronic
1032727565 7:134605199-134605221 TCTGATAATGAATATTGAAAGGG - Intergenic
1032767919 7:135017908-135017930 TTTGATTGTGAATATTTACATGG + Intronic
1033265895 7:139886794-139886816 CTTGAGACTGATGATTGACATGG + Intronic
1034066604 7:148143038-148143060 TTAGATACTGAATCATTACAGGG - Intronic
1034945170 7:155257519-155257541 CTTGATCCTGACCATTGACAAGG + Intergenic
1035014794 7:155756091-155756113 TTTGAAACTGAATTTTCCCAGGG - Intronic
1035895302 8:3393097-3393119 TGTGATACTGAACCTTGACTTGG - Intronic
1037471340 8:19214498-19214520 TTTGATATTTAATATTGCCAAGG + Intergenic
1037471894 8:19218631-19218653 GTTGTTGATGAATATTGACATGG + Intergenic
1037475548 8:19253404-19253426 TTTGATTCTGGATATTGCGAGGG - Intergenic
1038322375 8:26539298-26539320 TTTGATGCTGACTATTCACTGGG - Intronic
1039182032 8:34877868-34877890 TTTGATAGTAAATGTTGAGAAGG - Intergenic
1042740847 8:72044137-72044159 ATTGATAATGAATATTTGCAAGG - Intronic
1042823397 8:72956138-72956160 TTTGATATTTTGTATTGACAGGG + Intergenic
1043453771 8:80393785-80393807 TTTTATATTGAATAGAGACAGGG + Intergenic
1044751852 8:95423731-95423753 TTAGAAACTGAATATTAAAATGG + Intergenic
1045042656 8:98241369-98241391 TTTAAGGCTGAGTATTGACAAGG + Intronic
1045209247 8:100078453-100078475 TGTGATACTAATTATTGATATGG + Intronic
1050166317 9:2768571-2768593 TGTGGTAGTGTATATTGACAGGG + Intronic
1050198509 9:3114151-3114173 TTTGATATTGAAAACTGAGAGGG + Intergenic
1051352468 9:16211190-16211212 TTTGATACTGAAACTTGTCAAGG - Intronic
1051400511 9:16676830-16676852 TGTGTTAGTGAATATTTACAGGG - Intronic
1051441856 9:17093133-17093155 TTTTAAATTCAATATTGACAGGG + Intergenic
1053842856 9:42204276-42204298 TTAGACAATGAATATTGCCAAGG + Intergenic
1054586431 9:66971870-66971892 TTAGACAATGAATATTGCCAAGG - Intergenic
1057094965 9:92297798-92297820 TTTGATACTGAATGTGAACAAGG - Exonic
1058068663 9:100578809-100578831 TTTGAAACTTAATATTGGTAAGG + Intronic
1059004610 9:110387852-110387874 TCTGATACTGAAATTTAACAGGG - Intronic
1059218194 9:112586939-112586961 TTTGCTAATGAAAATAGACACGG - Intronic
1060701480 9:125753945-125753967 TTTGATACTTTATAGTGGCATGG + Intronic
1061995824 9:134182397-134182419 TTTACTACAAAATATTGACAGGG - Intergenic
1203628032 Un_KI270750v1:43778-43800 TTGAATACTGAATATTGATTGGG + Intergenic
1186828611 X:13366954-13366976 CTTGATTCTGAGTATTGGCAAGG - Intergenic
1187161552 X:16769789-16769811 TTTAATACCTAATTTTGACACGG + Intergenic
1187703572 X:21987845-21987867 TTTTGTTCTGAATATTGGCATGG + Intronic
1188769963 X:34141150-34141172 GTTGAAACTGAAAATTGAGAAGG - Intergenic
1188921109 X:35978929-35978951 TTTGATAGTGGATATTGTAAGGG + Intronic
1190154612 X:47979202-47979224 AGTGATACTGAATTTTAACATGG + Intronic
1190559714 X:51674966-51674988 TTTCATTCTGCATATTCACAAGG + Intergenic
1190564577 X:51718355-51718377 TTTCATTCTGCATATTCACAAGG - Intergenic
1191770565 X:64753099-64753121 ATTAATACTCAATATTCACAAGG - Intergenic
1192222298 X:69205704-69205726 TTTGGTAGTTAATATTGGCAAGG - Intergenic
1193891910 X:87058030-87058052 TTTGATATTGACTAATTACATGG + Intergenic
1194816548 X:98448580-98448602 TTTTATAGTCAATTTTGACAGGG - Intergenic
1197515928 X:127428893-127428915 TTTGATAATGTTTTTTGACATGG - Intergenic
1198791119 X:140347488-140347510 TTTGATACTAATTATGGTCAAGG - Intergenic
1200388239 X:155915915-155915937 ATTGAGACAGAATATTAACAAGG - Intronic
1201458671 Y:14198835-14198857 TTTGTTACTGATTATAGACATGG + Intergenic
1201607684 Y:15805145-15805167 ATTGTTACTGAATATGGAGATGG - Intergenic