ID: 1167313960

View in Genome Browser
Species Human (GRCh38)
Location 19:48753149-48753171
Sequence GGCTGCCGCCGGAGCGCGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 205}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167313948_1167313960 20 Left 1167313948 19:48753106-48753128 CCCTCTGCCGCGTCCTCCTGGGG 0: 1
1: 0
2: 2
3: 20
4: 319
Right 1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG 0: 1
1: 0
2: 2
3: 20
4: 205
1167313955_1167313960 4 Left 1167313955 19:48753122-48753144 CCTGGGGGATGGAGAACCTGTTT 0: 1
1: 0
2: 0
3: 27
4: 268
Right 1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG 0: 1
1: 0
2: 2
3: 20
4: 205
1167313945_1167313960 23 Left 1167313945 19:48753103-48753125 CCGCCCTCTGCCGCGTCCTCCTG 0: 1
1: 0
2: 5
3: 43
4: 587
Right 1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG 0: 1
1: 0
2: 2
3: 20
4: 205
1167313950_1167313960 19 Left 1167313950 19:48753107-48753129 CCTCTGCCGCGTCCTCCTGGGGG 0: 1
1: 0
2: 1
3: 24
4: 297
Right 1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG 0: 1
1: 0
2: 2
3: 20
4: 205
1167313953_1167313960 13 Left 1167313953 19:48753113-48753135 CCGCGTCCTCCTGGGGGATGGAG 0: 1
1: 0
2: 1
3: 32
4: 283
Right 1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG 0: 1
1: 0
2: 2
3: 20
4: 205
1167313954_1167313960 7 Left 1167313954 19:48753119-48753141 CCTCCTGGGGGATGGAGAACCTG 0: 1
1: 0
2: 0
3: 15
4: 234
Right 1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG 0: 1
1: 0
2: 2
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167313960 Original CRISPR GGCTGCCGCCGGAGCGCGCG AGG Intronic
900203131 1:1420153-1420175 GGCTGCCGCTGCGGGGCGCGGGG - Exonic
900302030 1:1982663-1982685 GGCTGCTGCCGGACTGCCCGTGG - Intronic
900349739 1:2228677-2228699 GGGCGCCGCCGGGGCGCGCGGGG + Exonic
901045574 1:6393662-6393684 GGCTGCCACCGGGTCGGGCGCGG - Intronic
901086690 1:6615072-6615094 GGCTGCCGCGGGAGGGCGGGTGG + Intronic
901109914 1:6785813-6785835 GGCTGGGGCCGGAGGGGGCGGGG + Intronic
902582879 1:17419998-17420020 TGCGGCTGCAGGAGCGCGCGCGG + Intronic
903788311 1:25875596-25875618 GGCTGTAGCCAGAGCGCCCGAGG - Intergenic
904724979 1:32539950-32539972 GGCCGCCGCGGGGGCGCGCGGGG + Intronic
904852864 1:33472541-33472563 GGCCGCCCCCGGCGCTCGCGCGG + Intergenic
905375012 1:37514400-37514422 GGCAGCCGCAGGAGGGGGCGTGG - Intronic
910200190 1:84690717-84690739 AGCTGCGCCCGCAGCGCGCGCGG - Intronic
912927893 1:113929685-113929707 GGCCGAGGCGGGAGCGCGCGGGG + Intronic
914703074 1:150150786-150150808 GGCTGCGGCCGGGGGGCGGGGGG - Intronic
915740252 1:158113683-158113705 GGCGGCCGCCGGGGGGCGCCGGG - Intergenic
919809396 1:201399327-201399349 GGCGGCCGGCGGGGCGCGGGCGG - Exonic
920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG + Intergenic
920504509 1:206506970-206506992 CGCGGCTGCGGGAGCGCGCGCGG + Intergenic
921472666 1:215567558-215567580 GGCGGCGGCCGGAGGGCGGGGGG - Exonic
922526703 1:226309411-226309433 GCCCGGCGCCGGAGCGCGGGGGG + Exonic
922581766 1:226703521-226703543 GGCGGCGGGCAGAGCGCGCGCGG - Intronic
923119585 1:230978359-230978381 GGCGGCTGCAGGAGGGCGCGCGG + Intronic
923498509 1:234545169-234545191 GGCTGGGGCAGGAGCGAGCGGGG + Intergenic
1063223500 10:3992838-3992860 GGCTGCCACCGGAACGCAGGCGG + Intergenic
1064553049 10:16521398-16521420 GGCTGCAGCCGGCGCCGGCGCGG + Exonic
1065343018 10:24723776-24723798 GGCCGCCGCAGGAGGGCGTGGGG + Intergenic
1069761806 10:70816239-70816261 GGCTGCGGCCGGGGCGGGGGCGG + Intronic
1070179247 10:73998389-73998411 GCCTGGCGCGGGAGCGGGCGCGG + Intronic
1071544930 10:86521878-86521900 GGCGGGCGCCGGAGCATGCGGGG - Intergenic
1076683204 10:132185880-132185902 GGCAGCCTCAGGAGCCCGCGAGG + Intergenic
1076793452 10:132788087-132788109 GGCTGCCGAGGGAACGCGTGGGG + Intergenic
1077095735 11:798298-798320 GGCCGAGGGCGGAGCGCGCGCGG - Exonic
1078514098 11:12008499-12008521 GGTCGCCGTCGGAGCGGGCGCGG + Exonic
1081705613 11:45180760-45180782 GGCTGCGGCCGGGGCGGGCGCGG - Intronic
1083457108 11:62786686-62786708 CGCTGCCGCCAGGGGGCGCGGGG + Exonic
1083572864 11:63769280-63769302 GGCTCCCGCGGGAGGGGGCGCGG - Intergenic
1083728025 11:64638393-64638415 GGCTGCCTCCGGAGCGCAGAAGG + Intronic
1084146268 11:67266847-67266869 GGCCGCGGCCGGGGCGCCCGCGG - Intronic
1084151337 11:67289278-67289300 GGCGGGCGGCGGAGCGGGCGGGG - Exonic
1085416496 11:76322047-76322069 GGCTGCCGGCGGGGCAGGCGGGG + Intergenic
1086349853 11:85934747-85934769 GGCGGCCGCCAGAGCGTGTGGGG - Intergenic
1089046347 11:115504425-115504447 GGCTGCCTCCGGAGCCCGAGCGG + Intronic
1091286891 11:134412648-134412670 GGCTGCTGCAGGAGGGCGGGGGG + Intergenic
1091381815 12:66825-66847 GGCTGGCGGCGGGGAGCGCGAGG - Exonic
1091712718 12:2753168-2753190 GGCTGGCGCCTGGGAGCGCGAGG + Intergenic
1092196955 12:6555510-6555532 GGCTGGCCGCGGAGGGCGCGAGG + Exonic
1092743165 12:11649551-11649573 GGCGGCCGCGGGGGCGCGGGCGG - Intergenic
1095476229 12:42589730-42589752 GGCTGCAGGCGGAGTGCGCTCGG + Intronic
1096204240 12:49707546-49707568 GGCTGCAGTCGGCGCTCGCGGGG - Intronic
1096647582 12:53047168-53047190 GGCTGCCACGGGCGCGGGCGCGG + Intronic
1097990369 12:65826007-65826029 GGCGGCCGCCGGAGGGAGCCCGG + Intronic
1101493868 12:105235846-105235868 GGCAGCCGCGGGAGTGCGCCCGG - Intronic
1102058017 12:109911187-109911209 AGCTGCAGCTGGAGCGGGCGCGG + Exonic
1102853944 12:116277464-116277486 GGCCCCCGCCGGCGCGCGAGGGG + Intergenic
1102933547 12:116879740-116879762 GGCGGCAGCCGGAGCGTGGGGGG - Intronic
1103400725 12:120641167-120641189 CGCTGCCGCCGGCCCGCGGGCGG + Exonic
1103764775 12:123272009-123272031 GGCAGCCGCCCGGACGCGCGCGG - Exonic
1105932852 13:25068969-25068991 GGCTCCCGCAGTTGCGCGCGGGG + Intergenic
1106517147 13:30465330-30465352 GGCCGCCGCCGCAGCGAGCCGGG - Intronic
1110573068 13:77026950-77026972 GGATGCGGGCGGAGCGCGGGGGG - Exonic
1110597018 13:77329907-77329929 GGCTGCAGCCGGGGGGCGTGGGG + Intergenic
1113311870 13:109140405-109140427 TGCTGCCCCCGGGGCGCCCGCGG - Exonic
1115545549 14:34462355-34462377 GCCGGCGGCCGGGGCGCGCGCGG - Exonic
1118265968 14:64295021-64295043 GGCTGCCACCAGGGGGCGCGAGG - Intronic
1118293733 14:64549868-64549890 GGGTGCGGCCGCAGCCCGCGCGG + Intergenic
1123630769 15:22258267-22258289 GGCCGCGGCCGGGGCGCGCCGGG - Intergenic
1125200752 15:37099063-37099085 CGCTGCCGCCGTGGCTCGCGCGG - Intronic
1127094435 15:55498451-55498473 TGCTGGCGCCGGAGCACGCTGGG - Exonic
1129817249 15:78565741-78565763 AGCAGCAGGCGGAGCGCGCGGGG - Exonic
1130010795 15:80152322-80152344 GGCAGCAGCCGGGGCGAGCGAGG + Intergenic
1131827192 15:96331237-96331259 GGCGGCGGCCGGAGAGAGCGAGG + Exonic
1132398159 15:101489314-101489336 GGCGGCCTCCGGCGCGCGCGAGG - Intronic
1132747420 16:1442838-1442860 GGCTGGCTCCGGAGCTTGCGTGG - Intronic
1132893174 16:2214492-2214514 GGCTGGCGCCGGGCCCCGCGGGG + Exonic
1138591183 16:58000532-58000554 GGCTGCGGCCGGACCGGGGGCGG + Intronic
1140927886 16:79600346-79600368 GGCTGCAGGCAGGGCGCGCGCGG + Exonic
1141665279 16:85462653-85462675 GGCTGCCCGGGGAGCGCGGGCGG + Intergenic
1141830042 16:86505508-86505530 GGCTGCCGGAGGAGCGCGGGAGG - Intergenic
1141959156 16:87392720-87392742 GGCAGCCGGCGGAGGGCGGGCGG + Intronic
1141972275 16:87492306-87492328 GGCCGCGGCCGGGGCGCGCCGGG + Intergenic
1142136941 16:88455843-88455865 GGCTGCCGACGGGGAGCGCGGGG + Intronic
1142206411 16:88785134-88785156 GGCGGTCGCCTGAGCGAGCGCGG - Exonic
1142348019 16:89566180-89566202 TGCAGGCGCCGGAGCGCGCCTGG - Exonic
1142761045 17:2042087-2042109 GGCTTCCGGCAGAGCGAGCGGGG + Exonic
1142762421 17:2050232-2050254 GGCCGCCGCCGCCGCGCCCGGGG - Intergenic
1143390536 17:6556738-6556760 CGCGGCCACCGCAGCGCGCGAGG + Intergenic
1145041280 17:19579892-19579914 GGCTGGCGGCGGCGCGGGCGCGG - Intergenic
1145243597 17:21253292-21253314 GGCGGGGGCCGGGGCGCGCGGGG + Exonic
1145266719 17:21383202-21383224 GGCTGCAGCTGGAGCAAGCGGGG - Intronic
1147315391 17:39617888-39617910 GGCCGCCCCGGGAGGGCGCGCGG - Intergenic
1147653000 17:42072641-42072663 GGCTGTCCCGGGAGAGCGCGGGG - Intergenic
1148617853 17:49013965-49013987 GGCTGAGGCCGCAGCGCGCAAGG - Intronic
1150217284 17:63477610-63477632 GGCAGCTGCCCGAGAGCGCGGGG - Intergenic
1151314040 17:73311183-73311205 GGCTTCCGAGGGAGCGGGCGGGG + Intronic
1151589705 17:75035100-75035122 AGCTGCAGCCGGAGACCGCGTGG + Intronic
1151674129 17:75589220-75589242 GGCGGCCGCCAGAGGGCGAGGGG + Intergenic
1152070555 17:78131881-78131903 GGCAGCTGCGGGAGCCCGCGGGG + Exonic
1152830966 17:82496893-82496915 AGCTGCCTCCGGAGGGCGAGCGG - Intergenic
1152948383 17:83211104-83211126 GCCTGCCGCTGGAGAGCGTGGGG - Intergenic
1153396824 18:4631555-4631577 GGCTGCCGGCAGGGTGCGCGGGG + Intergenic
1153688254 18:7567412-7567434 GGCGGCGGGCGGAACGCGCGCGG + Exonic
1153900651 18:9614599-9614621 GGCTGGCGGGGGCGCGCGCGCGG + Intronic
1156008444 18:32470477-32470499 GGCGGCCGCCGAGGCGCGGGTGG - Intronic
1160025374 18:75211620-75211642 GGCTGCGGGCGGAGCGCGCGGGG - Intronic
1160025445 18:75211826-75211848 AGCCGCCGCCGGAGTTCGCGGGG - Intronic
1160527822 18:79547729-79547751 GGCTGGCCCCAGAGCGCGGGCGG + Intergenic
1160782652 19:884664-884686 GGCAGCCGCCGCAGCGGGCGTGG + Intronic
1161156137 19:2732712-2732734 CCCTGCCGCCGGAGCCCGCCGGG - Exonic
1161388099 19:4007639-4007661 GGCGGCGGGAGGAGCGCGCGCGG + Exonic
1161400403 19:4064673-4064695 AGCTGCCTCCGGAGAGGGCGTGG - Intronic
1162031767 19:7920618-7920640 GGCTGCGGCAGGAGCCAGCGGGG + Intronic
1162070357 19:8149130-8149152 GGGCGCCCCCGGAGCCCGCGGGG + Intronic
1162125747 19:8498752-8498774 TGCTGCAGCCGGAGCGCCGGGGG - Exonic
1162362834 19:10230234-10230256 GGCTCCCGCGCGAGCGAGCGTGG - Intronic
1162524084 19:11197484-11197506 GGCAGCGGCCGGAGCGCGCAAGG - Exonic
1163124803 19:15239058-15239080 GGCTGCGGCAGGAGCGCATGAGG - Exonic
1165129289 19:33622097-33622119 GCCGGCAGCCGGAGCGTGCGGGG - Intronic
1165784579 19:38453394-38453416 GGCTGCCGACTCAGCGGGCGGGG + Intronic
1167080807 19:47275089-47275111 GGGTGCCGCGGGAGACCGCGTGG - Exonic
1167145782 19:47680320-47680342 GGCTGCTGCGGGAGCGCCCCCGG - Exonic
1167313960 19:48753149-48753171 GGCTGCCGCCGGAGCGCGCGAGG + Intronic
1168078501 19:53992966-53992988 GGCTGACGCCCGAGCGCGAGGGG + Exonic
925609794 2:5693154-5693176 GGCGGCGGCGGGAGCGCGGGCGG + Exonic
927997283 2:27495012-27495034 AGCTGCGGGCGGAGCGGGCGCGG + Exonic
928143678 2:28752241-28752263 GTCTGCCGCCGGAACGCGAGGGG + Intronic
931694176 2:64859724-64859746 GGCTGCCGCCCCAGGGCGCCCGG - Intergenic
932699680 2:73984599-73984621 GGCTGCAGCCGGGGCCGGCGAGG - Intergenic
934079106 2:88452437-88452459 GGCTGCCGGGGGGGCGCCCGGGG + Exonic
934636338 2:95992526-95992548 GGCTGCAGCTGCAGCGCCCGTGG + Intergenic
934797305 2:97112900-97112922 GGCTGCAGCTGCAGCGCCCGTGG - Intergenic
934836100 2:97590539-97590561 GGCTGCAGCTGCAGCGCCCGTGG + Intergenic
935196553 2:100819951-100819973 GTCTGCCTGCGGCGCGCGCGGGG + Intergenic
936530975 2:113277143-113277165 GGCTGCCCCCAGAAGGCGCGGGG - Intronic
937221715 2:120346015-120346037 GGCTGCCGCCGGCTCGCAGGGGG - Intergenic
937933068 2:127220217-127220239 GGCTGCGGCCGGCGCCCGAGCGG - Intergenic
938407476 2:131040487-131040509 GGCTGCCGCGGGCGCCAGCGCGG + Intronic
942947142 2:181683708-181683730 AGCGGCAGCCGGAGCGCCCGCGG + Intergenic
945088885 2:206160135-206160157 GGCTGCCGCGGGAGGGAGGGAGG + Intronic
946354873 2:219178319-219178341 AGCCGCCGCCCGAGCCCGCGAGG - Exonic
946865730 2:224039501-224039523 GGCTGCGCCCGGAACGCGCCGGG + Intergenic
948140859 2:235670830-235670852 TGCAGCGGCTGGAGCGCGCGCGG + Intronic
1170852464 20:20017503-20017525 GGCTGGGGCCGGAGCTGGCGGGG - Intronic
1173662892 20:44746216-44746238 GGCTGGGGCTGGAGCGGGCGCGG - Intronic
1175429315 20:58891110-58891132 GGCTGCTGCCCGAGCCCGGGGGG + Intronic
1175889974 20:62311707-62311729 GGCTGCGGCTGGAGCTCGGGGGG + Exonic
1179522366 21:41953724-41953746 GGCTGCGGCCACAGCGCGCTGGG + Exonic
1179893689 21:44350243-44350265 GGGTGACGCCGGGGCGCGGGCGG + Intronic
1180180295 21:46115941-46115963 GGCTGCAGGCGGGGCGGGCGTGG - Intronic
1180876835 22:19178635-19178657 GGCGGCCGCCAGAGCGCGCGGGG + Exonic
1180908362 22:19431568-19431590 GGCGGCGGCCGGAGGGCGGGTGG - Exonic
1181695950 22:24592887-24592909 AGCGGCGGCCGGAGCGCGCCCGG - Exonic
1182289836 22:29268571-29268593 TGCTGCGGCGGGGGCGCGCGGGG + Intronic
1182638731 22:31750096-31750118 GGCGGCGGCCGGAGCGCCCCCGG - Exonic
1185296755 22:50058430-50058452 GGCTGCTGTCGGAGCAGGCGCGG + Intergenic
1185333354 22:50261343-50261365 GGCGGCCGGCGGGGCGGGCGGGG - Intronic
950153819 3:10707962-10707984 CGCTGCCGCTGGTGCGCGCCCGG + Intronic
950902990 3:16513678-16513700 GGCTGGAGCCGGAGCGCGCCGGG - Exonic
953899809 3:46833733-46833755 GGCTGTCGTCGGGGCGCCCGGGG - Intronic
954437494 3:50503738-50503760 GGCCGCGGCGGGGGCGCGCGGGG - Intronic
954779069 3:53046016-53046038 CGCCTCCGCCGGAGCGCGGGTGG - Exonic
954846854 3:53566743-53566765 AGCTGCCGCAGGAGCTCTCGGGG - Intronic
956080278 3:65549565-65549587 CGCTGCCGCCCGAGCGGGCTGGG - Intronic
957048851 3:75396399-75396421 GGCTGCAGCTGCAGCGCCCGTGG + Intergenic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
964087464 3:152835219-152835241 GGCAGCCATCGGAGCGCGCGTGG - Exonic
967849497 3:194071210-194071232 GGCTCCCGCCCGGGCGGGCGCGG + Intergenic
967904162 3:194486970-194486992 GGCAGGCGGGGGAGCGCGCGCGG + Intronic
968653119 4:1767728-1767750 GGCTCCGGCCGGCGCGGGCGTGG - Intergenic
970202865 4:13627467-13627489 GGCTGGCCCCGGCGCGGGCGGGG - Exonic
973635874 4:52861952-52861974 GGCTGCAGCGAGTGCGCGCGTGG + Intergenic
983656467 4:170089943-170089965 GGCGGCCGCAGGAGCGCGTGCGG - Exonic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
985995787 5:3596191-3596213 GGCAGCCGCCGCAGCGGCCGCGG - Exonic
990210890 5:53480646-53480668 GGCGGCCGGCGGCGAGCGCGGGG + Exonic
991351256 5:65722338-65722360 GGCTGGCGGCGGCGGGCGCGTGG - Exonic
992487522 5:77210653-77210675 GGCGGCCGCTGGTGCGCGCGGGG + Intronic
992627571 5:78648914-78648936 GGCTCCCGGCGCGGCGCGCGGGG + Intronic
993900946 5:93584189-93584211 GGCCGCAGCCGGAGCGCGAGCGG - Exonic
997265015 5:132490398-132490420 GGCGCCCCCCGGAGCCCGCGCGG + Intronic
997292492 5:132747728-132747750 GGCTGGCGCCGTACCGCGCCGGG - Exonic
998166647 5:139848199-139848221 GGCTGGCGGCGCAGCGCGCACGG - Exonic
1000347626 5:160328073-160328095 GGCTCACGCAGGAGTGCGCGTGG + Intronic
1002091931 5:176810988-176811010 GGCTTCCGGGAGAGCGCGCGGGG - Intronic
1002140287 5:177133732-177133754 CGCGGCCGCGGGGGCGCGCGCGG + Intronic
1002574003 5:180161398-180161420 GGCTGCCGCAGGGCTGCGCGGGG - Intronic
1002813450 6:656797-656819 GGAGGCCGCCGGAACCCGCGGGG + Exonic
1005942536 6:30571507-30571529 AGCAGCCGCCGGAGCCCGAGTGG + Exonic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006180385 6:32150512-32150534 GGCTGGCGCCGGCGGGGGCGGGG + Exonic
1007781602 6:44257617-44257639 GTCTGCCTCCGGGCCGCGCGGGG - Intronic
1013793612 6:113860186-113860208 GGCCGCCGCCGAGGCGGGCGCGG + Exonic
1014230222 6:118894669-118894691 GACGGCCGCCGAGGCGCGCGCGG + Intronic
1015799405 6:137044934-137044956 GGTAGCCGGGGGAGCGCGCGTGG - Exonic
1016990718 6:149925965-149925987 GGCTGCTGCGGGAGGGCGCCCGG + Intergenic
1018331041 6:162727708-162727730 GGCTGGCGCCGCTGCGCGCATGG - Exonic
1018950820 6:168377757-168377779 GGCTGACGCCTGAGCTCGGGCGG + Intergenic
1019197357 6:170290338-170290360 GGCTGCCGCGGGACCTCGCAGGG - Exonic
1019343070 7:517588-517610 GACTGCGGCCGGCGCTCGCGGGG - Intronic
1022090076 7:27102251-27102273 GGCTGCCGCGGCTGCCCGCGGGG + Exonic
1022098397 7:27154998-27155020 GACTGCCGCCGCAGCTCCCGAGG - Exonic
1022629302 7:32070584-32070606 AGCTGCCTCCGGAGCGCACCTGG - Intronic
1024569108 7:50709581-50709603 GGCACCCTCCGGAGGGCGCGGGG - Intronic
1031966465 7:128031321-128031343 GGCCGCCGCCGGAGGGAGTGCGG + Intronic
1032068793 7:128791499-128791521 GGCGGGCGCCGGAGCCGGCGCGG + Intronic
1032306232 7:130734191-130734213 CGCTGCCGCCGCCGCCCGCGCGG + Intergenic
1032344361 7:131105947-131105969 GGCGGCGGCGGGCGCGCGCGGGG + Intergenic
1034951085 7:155297640-155297662 GGCTCCCGCCCGAGTGCGCGCGG + Intergenic
1037337050 8:17801561-17801583 GGCTGGCGCCGGGGGGCGTGGGG - Intergenic
1042696024 8:71556387-71556409 GGCTGCCGCGGGCGCGCGGGCGG - Intronic
1044988714 8:97776501-97776523 GGCTGCGGACGGAGCGGTCGCGG + Intronic
1045489358 8:102656762-102656784 GGCTCCCGCTGGAGCACGCCTGG + Intergenic
1049201575 8:141343162-141343184 GGCTGCCCCTGGAACGTGCGGGG - Intergenic
1049409037 8:142464285-142464307 GGCGGCCGCCGGAGCAGACGCGG + Exonic
1049585124 8:143429424-143429446 GGCGGCCCCGGGAGCGCGGGCGG - Exonic
1049707441 8:144049414-144049436 GGCGGGCGCCAGAGCGCGGGCGG - Intergenic
1050873970 9:10612890-10612912 GCCGGCGGCCGGAGCGCGTGGGG - Intergenic
1052970936 9:34376868-34376890 AGCTGCCGCCGCGCCGCGCGGGG + Intergenic
1057466367 9:95317726-95317748 CGACGCCGCGGGAGCGCGCGGGG - Intergenic
1060952328 9:127612206-127612228 CCCCGCCGCCGGCGCGCGCGGGG - Intergenic
1061208507 9:129177611-129177633 GGCGGCGGCCGGAGCGCCCGCGG - Exonic
1061208610 9:129178125-129178147 GCCGGCCGCCGGGGCGCGCCGGG + Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062429920 9:136522497-136522519 GGCTGGGGCCGGAGAGGGCGTGG - Intronic
1062500728 9:136850929-136850951 GGCTGCCGCAGGAGCAGGCAGGG - Exonic
1203608456 Un_KI270748v1:75478-75500 GCCTGCCGCTGGAGAGCGTGGGG - Intergenic
1189304110 X:39973961-39973983 GGCTGACACCGGAGCACGCAGGG + Intergenic
1189323042 X:40097654-40097676 GGCTCCTGCCCGAGCGCGGGCGG - Intronic
1189821443 X:44873253-44873275 GGGAACGGCCGGAGCGCGCGGGG - Intronic