ID: 1167314089

View in Genome Browser
Species Human (GRCh38)
Location 19:48753716-48753738
Sequence AAGGGGGGGCAGGATAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 955
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 878}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167314074_1167314089 29 Left 1167314074 19:48753664-48753686 CCGGTAGTGGCCCCGAATGGCTG 0: 23
1: 127
2: 148
3: 95
4: 68
Right 1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG 0: 1
1: 0
2: 5
3: 71
4: 878
1167314079_1167314089 17 Left 1167314079 19:48753676-48753698 CCGAATGGCTGGGCGCGCTGATA 0: 5
1: 28
2: 28
3: 34
4: 140
Right 1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG 0: 1
1: 0
2: 5
3: 71
4: 878
1167314077_1167314089 19 Left 1167314077 19:48753674-48753696 CCCCGAATGGCTGGGCGCGCTGA 0: 4
1: 24
2: 33
3: 51
4: 180
Right 1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG 0: 1
1: 0
2: 5
3: 71
4: 878
1167314078_1167314089 18 Left 1167314078 19:48753675-48753697 CCCGAATGGCTGGGCGCGCTGAT 0: 6
1: 30
2: 32
3: 46
4: 176
Right 1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG 0: 1
1: 0
2: 5
3: 71
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167314089 Original CRISPR AAGGGGGGGCAGGATAAGGA GGG Intronic
900125187 1:1065736-1065758 ACAAGGGGGCAGGATAAGGAGGG + Intergenic
900323350 1:2095713-2095735 AAGGTGGGGAGGGAAAAGGAGGG - Intronic
900457460 1:2784135-2784157 CGAGGGGGGCAGGGTAAGGAGGG + Intronic
900654498 1:3748405-3748427 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
900700782 1:4047487-4047509 AAGGGGAGGAAGGAGGAGGAAGG + Intergenic
900831549 1:4969211-4969233 AAGGGAGGGGAGGAGAAGGGAGG + Intergenic
901056382 1:6450380-6450402 GAGGGGGGGCAGGATGAGACTGG - Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901526383 1:9825418-9825440 GAGGGGGAGCAGGGGAAGGAAGG - Intergenic
902409659 1:16205568-16205590 CTGGAAGGGCAGGATAAGGAAGG + Exonic
903014702 1:20354292-20354314 AAGGGTGGGGAGGAGAGGGATGG + Intronic
903344420 1:22675344-22675366 ATGGGCAGGCAGGAGAAGGAAGG - Intergenic
903368648 1:22820112-22820134 AAGGGGAGGCAGGCTCAGAAAGG + Intronic
903379108 1:22884652-22884674 AATGGGTGGCTGGATATGGATGG + Intronic
903395700 1:23000326-23000348 ATGGTGGTGCAGGATATGGAAGG + Intergenic
904618665 1:31763089-31763111 CAGGGGTGGGAGGATAGGGATGG + Intronic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
905388509 1:37621217-37621239 AAGCAGGGGCTGGATGAGGAAGG + Intronic
905429567 1:37911675-37911697 ATGGTGGTGCAGGATATGGAAGG - Intronic
905462012 1:38128108-38128130 GAGGGGAGGGAGGACAAGGAGGG + Intergenic
905681242 1:39872849-39872871 AGGGAGGGGAAGGAAAAGGAAGG + Intronic
905917822 1:41698174-41698196 TAGGGTGGGCATCATAAGGAGGG - Intronic
906238017 1:44223383-44223405 AAGAGGGGGAAGGGTTAGGATGG + Intronic
906245022 1:44267397-44267419 AAGGGAGGGAAGAAGAAGGAGGG - Intronic
906708132 1:47909780-47909802 AAGGGGGGGGGGGATGGGGAGGG - Intronic
906717289 1:47979631-47979653 AAGTGGGGGCGGGGTAAGGCAGG - Intronic
907256002 1:53179669-53179691 TTGGTGAGGCAGGATAAGGAAGG - Intergenic
907364545 1:53947132-53947154 AAGGGGAGGCAGGTGAAGGTTGG + Intronic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
908245056 1:62221341-62221363 AAGGGTGGGGTGGAGAAGGAGGG - Intergenic
909028562 1:70511471-70511493 TTGGTGGGGCAGGATCAGGAGGG + Intergenic
909729776 1:78876848-78876870 ATGGTGGTGCAGGATATGGAAGG - Intergenic
910028509 1:82687913-82687935 AAGGGGAGGCAGGAGAGGCAGGG - Intergenic
911100850 1:94094769-94094791 GAGGAGGGGAAGGAGAAGGAGGG + Intronic
911117497 1:94260990-94261012 ATGGGGGTGCAGAATTAGGAAGG - Intronic
911147685 1:94568397-94568419 ATGGTGGTGCAGGATATGGAAGG + Intergenic
911474312 1:98357485-98357507 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
912253176 1:108031904-108031926 AAGGGAGAGCATGAAAAGGATGG + Intergenic
912438749 1:109681703-109681725 AGGCGGGGGCAGGAGAAGGAGGG - Intronic
912441272 1:109700148-109700170 AGGCGGGGGCAGGAGAAGGAGGG - Intronic
912496440 1:110094943-110094965 CAGGAGGGGCAGGACGAGGATGG + Intergenic
912703417 1:111895100-111895122 AAGGAGGGGAAGGAAGAGGAAGG + Intronic
912795768 1:112692714-112692736 GAGTGGGGGCAGGAACAGGATGG - Intronic
912939175 1:114030033-114030055 ATGGTGGTGCAGGATATGGAAGG - Intergenic
913095438 1:115511713-115511735 ATGGTGGTGCAGGATATGGAAGG + Intergenic
913245472 1:116866661-116866683 ATGGTGGTGCAGGATATGGAAGG - Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
914720042 1:150282224-150282246 AAGGGAGGGGAGGAAAAGGGCGG - Intergenic
914805042 1:150985488-150985510 AAGGGGTGGTAAGATGAGGATGG - Intronic
915121125 1:153630028-153630050 AGGGGTGGGCAGCAGAAGGAAGG + Intronic
915233146 1:154460988-154461010 ACGAGGAGGCAGGGTAAGGAAGG + Intronic
915234370 1:154469745-154469767 CAGGTGGGGAAGGAAAAGGAAGG + Intergenic
915317319 1:155036470-155036492 TGGGGAGGGCAAGATAAGGAGGG - Intronic
915593225 1:156882268-156882290 GATGGGGGGCAGGAAAGGGACGG + Intergenic
915702286 1:157807307-157807329 AAGCAGGGGTAAGATAAGGAGGG - Intronic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
916329081 1:163594740-163594762 ATGGTGGTGCAGGATATGGAAGG - Intergenic
916332101 1:163628394-163628416 GAGGGGTGGGAGGAGAAGGAGGG - Intergenic
916866399 1:168864050-168864072 AAGGGGAGGGGGGATAAGGATGG + Intergenic
916901863 1:169233897-169233919 AAGGAGGGAGAGGAAAAGGAAGG - Intronic
917503283 1:175605072-175605094 AATGGTGGGCAGCATAGGGAAGG + Intronic
917749953 1:178044146-178044168 ATGGTGGTGCAGGATATGGAAGG - Intergenic
917903038 1:179562505-179562527 AAGTGGAGGGAGGATAAGGAAGG - Intronic
918513072 1:185332813-185332835 GAGGGGGGGAAGGATAACAAGGG - Intergenic
919725571 1:200880622-200880644 ACAGAGTGGCAGGATAAGGAAGG + Intergenic
920053167 1:203175521-203175543 AAGGTGGGGCAGGGGGAGGAGGG - Intronic
920300560 1:204986138-204986160 AGGGTGGGGCAGGAGAAGGGTGG + Intronic
920399659 1:205669087-205669109 AAGGGGTGGCAGTAGAAGCAAGG + Intronic
920425700 1:205873366-205873388 AAGGTGGTGCAGGATATGGAAGG - Intergenic
920427029 1:205886626-205886648 ATGGTGGTGCAGGATATGGAAGG + Intergenic
920443652 1:205999197-205999219 AAGCTGGGGCAGGACGAGGAAGG + Intronic
920901308 1:210112803-210112825 ATGGTGGTGCAGGATATGGAAGG + Intronic
920908336 1:210191667-210191689 ATGGTGGTGCAGGATATGGAAGG - Intergenic
921205425 1:212844726-212844748 ATGGTGGTGCAGGATATGGAAGG - Intronic
921356850 1:214292896-214292918 AAGGAGGCAGAGGATAAGGAAGG - Intronic
921361009 1:214331136-214331158 AAGAGGGAGCAGGAGAAGGATGG + Intronic
921390944 1:214612914-214612936 AATGGGGGGCAGGAAGGGGAAGG + Intronic
921707976 1:218345803-218345825 AAGGAGGAGCAGGAGAAGGAGGG + Intergenic
921890161 1:220345816-220345838 CAGGAGGGGCAGGATCAGGAAGG - Intergenic
922020592 1:221700204-221700226 GAGGGAGGGAAGGAAAAGGAAGG + Intergenic
922027717 1:221767175-221767197 AAAGGGGAGGAGGAAAAGGAGGG - Intergenic
922317304 1:224453875-224453897 GAGGGGAGGGAGGATAAAGAAGG - Intronic
922363252 1:224841978-224842000 ATGGTGGTGCAGGATATGGAAGG + Intergenic
922403850 1:225291008-225291030 AAGGGAGAGAAGGATAGGGAGGG - Intronic
924623228 1:245680179-245680201 AAGGGAGGGCAGGGGAGGGAAGG - Intronic
1063624027 10:7672301-7672323 AAGGGGGAGGAAGATAAAGAAGG + Intergenic
1063850850 10:10188228-10188250 AAGGAGGGGCAAGAGAAAGATGG + Intergenic
1064082442 10:12319428-12319450 AAGGGAGGGGAGGAGAGGGAAGG - Intergenic
1064327497 10:14364601-14364623 AAGAGGGGCCAAGATGAGGAGGG + Intronic
1064462305 10:15546824-15546846 AAGGGAGGGAAGGAAAGGGAAGG + Intronic
1065019512 10:21493324-21493346 AAGGGAGGGAAGGAAAATGAAGG - Exonic
1065126898 10:22582702-22582724 AAGGAAGGGAAGGAAAAGGAAGG + Intronic
1065452643 10:25874553-25874575 AGGGAGGGGAAGGATAGGGAAGG + Intergenic
1065474774 10:26122711-26122733 AAGGAGGAGAAGGAGAAGGAGGG - Intronic
1065667869 10:28082446-28082468 AGGAGGAGGAAGGATAAGGAAGG - Intronic
1065791315 10:29263303-29263325 AAGGAAGGGAAGGAAAAGGAAGG + Intergenic
1067346073 10:45440050-45440072 AAGAGGGAGCAGGGCAAGGAGGG + Intronic
1067360631 10:45574932-45574954 ATGGTGGTGCAGGATATGGAAGG - Intronic
1067828624 10:49597344-49597366 GAGGGAGGGCAGGAAAGGGATGG - Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068608829 10:59036071-59036093 AAGCAGGGGAAGGATAAGGGGGG + Intergenic
1069023149 10:63511903-63511925 AAGAAGGGGAAGGAGAAGGAAGG - Intergenic
1069078778 10:64065909-64065931 AGGGGGGGGCAGGGTAAGGAGGG + Intergenic
1069642818 10:69967073-69967095 AGGTGGGGGCAGGACCAGGATGG - Intergenic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1070170727 10:73930873-73930895 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1070199126 10:74186211-74186233 AAGGAGGGGAAGGGAAAGGAAGG - Intronic
1070586878 10:77773008-77773030 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1070893749 10:79964192-79964214 ATGGTGGTGCAGGATATGGAAGG - Intronic
1070939043 10:80327006-80327028 ATGGGGGTGGAGGACAAGGAAGG - Intergenic
1070978719 10:80627469-80627491 AAGAGGGGGCAAGGCAAGGAGGG - Intronic
1071822030 10:89288847-89288869 ATGGTGGTGCAGGATATGGAAGG - Intronic
1072207170 10:93214867-93214889 AAGAAGGGACAGGAGAAGGAGGG - Intergenic
1072211041 10:93247319-93247341 AAGGGAGTACAGGAAAAGGAGGG - Intergenic
1072499077 10:95994188-95994210 GAAAGGGGGCAGGGTAAGGAGGG + Intronic
1072884770 10:99263387-99263409 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1073342849 10:102758761-102758783 ACAAGGGGGCAGGGTAAGGAGGG + Intronic
1073395018 10:103210449-103210471 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1074226854 10:111493431-111493453 AAGGGAAGGGAGGAGAAGGAAGG - Intergenic
1074437610 10:113447313-113447335 AAGCTGGGGCAGAAGAAGGAAGG - Intergenic
1074496590 10:113984777-113984799 CTTGGGGAGCAGGATAAGGAAGG - Intergenic
1075224976 10:120620716-120620738 AAGGCAGGGGAGGATAAGGGTGG - Intergenic
1075886128 10:125900944-125900966 AAAGGGGGGCAGAAAAAGGCTGG - Intronic
1075993045 10:126854124-126854146 GAAAGGGGGCAGGAAAAGGAGGG + Intergenic
1076369821 10:129945107-129945129 AAGGGGGGGGAGGTGAAGGGAGG + Intronic
1076809429 10:132878940-132878962 TAGGAGGAGCAGGACAAGGAGGG + Intronic
1076907037 10:133367941-133367963 ACGAGGGGGCAGGGTGAGGACGG - Intronic
1076933960 10:133555273-133555295 AAGGGGCGGGAGGACAAGGGAGG - Intronic
1077013325 11:389194-389216 ACAAGGGGGCAGGATAAGGAGGG + Intergenic
1077052580 11:574404-574426 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1077522805 11:3046318-3046340 AGAGGGGGGCAGGATTAGGGAGG - Intronic
1077557251 11:3231612-3231634 GAGGAGGGGGAGGAGAAGGAGGG + Intronic
1077701140 11:4443571-4443593 AAGGGGAGGGTGGAGAAGGAAGG + Intergenic
1077701147 11:4443590-4443612 AAGGGGAGGGTGGAGAAGGAAGG + Intergenic
1078566496 11:12418646-12418668 AATGGGGAGCAGAATAAAGATGG - Intronic
1078654263 11:13223492-13223514 AAGGGGGAGCAGGAAAAAGGAGG - Intergenic
1078991242 11:16648372-16648394 AGGTGGGGGCAGGATTAGGTGGG - Intronic
1079230838 11:18647433-18647455 AAAGTGGTGCAGGATATGGAAGG - Intergenic
1079348564 11:19673898-19673920 GAGAAGGGGCAGGAAAAGGAAGG - Intronic
1079360281 11:19765323-19765345 AAGAGGAGGAAGGATGAGGAAGG - Intronic
1079363705 11:19791331-19791353 AGGGGCGGGCTGGATAGGGAAGG - Intronic
1079968824 11:27010772-27010794 GAGGGAGGTCAGGAAAAGGAAGG + Intergenic
1080070929 11:28085638-28085660 ACAAGGGGGCAGGGTAAGGAGGG - Intronic
1080642093 11:34164099-34164121 AAAGCGGGGCTGGATAAGCAGGG - Intronic
1080656817 11:34264823-34264845 AAGTGGGGTCGGGATGAGGAGGG - Intronic
1080994223 11:37580566-37580588 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1081160053 11:39738956-39738978 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1081340269 11:41918510-41918532 AAGGGGGGGCAGGGCCAAGATGG - Intergenic
1081396837 11:42596239-42596261 AAGGCTGGGCAGTAGAAGGAAGG - Intergenic
1081611310 11:44565164-44565186 AGGGCAGGGCAGGATTAGGAAGG + Intronic
1081851029 11:46275452-46275474 AAGGGGTGGCAGGGGGAGGAGGG - Intergenic
1082762098 11:57136929-57136951 AAGGAGGAGGAGGAAAAGGAAGG + Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083102713 11:60326643-60326665 AGGGTGGGGCAGGATATGGGTGG + Intergenic
1083399656 11:62414895-62414917 AAGGGGGCCCAGGCTCAGGAGGG - Intronic
1083575266 11:63786045-63786067 AAGGGAGGGAAGGGAAAGGAAGG + Intergenic
1083782230 11:64924623-64924645 AAGGGGGGGCTGCGTCAGGAAGG - Intronic
1083875525 11:65522010-65522032 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1084452815 11:69250191-69250213 CAGGGGGGACAGGAAATGGATGG - Intergenic
1084701424 11:70788695-70788717 AGGGCTGGGCAGGAGAAGGATGG - Intronic
1084742777 11:71150121-71150143 AAGGGAGGGAAGGGGAAGGAGGG + Intronic
1084884288 11:72193368-72193390 AAGGGGAGGAAGGAAAGGGAGGG + Intronic
1085431548 11:76454927-76454949 AAGGGTGGGCAGTATTAGGAGGG - Intronic
1086133375 11:83422825-83422847 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1086134516 11:83432947-83432969 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1086135962 11:83444236-83444258 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1086658355 11:89385157-89385179 ATGGTGGTGCAGGATATGGAAGG - Intronic
1087167750 11:95021818-95021840 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1087306485 11:96495482-96495504 AAGGAGGAGGAGGAGAAGGAGGG - Intronic
1087701785 11:101443403-101443425 TAGGGAAGGCAGGACAAGGAAGG - Intergenic
1088811133 11:113393451-113393473 GAGGGGGAGCAAGATATGGAAGG - Intronic
1088848057 11:113683974-113683996 AAGTGGGGGCAGGTGAAGGTAGG + Intergenic
1089243152 11:117098471-117098493 AAGGGGGGGCGGGAAAGGGGGGG + Intergenic
1089778441 11:120855998-120856020 CAGGGGGACCAGGAAAAGGAAGG + Intronic
1090405376 11:126473170-126473192 GAGCGGGGGCTGGATTAGGAGGG - Intronic
1092880830 12:12886649-12886671 AAGAGGGGCAAGGATCAGGAAGG - Intergenic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1093171051 12:15861014-15861036 AAGGGTGGGCAGGATTAAGCAGG - Intronic
1093184662 12:16006196-16006218 AAGAGGGGAGAGGGTAAGGAAGG - Intronic
1093235433 12:16604340-16604362 AGGGGGGTGAAGGATAGGGAAGG - Intronic
1093434628 12:19122425-19122447 GAGCGGGGGCAGGGTAGGGAGGG - Intergenic
1094170507 12:27486336-27486358 AAGGGGATGCAGGAGAAGGCTGG - Intronic
1094203581 12:27817386-27817408 AAGGGAGGGAAGAAGAAGGAGGG - Intergenic
1094597570 12:31879125-31879147 AAGGCGGGACAGCTTAAGGAAGG + Intergenic
1095319082 12:40803806-40803828 AAGGGAGGAGAGGAGAAGGAAGG + Intronic
1095468138 12:42509472-42509494 AAGGGTGAGCAGAATAAGGCAGG - Intronic
1095806441 12:46325264-46325286 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1095998700 12:48111448-48111470 ATGGTGGTGCAGGATATGGAAGG + Intronic
1096123377 12:49102997-49103019 AATGGGGGGCATGTTAGGGAAGG - Intronic
1096389563 12:51217980-51218002 AAGGGGGGGAGGGAAAAGGGGGG - Intergenic
1096447620 12:51707983-51708005 AAGGGAGGGCAGGATTAGAATGG - Intronic
1096678849 12:53241755-53241777 AGGGGAGGGCTGGAAAAGGAGGG + Intergenic
1096716291 12:53493337-53493359 ATGCGGGGGCAGGGGAAGGAAGG - Intronic
1096787932 12:54028543-54028565 GCGAGGTGGCAGGATAAGGAAGG - Exonic
1097038214 12:56138101-56138123 AAGCTTGGGCAGGATCAGGAGGG - Intronic
1097613603 12:61857762-61857784 GAGGAGGTGCAGGAGAAGGAGGG - Intronic
1097879118 12:64671188-64671210 AAAGGGAGGCAGGATAGGGGAGG + Intronic
1097973379 12:65659208-65659230 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1098163267 12:67667965-67667987 AAGCTCGTGCAGGATAAGGAGGG + Intergenic
1099293689 12:80803906-80803928 AAGTGGGGTCAGGAAAAGTAAGG + Intronic
1101523021 12:105502589-105502611 AAGGGGGCGCTGTATGAGGAGGG - Intergenic
1101606794 12:106252881-106252903 CATGGGGGACGGGATAAGGAAGG + Intronic
1102248509 12:111369907-111369929 AAGAGGCGGCAGGAACAGGAAGG - Intergenic
1102604830 12:114060390-114060412 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1103134981 12:118499381-118499403 AAGGGAGGGGAGGGGAAGGAGGG - Intergenic
1103289060 12:119828972-119828994 AAGGGGGAGAAGGAAAAGAAAGG + Intronic
1104257934 12:127156125-127156147 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1104795805 12:131516603-131516625 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1104885184 12:132103294-132103316 ACGAGGGGGCAGGGTAAGGAGGG - Intronic
1104913720 12:132252955-132252977 ACGAGGGGGCAGGGTAAGGAGGG + Intronic
1105855567 13:24368871-24368893 CAAGGGAGGCAGGGTAAGGAGGG + Intergenic
1106492158 13:30236061-30236083 AAGGAGGAGAAGGAAAAGGAGGG + Intronic
1106558482 13:30829799-30829821 AAGGGAGAGCAGGATCAGGTTGG + Intergenic
1106916348 13:34519399-34519421 AAGGAGGGGCAGGAAAATGCAGG - Intergenic
1106926098 13:34614787-34614809 AAGGTGGGGCAGAAGAAGGAAGG - Intergenic
1106947049 13:34840232-34840254 AAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1106947069 13:34840330-34840352 AAGGGAGGAGAGGAGAAGGAAGG + Intergenic
1107084230 13:36408187-36408209 AAGGAGGAGAAGGAGAAGGAGGG + Intergenic
1107449450 13:40495452-40495474 GAGGAGGAGCAGGATAAGGATGG - Intergenic
1107482414 13:40795639-40795661 CTGGGGGGACAGGATAGGGAGGG + Intronic
1107953556 13:45486465-45486487 AACATGGGGGAGGATAAGGAAGG - Intronic
1108702989 13:52959474-52959496 AGGGTGGTGCAGGATATGGAAGG + Intergenic
1108790254 13:53961483-53961505 AAGGGAGGGCAGGGGAGGGAAGG - Intergenic
1109353225 13:61209186-61209208 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1110399255 13:75070728-75070750 AATAGGGGGAAGGATAAGCACGG - Intergenic
1110563005 13:76929354-76929376 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1110654125 13:77976545-77976567 GAGTGGGGGCAGGGTAAGAAAGG - Intergenic
1110773688 13:79380465-79380487 AAGGAGGGACAGGGTAAGAAGGG + Intronic
1111086369 13:83380539-83380561 AGGGAGGGGGAGGAGAAGGAAGG - Intergenic
1111108458 13:83675614-83675636 CAAGGGGGGCAGGATAAGGAGGG + Intergenic
1111396346 13:87672929-87672951 AAGGGGAGGGAGGAGAGGGAAGG - Intronic
1112430921 13:99349528-99349550 ACCGGGGGTCAGGGTAAGGAGGG + Intronic
1112505267 13:99971192-99971214 AAGGGGTGGGAGGAAGAGGAGGG + Exonic
1112554754 13:100456549-100456571 ACCAGGGGGCAGGGTAAGGAGGG + Intronic
1112637044 13:101226912-101226934 AGGGAGGGGAAGCATAAGGAAGG - Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1113526926 13:110986756-110986778 AAGGGAGGGAAGGATAAGACAGG - Intergenic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1114618764 14:24082422-24082444 GAGGGGAGGCAGGGCAAGGAAGG - Intronic
1115018535 14:28646398-28646420 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
1115294707 14:31812625-31812647 AAGTGGGTGCAGGCCAAGGAGGG - Intronic
1115659127 14:35474585-35474607 AGGAGGGGGAAGGAGAAGGAGGG - Intergenic
1115704634 14:35986497-35986519 TAGGGGGAGCAGGATGTGGATGG + Intergenic
1115952025 14:38732201-38732223 AAGAGGGGGCAGTCTAAGCATGG + Intergenic
1116416968 14:44689811-44689833 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416974 14:44689826-44689848 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416980 14:44689841-44689863 GAGGAGGGGCAGGAGGAGGAGGG + Intergenic
1116416992 14:44689868-44689890 AAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1116561424 14:46384447-46384469 ACTAGGGGGCAGGGTAAGGAGGG + Intergenic
1116688973 14:48080685-48080707 AGGGAGGGCCAAGATAAGGAGGG - Intergenic
1117174471 14:53132622-53132644 ATGGTGGTGCAGGATATGGAAGG - Intronic
1117602064 14:57386310-57386332 AAAAGGAGGCAGGAAAAGGATGG + Intergenic
1118069937 14:62235366-62235388 GGGTGGGGGGAGGATAAGGAGGG - Intergenic
1118219312 14:63840469-63840491 AAGGGAGGGAGGGAAAAGGAAGG - Intergenic
1118838710 14:69495131-69495153 AAAGAGGGGCAGGGGAAGGAAGG - Intronic
1118925514 14:70187758-70187780 AAGGGGGCGAGGGAGAAGGAGGG - Intronic
1119583361 14:75808315-75808337 AAAGGGGGTCAGGAAAAGCAGGG - Intronic
1119764385 14:77179271-77179293 AGGGGAGGGCAGGAGAGGGAAGG - Intronic
1120255458 14:82113512-82113534 AAGAGGTGGGAGGATAAAGAGGG + Intergenic
1120286141 14:82504530-82504552 AAGGGAGGGCAGAACAAGAAAGG + Intergenic
1121068198 14:90990073-90990095 ATGGGGGGACAAGATAAGGCAGG + Intronic
1121248401 14:92481541-92481563 AAGAGGGGGCAGAACAAGGTTGG - Intronic
1121495645 14:94390013-94390035 GAGGGAGGGCAGCATCAGGAGGG - Intronic
1121611959 14:95287368-95287390 AAGGGCGGGCAGGTTGAGGCAGG - Intronic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1121980316 14:98448804-98448826 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1122010330 14:98741280-98741302 TAGGAGGGGAAGGAAAAGGAAGG + Intergenic
1122100734 14:99407716-99407738 ACAGGAGGGCAGGGTAAGGAGGG - Intronic
1122381050 14:101307328-101307350 ATGGTGGGGCAGGATATGGAAGG + Intergenic
1122439287 14:101718976-101718998 AAGGGAGGGGAGGAGAAGGGAGG + Intergenic
1122507959 14:102244010-102244032 ATGGTGGGGCAGGATATGGAAGG - Intronic
1123068110 14:105628256-105628278 GAGGGGGGGCAGGAGGAGCAGGG - Intergenic
1123092040 14:105746245-105746267 AGTGGGGGGCAGGATGAGCAGGG - Intergenic
1123508061 15:20965737-20965759 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123565280 15:21539478-21539500 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123601543 15:21976762-21976784 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1123895888 15:24829480-24829502 ATGAGGAGGCAGGAGAAGGAAGG + Intronic
1124014596 15:25864227-25864249 AAGGGGTGGGAGAATAAGCACGG + Intronic
1125546903 15:40512604-40512626 ATGTGGGGGCATGTTAAGGATGG - Intergenic
1125617824 15:41031489-41031511 GAGGGGAGGAAGGAGAAGGAAGG + Intronic
1125680662 15:41528200-41528222 AAGGGTGGGCAGGACCAGGCTGG + Intronic
1125750095 15:42022008-42022030 AGGGGAGGGCAGGGCAAGGAAGG - Intronic
1125785770 15:42316380-42316402 CAAGGGGGGCAGGGTAAGGAAGG + Intronic
1127417101 15:58768952-58768974 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1127733635 15:61821980-61822002 AAGGGGAGACAGGACAAGGCGGG - Intergenic
1128391463 15:67185470-67185492 AATGGAGGGCAGGACATGGATGG + Intronic
1128551826 15:68602661-68602683 AAGGGGGGGCAATAAACGGAAGG - Intronic
1128576059 15:68775950-68775972 AAGGGTGAGCAGGCCAAGGAGGG - Intergenic
1128661093 15:69501629-69501651 AAGGGAGGGCAGGAGAAGGTCGG - Intergenic
1129063452 15:72880655-72880677 AAGGGAGGGCAGGGGAAGGGAGG + Intergenic
1129259698 15:74358017-74358039 ATGGTGGTGCAGGATATGGAAGG - Intronic
1129468111 15:75735375-75735397 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1129865248 15:78902466-78902488 ACAAGGGGGCAGGGTAAGGAAGG + Intergenic
1129889133 15:79059328-79059350 AAGGAAGGGAAGGATAGGGAAGG - Intronic
1130000276 15:80039936-80039958 AAGGGGGTGCAGGCTGAGGCAGG - Intergenic
1130011451 15:80155715-80155737 CAAGGGGGGCAGGGTAGGGAGGG + Intronic
1130226044 15:82058992-82059014 GAGGGGGAGGAGGAGAAGGAGGG - Intergenic
1130276147 15:82477338-82477360 GCGGGGGGGCAGGACAAGGCAGG - Intergenic
1130430366 15:83841658-83841680 GAGGGGGGGCAGGAAATTGAAGG + Intronic
1130495758 15:84468811-84468833 GCGGGGGGGCAGGACAAGGCAGG + Intergenic
1130748916 15:86688273-86688295 AAGGGTGGGGAGGACAAGGGAGG + Intronic
1130825577 15:87542058-87542080 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1130927487 15:88396441-88396463 GAGGAGGAGCAGGAAAAGGAAGG - Intergenic
1131117088 15:89802293-89802315 AAGTTGGGGCAGGGCAAGGAAGG + Intronic
1131689317 15:94809434-94809456 AAGGGGGTGAAGGAGAAGGAAGG + Intergenic
1132078620 15:98845453-98845475 AGGAGGGGGCAGGAGAAGGAAGG - Intronic
1132112154 15:99109481-99109503 AAGGTGGGGTGGGATTAGGATGG + Intronic
1132337947 15:101060871-101060893 AGGGGCGGGCAGGATATGGCCGG + Intronic
1132399460 15:101496556-101496578 AAGGGGCGGCAGGGGCAGGAAGG - Intronic
1202973651 15_KI270727v1_random:266585-266607 AAAGGGGAGCAGGATGAGTAAGG - Intergenic
1132702585 16:1228451-1228473 AAGGGGGCTCAGGATGGGGAAGG + Exonic
1132705742 16:1242417-1242439 AAGGGGGCTCAGGATAGGGAAGG - Exonic
1133964359 16:10519703-10519725 AGGGGAGGGCAGGAGAAGGAAGG - Intergenic
1134523307 16:14928076-14928098 AAGGGGGGAGAGGAGAGGGAAGG - Intronic
1134710904 16:16326560-16326582 AAGGGGGGAGAGGAGAGGGAAGG - Intergenic
1134948680 16:18342049-18342071 AAGGGGGGAGAGGAGAGGGAAGG + Intergenic
1135025123 16:18993747-18993769 ATGGTGGTGCAGGATATGGAAGG + Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1136123251 16:28155812-28155834 AAGGGAGGACAGGAGATGGATGG + Intronic
1136530253 16:30863381-30863403 ATGGTGGTGCAGGATATGGAAGG - Intronic
1136711816 16:32243698-32243720 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1136736680 16:32473601-32473623 AAGGGAGGGCAGGGGAAGGGAGG - Intergenic
1136756100 16:32685709-32685731 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1136812013 16:33184664-33184686 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1136818489 16:33294744-33294766 ACAAGGGGGCAGGGTAAGGAGGG - Intronic
1136825053 16:33351277-33351299 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1136830119 16:33450048-33450070 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1137589930 16:49687223-49687245 GAGAGAGGGCAGGACAAGGAAGG - Intronic
1137655491 16:50154459-50154481 AAGGGAGGACAGGAGACGGAGGG - Intronic
1137767832 16:50991511-50991533 AGAGGGGGGCAGGAGAGGGAAGG + Intergenic
1137896359 16:52216946-52216968 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1138105210 16:54284320-54284342 AAGCGGGGGAAGAAAAAGGAGGG + Intronic
1138111862 16:54330411-54330433 AAGAGGGGGTAGGAGAAGCAAGG - Intergenic
1138580769 16:57939311-57939333 AATGGGGGGAAGGAGATGGAGGG + Intronic
1139614332 16:68079902-68079924 AAGCGGGGGCAGGACAGGGCAGG - Intergenic
1139645601 16:68327471-68327493 AGGTGGGGCCAGGATAGGGAAGG + Intronic
1139711568 16:68780262-68780284 ACAGGGAGGAAGGATAAGGAGGG - Intronic
1140541478 16:75760250-75760272 AAGGGAGGGAAGGGAAAGGAAGG - Intronic
1140761362 16:78111943-78111965 ACAAGGGGGCAGGGTAAGGAGGG - Intronic
1140847567 16:78904956-78904978 ATTGGGAGGTAGGATAAGGATGG - Intronic
1141137231 16:81474332-81474354 AAGAGGGTGCAGGAGAAAGAAGG - Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1142390388 16:89796035-89796057 AAGAGGGGTCAGGAAAGGGAGGG + Intronic
1202990591 16_KI270728v1_random:7634-7656 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1203016388 16_KI270728v1_random:355976-355998 AAGGGAGGGCAGGGGAAGGGAGG + Intergenic
1203034723 16_KI270728v1_random:629134-629156 AAGGGAGGGCAGGGGAAGGGAGG + Intergenic
1203058238 16_KI270728v1_random:946061-946083 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1142958257 17:3535490-3535512 AAGGGAGGGAAGGGGAAGGAGGG - Intronic
1143021242 17:3918100-3918122 AAGGGAGGGAGGGAGAAGGAAGG + Intergenic
1143305941 17:5946797-5946819 AAGGGTGGAGAGGAGAAGGATGG + Intronic
1143452937 17:7046948-7046970 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1143499949 17:7332759-7332781 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1144626936 17:16848790-16848812 GTGGGGGGGCAGGGGAAGGAAGG - Intergenic
1144879503 17:18423922-18423944 GTGGGGGGGCAGGGGAAGGAAGG + Intergenic
1145080390 17:19890148-19890170 ATGGTGGTGCAGGATACGGAAGG + Intergenic
1145152737 17:20520465-20520487 GTGGGGGGGCAGGGGAAGGAAGG - Intergenic
1145247490 17:21279084-21279106 AAGTGTGGGCAGGAAAAGGCAGG + Intergenic
1145248683 17:21285619-21285641 GAGGGGTGGGAGGACAAGGAAGG - Intronic
1145986193 17:29048568-29048590 AAGGCGGGGCAGGAAAGAGATGG - Intronic
1146640940 17:34541146-34541168 TAGTGGGGGCAGGAGAAGGCAGG - Intergenic
1146987336 17:37232856-37232878 GAGGAGGAGGAGGATAAGGACGG - Intronic
1147053939 17:37819431-37819453 AAGGGTGGGCAGGATTTAGAAGG + Intergenic
1147363401 17:39945039-39945061 GTGGGGGGGCAGGTTGAGGAGGG + Intergenic
1147675564 17:42202671-42202693 AAGCTGGGCCAGGATAAGGATGG + Intronic
1147844718 17:43396918-43396940 GAGGGTGGGCAGGAAAAGGCTGG + Intergenic
1147991629 17:44337371-44337393 CAAGGGGGGCAGGGTAAGGAGGG + Intergenic
1148027703 17:44600029-44600051 AAGTGGGGGCAGGAGAGGGGAGG - Intergenic
1148057978 17:44813051-44813073 AAGGGAGGAAAGGAGAAGGAAGG - Intronic
1148552666 17:48559867-48559889 AAGGGGTGGCAGGACAAAAAGGG + Intronic
1148673652 17:49432158-49432180 AAGGGAAGGCAGCATCAGGAAGG - Intronic
1148781316 17:50123666-50123688 GAGGGGGAGGAGGATAGGGAAGG - Intronic
1149965586 17:61160761-61160783 AAGCGGGGGTTGGGTAAGGAAGG + Intronic
1150137998 17:62706270-62706292 GAGGGAGGGCAGGGGAAGGATGG + Intronic
1150153950 17:62834908-62834930 AAAGGGGGGGAAGAAAAGGAGGG + Intergenic
1151052662 17:70996068-70996090 AAGGTGGAGGAGGAGAAGGAAGG - Intergenic
1151503058 17:74504748-74504770 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1151549411 17:74813447-74813469 AAGGGGAGACAGGAGAATGAGGG - Intronic
1151878641 17:76881473-76881495 GAGGCCGGGCAGGAGAAGGAGGG + Intronic
1152055582 17:78023400-78023422 GAGGAGGAGCAGGAGAAGGAAGG - Intronic
1152242532 17:79167915-79167937 AGGAGGGGGCAGGACAAAGATGG + Intronic
1152315945 17:79580260-79580282 ATGGGGGGGGAGGAGGAGGACGG - Intergenic
1152745934 17:82039256-82039278 CAAGGAGGGCAGGGTAAGGAGGG - Intergenic
1152838417 17:82550366-82550388 AAGGGGGTGCAGGAGCAAGATGG + Intronic
1152928366 17:83098202-83098224 AAGTGGGGGCCGGAAAAGTAGGG - Intergenic
1153104037 18:1507415-1507437 ATGGGAGGGAGGGATAAGGAGGG - Intergenic
1153478090 18:5518430-5518452 AAGTGGGGCAAGGATCAGGAAGG - Intronic
1153881366 18:9424425-9424447 ACGGTGGTGCAGGATATGGAAGG + Intergenic
1154485232 18:14867311-14867333 GAGGGGGGGCAGGTTAGGGGTGG + Intergenic
1155382524 18:25239780-25239802 AGGAGGGGGGAGGAGAAGGAGGG + Intronic
1155451540 18:25968947-25968969 GAGGAGGGGCAGGATAATGCTGG - Intergenic
1155510913 18:26575791-26575813 TAGGGAGGGCAGGATGAGTAAGG - Intronic
1155570202 18:27184849-27184871 GAGGGGGCGCTGGAGAAGGACGG - Intronic
1156290694 18:35747065-35747087 AAGGCTGGGCAGGGTAAGGCAGG - Intergenic
1156501646 18:37563906-37563928 AAGGGAGGGCTGGAGAAAGAGGG + Intronic
1156916115 18:42465796-42465818 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1157214998 18:45775334-45775356 AATGGGGGGAAGGAGAAGGGCGG + Intergenic
1157470271 18:47983141-47983163 AAGGGGGGGAAGGAAAGGGGAGG - Intergenic
1157573464 18:48729060-48729082 AGGGGAGGACAGGATGAGGAGGG - Intronic
1157589410 18:48827395-48827417 AAGCGTGGGCAGGAGAGGGAAGG + Intronic
1158346624 18:56522829-56522851 AAGGGAGGACAGAAGAAGGAAGG - Intergenic
1158383801 18:56966286-56966308 AAGAGGGGGCAGGAGAGGCAAGG - Intronic
1158423128 18:57313513-57313535 AAAGGAGAGCAGGAGAAGGAAGG + Intergenic
1158427372 18:57352363-57352385 GAGGGGGTGCAGGAGAGGGAGGG - Exonic
1158602233 18:58864532-58864554 AAGTGGGGGAAGGAGAAGGAGGG + Intronic
1159301000 18:66567359-66567381 AAGGGGGAGGAGGAGAGGGAGGG + Intronic
1159680380 18:71343002-71343024 GAGGGAGGGGAGGAAAAGGAAGG - Intergenic
1159875664 18:73808225-73808247 AAGTGGGGGCAGGAGAACCAGGG - Intergenic
1159950337 18:74478298-74478320 AGGTGGGGGCAGGAGCAGGAAGG - Intergenic
1160293558 18:77617230-77617252 AAGGGGAGACAGGATCAGCAAGG + Intergenic
1160592295 18:79951407-79951429 AAGGGGGCGCAGGCCCAGGATGG + Intronic
1160785966 19:900446-900468 ATGTGGGGGCAGGATCTGGATGG - Intronic
1160786020 19:900613-900635 GATGGGGGGCAGGATATGGATGG - Intronic
1160786065 19:900729-900751 ATGGGGGGGCAGGATATGGATGG - Intronic
1161100250 19:2418258-2418280 AAAGGAGGGAAGGACAAGGAGGG - Intronic
1161100273 19:2418325-2418347 AAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100489 19:2418894-2418916 AAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161100509 19:2418949-2418971 AAGGGAGGGAAGGAAAGGGAGGG - Intronic
1161258889 19:3324701-3324723 AAGGGAGGGCAGGGAGAGGATGG - Intergenic
1161431112 19:4233022-4233044 AAGGAGAGGCAGGAACAGGAGGG - Intronic
1161562832 19:4983319-4983341 AGGCGGGGGCAGGATTGGGAGGG - Intronic
1161870975 19:6869723-6869745 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1161951489 19:7470325-7470347 AAGGGTGGGCAGGGCAGGGAGGG - Intronic
1162024183 19:7884495-7884517 GAGGAGGGGGAGGAGAAGGAAGG + Intergenic
1162076586 19:8191965-8191987 AAGGAGGAGGAGGAGAAGGAGGG + Intronic
1162185060 19:8898333-8898355 AGGGAGGGGCAGGGAAAGGAGGG + Intronic
1162185873 19:8904383-8904405 AGGGAGGGGCAGGCAAAGGAGGG + Intronic
1162186246 19:8907198-8907220 AGGGAGGGGCAGGGAAAGGAGGG + Intronic
1162292469 19:9790511-9790533 ACAAGGGGGCAGGGTAAGGAGGG + Intronic
1162336142 19:10061743-10061765 AAGAGAGGGCAGGTTAAGGTGGG + Intergenic
1162467138 19:10849075-10849097 GAGGGAGGGCAGGAGAAGGAAGG - Intronic
1163463092 19:17450740-17450762 AAGGAGGAGGAGGAGAAGGAAGG - Intronic
1164003691 19:21130557-21130579 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1164202196 19:23028174-23028196 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1164429152 19:28171872-28171894 AAGTGGGGGAAGGATAAAGAGGG - Intergenic
1164501329 19:28822913-28822935 AAGGCTGGTCAGGAAAAGGATGG - Intergenic
1164591879 19:29511931-29511953 AAGGAGAGGGAGGATGAGGAAGG + Intergenic
1165249472 19:34517706-34517728 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1165419612 19:35716442-35716464 AAGGGGAGGCCGGTGAAGGAAGG - Intronic
1165852750 19:38859706-38859728 CAAGGGGGGCAGGGTAAGGAGGG + Intergenic
1166161778 19:40959451-40959473 AAGGAGGGGAAGGAGAGGGAGGG - Intergenic
1166514669 19:43437546-43437568 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1166750077 19:45160358-45160380 AGTGAGGGGCAGGATAAGGAGGG + Intronic
1166759519 19:45215891-45215913 CAGCGGCGGCAGGAGAAGGAGGG + Intronic
1166863158 19:45821211-45821233 AAGAGGAGGCAAGAAAAGGAGGG + Intronic
1167314089 19:48753716-48753738 AAGGGGGGGCAGGATAAGGAGGG + Intronic
1167554191 19:50183043-50183065 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1167725754 19:51211758-51211780 ACGGGGATGCAGGATCAGGAAGG - Intergenic
1167744599 19:51343075-51343097 ATGGGCGGGCAGGATAAGAATGG - Intergenic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1167869983 19:52360231-52360253 AATGGAGGGCAGGAAAAGGTTGG + Intronic
1167895611 19:52578406-52578428 ACAAGGGGGCAGGGTAAGGAGGG - Intronic
1167927713 19:52834922-52834944 ACAAGGGGGCAGGGTAAGGAGGG + Intronic
1168357719 19:55712862-55712884 AAGGAGGGGGAGGAGGAGGAGGG + Intronic
1168433875 19:56302563-56302585 AAGGGGGAGGAAGAAAAGGAAGG - Intronic
1168726411 19:58584959-58584981 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925079617 2:1053795-1053817 AATGGAGGAAAGGATAAGGAAGG - Intronic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925380739 2:3423960-3423982 AAGGGGCCACAGGCTAAGGAAGG - Intronic
925433551 2:3817349-3817371 ATGGTGGTGCAGGATATGGAAGG + Intronic
926803395 2:16682619-16682641 AAGAGTGGGCAGGTTGAGGAGGG + Intergenic
927088170 2:19690517-19690539 AAGGGAGGGGAGGGAAAGGAAGG + Intergenic
927134435 2:20086399-20086421 ATGGTGGTGCAGGATATGGAAGG - Intergenic
927275346 2:21257771-21257793 AAGGGAGGACAGAAAAAGGAAGG - Intergenic
927520154 2:23693618-23693640 TAGGGAGAGCAGGACAAGGAAGG - Intronic
927566624 2:24119179-24119201 TAGGTGGGGCAGGATAGGGGAGG - Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928781160 2:34822375-34822397 AAGGGGGGACTTGATATGGAAGG - Intergenic
928921691 2:36534203-36534225 AAGGATGGGAAAGATAAGGAAGG + Intronic
929577403 2:43060678-43060700 AAGGTGGGTCAGGATAAGGTAGG + Intergenic
929684202 2:44020365-44020387 ATGGTGGTGCAAGATAAGGAAGG + Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
930098714 2:47586801-47586823 ATGGTGGTGCAGGATACGGAAGG + Intergenic
930182645 2:48379325-48379347 AGGGTGGGACAGGAGAAGGATGG + Intergenic
930426737 2:51222433-51222455 ATGGTGAGGCAGGATAAGTAAGG - Intergenic
930706406 2:54508944-54508966 ATGGTGGTGCAGGATATGGAAGG + Intronic
931085269 2:58823221-58823243 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
931720885 2:65067086-65067108 AAGGGAGGGAAGGATAAGCCTGG + Intronic
932159162 2:69445106-69445128 ATGGTGGTGCAGGATATGGAAGG + Intergenic
932345118 2:70990375-70990397 ACCTGGGGGCAGGATGAGGAGGG - Intronic
932345788 2:70994529-70994551 CAGGAGGGGCAGGATCAGGCGGG + Intronic
932740109 2:74284751-74284773 AGGGAGGGGCAGGGTAAGAATGG - Intronic
932851869 2:75195375-75195397 AAGGGAAGGTAGGAGAAGGAGGG - Intronic
933138234 2:78762045-78762067 ATGGTGGTGCAGGATATGGAAGG - Intergenic
933179500 2:79213374-79213396 ATGGTGGTGCAGGATATGGAAGG + Intronic
933997525 2:87680525-87680547 AAGGGAGGGGAGGAGAAGGGAGG + Intergenic
934089166 2:88536185-88536207 AAGGGAAGGGAGGAAAAGGAAGG + Intergenic
934136309 2:88999460-88999482 CAAGGGGGGCAGGGTAAGGAGGG + Intergenic
934511345 2:94946820-94946842 AAGTGGGGGAAGGAAAAAGAGGG - Intergenic
934792061 2:97069906-97069928 AAGGAGGGGCAGCCGAAGGAAGG + Intergenic
934814558 2:97313804-97313826 AAGGAGGGGCAGCCGAAGGAAGG - Intergenic
934823136 2:97394679-97394701 AAGGAGGGGCAGCTGAAGGAAGG + Intergenic
935065296 2:99642135-99642157 ATGAGGGGGCAGGAGAGGGAGGG + Intronic
935269736 2:101423623-101423645 AAGACTGGGCAGGCTAAGGATGG - Intronic
935300840 2:101692799-101692821 AAAATGGGGCAGGGTAAGGAGGG - Intergenic
935620566 2:105126096-105126118 AAGGCGGGCCAGGATGTGGAGGG - Intergenic
936140835 2:109938775-109938797 AAGTGGGGGCAGGGTTAGGTGGG - Intergenic
936177526 2:110236720-110236742 AAGTGGGGGCAGGGTTAGGTGGG - Intergenic
936203858 2:110432711-110432733 AAGTGGGGGCAGGGTTAGGTGGG + Intronic
936296327 2:111270387-111270409 AAGGGAGGGGAGGAGAAGGGAGG - Intergenic
936485912 2:112925576-112925598 AAGGGTGGGCAGGGCAAGGCAGG + Intergenic
936496560 2:113027281-113027303 AGGGGGAGGCAGGAGAAGCAGGG + Intronic
936889434 2:117351640-117351662 ATGGTTGTGCAGGATAAGGATGG + Intergenic
936991863 2:118375104-118375126 CTGGTGGGGCAGGAAAAGGAAGG - Intergenic
937025357 2:118692982-118693004 GAGCGGGGGCAGGAGAAGGAAGG + Intergenic
937969413 2:127537723-127537745 AAGGAGGAGGAGGAGAAGGAAGG + Intronic
938421528 2:131151236-131151258 AAGGGGGAGCAGGACAACCAGGG - Intronic
938783237 2:134603877-134603899 AAGGGAGGGGAGGGTATGGAAGG + Intronic
938900879 2:135797621-135797643 AAGGGGCGGGCGGGTAAGGAAGG + Intronic
939003049 2:136758235-136758257 AAGGTGGGGCCAGATTAGGAAGG + Intergenic
939460459 2:142491376-142491398 ATGGTGGTGCAGGATATGGAAGG + Intergenic
939766165 2:146252232-146252254 AGGGGAGGGGAGGAGAAGGAAGG + Intergenic
940183251 2:150957230-150957252 ATGGTGGTGCAGGATATGGAAGG - Intergenic
941117484 2:161488555-161488577 AAGGGGGGGAAGGAGAAGGAAGG - Intronic
941327478 2:164134799-164134821 AAGAGGGAGCAGGGTAAGGAAGG + Intergenic
941455854 2:165711652-165711674 ATGGTGGTGCAGGATATGGAAGG + Intergenic
941750902 2:169134725-169134747 ATGGTGGTGCAGGATATGGAAGG - Intronic
941768051 2:169319862-169319884 AATGGGAGGAAGGGTAAGGATGG - Intronic
942189945 2:173459384-173459406 GAGGGGGGGCTGGAAAAGAAAGG - Intergenic
942289449 2:174454729-174454751 AAGGGAAGGAAGGAAAAGGAAGG + Intronic
944188693 2:196978266-196978288 AAGGGGGAGCAGGAGAGAGAGGG - Intronic
944433762 2:199665094-199665116 AAGGAAGGAGAGGATAAGGAAGG - Intergenic
945163768 2:206920595-206920617 AAGGGTGGGCTGGAAGAGGAAGG + Intergenic
945190304 2:207180760-207180782 AAGGAGGGGCAGTGGAAGGAAGG - Intergenic
945554986 2:211265621-211265643 ATGGTGGTGCAGGATATGGAAGG - Intergenic
945588351 2:211696035-211696057 GAGGGGGGGAAGGGGAAGGAGGG - Intronic
945858463 2:215094143-215094165 ATGGTGGTGCAGGATATGGAAGG - Intronic
946070435 2:217030113-217030135 AAGAAGGGCCAGGATAAGGTGGG + Intergenic
946446908 2:219747907-219747929 AGGGGAGGGCAGGGAAAGGAAGG - Intergenic
946871442 2:224089174-224089196 ATGGTGGTGCAGGATATGGAAGG + Intergenic
947557715 2:231111273-231111295 GAGGGGTAGCAGGACAAGGAAGG - Intronic
947598804 2:231431789-231431811 ATGGTGGAGCAGGATATGGAAGG + Intergenic
948305143 2:236940960-236940982 AAGGTGGGGCTGGATAAAGTAGG - Intergenic
948446411 2:238036904-238036926 AAGGTGTGGAAGGATAAGGTGGG - Intronic
949023747 2:241755367-241755389 AGGGTGGGGCAGGGTAGGGAAGG - Intronic
949027290 2:241772240-241772262 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1168761862 20:354803-354825 GAAGGGGTGCAGGATGAGGAGGG - Exonic
1168897652 20:1334812-1334834 AAAAGGGGGCAAGAGAAGGAAGG + Intronic
1168942993 20:1729289-1729311 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1170680123 20:18518919-18518941 ATGGTGGTGCAGGATATGGAAGG + Intronic
1171210027 20:23309829-23309851 GTGAGGGGGCAGGAGAAGGAGGG - Intergenic
1171299003 20:24043033-24043055 CACGAGGGGCAGGAGAAGGAGGG + Intergenic
1171321452 20:24248040-24248062 AAAGGAGGGCAGGGGAAGGAGGG - Intergenic
1171358035 20:24565744-24565766 AAGCGGGGGAAGGAGAAGGTGGG - Intronic
1172006017 20:31819638-31819660 AAGCTGGGGCAGGAGATGGAGGG + Intronic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172580688 20:36044984-36045006 AAGGAGGGGCAGCAAAAGAAAGG + Intergenic
1173174299 20:40752756-40752778 AAGGGGAGGAAGGTTAAGGTGGG - Intergenic
1173438889 20:43057431-43057453 GAGGGGAGGAAGGAAAAGGAGGG + Intronic
1173652385 20:44674925-44674947 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1173801916 20:45899437-45899459 GAGTGGGGGCAGGATGGGGAAGG - Intronic
1174062749 20:47844085-47844107 AGGGGAGGGGAGGAGAAGGAAGG + Intergenic
1174723599 20:52838924-52838946 AAGGGAGGGGAGGAGAGGGAAGG - Intergenic
1175425504 20:58862848-58862870 AAGGGGGAGCTGGATAGGCAGGG - Intronic
1175531070 20:59674580-59674602 AAGCGGGGACAGGAGAAGGGGGG - Intronic
1175531080 20:59674611-59674633 AAGCGGGGACAGGAGAAGGGGGG - Intronic
1175531102 20:59674692-59674714 AAGGGGGGACAGGAGAAGGCAGG - Intronic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175531161 20:59674901-59674923 AAGGGGGGATAGGAGAAGGCAGG - Intronic
1175664125 20:60843753-60843775 ACGGGAGGGCAGGAGAAGGGAGG + Intergenic
1176221475 20:63971056-63971078 AAGGGAGGGGAGGAGAAGGGAGG - Intronic
1177173235 21:17676740-17676762 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1177282140 21:18994472-18994494 AAGGGGGAGGAGGAGGAGGAAGG + Intergenic
1178606126 21:34037526-34037548 AGTGGGAGGCAGGAAAAGGATGG - Intergenic
1179014936 21:37588257-37588279 ATGGTGGTGCAGGATATGGATGG + Intergenic
1179094925 21:38305177-38305199 AATTGGGTGCAAGATAAGGAGGG - Exonic
1179275945 21:39891673-39891695 ACAAGGGGGCAGGGTAAGGAGGG + Intronic
1179855150 21:44159483-44159505 CATGGGGGGCAGGTTAAGGGAGG - Intergenic
1179970279 21:44833102-44833124 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1180535871 22:16392318-16392340 AAGGGAGGGCAGGGGAAGGGAGG + Intergenic
1181018160 22:20083187-20083209 AAGGGGAGGCAGTTTTAGGAAGG - Intronic
1181485197 22:23226068-23226090 AGGGTGGGGCAGGATAGGGTGGG + Intronic
1182741710 22:32572463-32572485 AAGGGAGGGAAGGAGAAAGAAGG - Intronic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1183627379 22:39012932-39012954 CAAGGGGGGCAGGGTAAGGAGGG + Intergenic
1184037028 22:41923136-41923158 CAGGAGGGGCAGGAGAAGCAGGG + Intergenic
1184081745 22:42226180-42226202 AAAAGGGGGCAGGAGAAGGGTGG + Intronic
1184133465 22:42531899-42531921 CAAGGGGAGCAGGGTAAGGAGGG - Intergenic
1184369247 22:44072194-44072216 AAAGGGGGACAGGGTAGGGAGGG - Intronic
1185052677 22:48562094-48562116 GAGGGGGCTTAGGATAAGGAGGG - Intronic
1185061867 22:48611296-48611318 AAAGGGGAGCAGGTGAAGGAAGG - Intronic
1185394453 22:50579511-50579533 GGGGGAGGGCAGGAAAAGGAGGG + Intronic
950584715 3:13883955-13883977 CAGGGTAGACAGGATAAGGAAGG + Intergenic
950942000 3:16902134-16902156 AGGAGGGGGCAGGATAAGACAGG - Intronic
952169501 3:30791422-30791444 AAGTGGAGGCAGGCTCAGGAAGG - Intronic
952297216 3:32072133-32072155 ATGGTGGTGCAGGATATGGAAGG - Intronic
952343296 3:32462990-32463012 ATGGAGGTGCAGGATATGGAAGG + Intronic
952792132 3:37208228-37208250 ATGGTGGTGCAGGATATGGAAGG - Intergenic
952912521 3:38203287-38203309 CAAGGGGGGCAGGGTAAGGAGGG - Intronic
952998705 3:38910002-38910024 TAGAGGGGGAAGGAAAAGGATGG + Intronic
953656219 3:44856840-44856862 ATGGTGGTGCAGGATATGGAAGG + Intronic
953917646 3:46930819-46930841 AAGGGGGCCCAGGAGAAGGGCGG - Intronic
954161443 3:48725638-48725660 ATGGTGGTGCAGGATATGGAAGG + Intronic
954182250 3:48890628-48890650 ACAAGGGGGCAGGGTAAGGAGGG - Intronic
954542140 3:51400632-51400654 AGGTGGGGAAAGGATAAGGAAGG - Intronic
954656119 3:52195278-52195300 AAGGGAGGGAGGGAGAAGGAGGG + Intergenic
956233233 3:67040313-67040335 ATGGTGGTGCAGGATATGGAAGG + Intergenic
958154594 3:89740352-89740374 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
959388886 3:105748439-105748461 TGGGGGTAGCAGGATAAGGACGG - Intronic
959850107 3:111075325-111075347 AAGGGAGGGAAGGACAGGGAAGG - Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961111236 3:124285028-124285050 TAGGGGTAGCAGGAGAAGGAGGG + Intronic
961352621 3:126313668-126313690 TAGGGAGGGCAGGAGAAGGTGGG - Intergenic
961566002 3:127763718-127763740 AAGGGGCGGGAGGGGAAGGAAGG - Intronic
962145267 3:132833631-132833653 GGGGCAGGGCAGGATAAGGATGG + Intergenic
962523643 3:136219264-136219286 ATGGTGGTGCAGGATATGGAAGG + Intergenic
962769698 3:138600923-138600945 GAGGGGGAGGAGGAGAAGGAGGG + Intergenic
963111585 3:141693150-141693172 ATGGTGGTGCAGGATATGGAAGG + Intergenic
963326934 3:143873681-143873703 CAATGGGGGCAGGGTAAGGAGGG + Intergenic
963711817 3:148755212-148755234 ATGGGGGAGCAGGAGAAGAAAGG - Intergenic
963858943 3:150286742-150286764 AAGGGGGAGTAGGTTAAAGATGG + Intergenic
963861611 3:150316204-150316226 AAGTGAGGGCAGGATGAGTATGG - Intergenic
964374419 3:156035537-156035559 AAGGAGGGGGAGGAAGAGGAAGG - Intergenic
965335441 3:167427151-167427173 ATGGTGGTGCAGGATATGGAAGG - Intergenic
965861672 3:173157284-173157306 ATGGTGGTGCAGGATATGGAAGG + Intergenic
965885276 3:173437858-173437880 TAGGGAAGGCAGGATCAGGAAGG - Intronic
965947288 3:174258851-174258873 AAGGGAAGGGAGGAAAAGGAAGG + Intronic
966279620 3:178211918-178211940 ATGGTGGTGCAGGATATGGAAGG - Intergenic
966397331 3:179517046-179517068 ATGGTGGTGCAGGATATGGAAGG + Intergenic
966559203 3:181300120-181300142 AAGGGGAGGGAGGAGAAGAAGGG + Intergenic
967555119 3:190847764-190847786 AATGGGGGGAAGGGTTAGGAGGG + Intergenic
967662146 3:192125753-192125775 AAGGGAGGAGAGGAGAAGGAGGG + Intergenic
968222515 3:196948938-196948960 AAGGGAGGGGAGGGGAAGGAAGG - Intronic
969356342 4:6628876-6628898 AAGGGAGGGGAGGAAAGGGAAGG + Intergenic
969525487 4:7701974-7701996 CATGTGGGGCGGGATAAGGAAGG - Intronic
969602249 4:8183228-8183250 AACGAGGGGGAGGATGAGGACGG - Intronic
970038147 4:11763579-11763601 AAGGGAGGGGAGGAGAGGGAAGG - Intergenic
970301314 4:14684137-14684159 AAGAGGGGGAAGAAAAAGGAGGG + Intergenic
970471403 4:16382806-16382828 GAGGGAGGGAAGGAGAAGGAAGG - Intergenic
971251292 4:24975413-24975435 AGGGGAGGGAAGGAGAAGGAAGG + Intronic
971251427 4:24976019-24976041 AAGGGAGGGAAGGAGAGGGAGGG + Intronic
971296408 4:25397365-25397387 GAGGGGTGGGAGGCTAAGGAAGG - Intronic
971311578 4:25529942-25529964 AAGGGAGGGGAGGAAAGGGAAGG + Intergenic
971553188 4:27979493-27979515 ATGGTGGTGCAGGATATGGAAGG - Intergenic
972804422 4:42513520-42513542 GAGGTGGGGAAGGATAAGGGAGG + Intronic
973266841 4:48219731-48219753 ACAAGGGGGCAGGGTAAGGAAGG - Intronic
973544380 4:51966162-51966184 GAGGGAGGGAAGGAGAAGGAAGG - Intergenic
973751397 4:54023821-54023843 ACGGTGGTGCAGGATATGGAAGG - Intronic
973960891 4:56108647-56108669 CAAGGGGGGCAGGGTAAGGAGGG + Intergenic
973971606 4:56218571-56218593 AAGGGAGGGGAGGGGAAGGAGGG - Intronic
974333563 4:60510430-60510452 AAGGGAGGGAAGGGAAAGGAAGG + Intergenic
975130717 4:70830094-70830116 AAAGGGGGGAAGAATAAGTAAGG + Intronic
975152401 4:71035549-71035571 ATGGTGGTGCAGGATATGGAAGG - Intergenic
975642184 4:76511823-76511845 CAGGTGGGGCTGGAAAAGGATGG + Intronic
976132299 4:81897551-81897573 AAGGGGGGAGAGGAGGAGGAAGG - Intronic
976254462 4:83085493-83085515 ACCAGGGGGCAGGGTAAGGAGGG - Intergenic
977782172 4:100993401-100993423 ATGGTGGTGCAGGATATGGAAGG + Intergenic
978776894 4:112514568-112514590 AAGGAGGGGCAGGGGAAGGGAGG + Exonic
979700244 4:123658744-123658766 CAGAGGGGGAAGGATGAGGAGGG + Intergenic
980302383 4:131011395-131011417 ATGGTGGTGCAGGATATGGAAGG - Intergenic
980480744 4:133384711-133384733 AAGGGTGGGAAGGAAAAGCAGGG - Intergenic
981124218 4:141087415-141087437 AAGGAGAGGCTGGATAAAGATGG - Intronic
981482620 4:145254347-145254369 ATGGTGGTGCAGGATATGGAAGG + Intergenic
981923898 4:150117065-150117087 AGGTGGGGGCTGGATAAGGCAGG + Intronic
982319145 4:154060829-154060851 ATGGTGGTGCAGGATATGGAAGG - Intergenic
982395082 4:154907484-154907506 CAAGGGGGGCAGGGTAAGGAGGG + Intergenic
982719985 4:158849292-158849314 GAGGGGGAGCAGGAGAAAGAAGG + Intronic
983503134 4:168523238-168523260 AGGGGAGGGGAGGGTAAGGAAGG + Intronic
983595127 4:169457693-169457715 AAGGGGGGAGGGGAGAAGGAGGG + Intronic
983883443 4:172957692-172957714 ATGGTGGTGCAGGATATGGAAGG + Intronic
983919718 4:173333480-173333502 AAGGTGAGGCAGGAGAGGGACGG - Exonic
984412040 4:179407545-179407567 ATGGTGGTGCAGGATATGGAAGG - Intergenic
984437579 4:179724830-179724852 ATGGTGGTGCAGGATATGGAAGG - Intergenic
984614280 4:181878320-181878342 ATGAGGGGGCAGGAAAAGGAAGG + Intergenic
984703172 4:182831886-182831908 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703183 4:182831917-182831939 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703194 4:182831948-182831970 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703225 4:182832043-182832065 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703236 4:182832074-182832096 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703247 4:182832105-182832127 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703258 4:182832136-182832158 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703269 4:182832167-182832189 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703280 4:182832198-182832220 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703296 4:182832245-182832267 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984703307 4:182832276-182832298 AAGGGGGGAGAGGAGAAGGAGGG - Intergenic
984822042 4:183890512-183890534 AAAGAGGGACAGGAAAAGGAGGG + Intronic
986206192 5:5627469-5627491 ACGGAGGGGCAGGAACAGGAGGG + Intergenic
986240447 5:5955199-5955221 AAAGGAGGGAAGGAGAAGGAGGG - Intergenic
986512530 5:8523395-8523417 TAGGGTCTGCAGGATAAGGAAGG + Intergenic
986969527 5:13315920-13315942 AAAGGGGGGGAGGGTAGGGATGG - Intergenic
987258379 5:16179839-16179861 AAGGGGGGGCCGGAGAAGCGAGG + Intronic
987616169 5:20276939-20276961 AAGGGGAGGAAGGAGTAGGAAGG + Intronic
988199411 5:28050034-28050056 ATGGTGGTGCAGGATATGGAAGG - Intergenic
988255767 5:28818379-28818401 AAGGAGGAGGAGGAGAAGGAGGG + Intergenic
988550995 5:32200650-32200672 AGGGGAGGGGAGGAGAAGGAAGG + Intergenic
988680549 5:33480809-33480831 AGGGGAGGGGAGGAAAAGGAGGG - Intergenic
988801222 5:34698210-34698232 AAGGGAGGGGAGGAGATGGAGGG - Intronic
989167585 5:38446293-38446315 AAGGCGGCGCCGGAAAAGGAGGG - Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989525996 5:42454477-42454499 AAGTGGGGGCAGGATTAGGCGGG + Intronic
990564854 5:57018680-57018702 ATGGTGGTGCAGGATATGGAAGG + Intergenic
991030231 5:62074842-62074864 AAAGGGAGGGGGGATAAGGAGGG + Intergenic
991667597 5:69014674-69014696 CAGTGGGGGCAGGAAAAGGGAGG - Intergenic
992451722 5:76882002-76882024 ATGGTGGTGCAGGATATGGAAGG + Intronic
993506868 5:88719784-88719806 AAGTGGTGGCAAGATAGGGAAGG - Exonic
993569182 5:89515018-89515040 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
994084522 5:95743693-95743715 AATGGGGGGGAGGAGAAGAAGGG - Intronic
994375487 5:99012890-99012912 ATGGTGGTGCAGGATATGGAAGG + Intergenic
995140411 5:108728725-108728747 AAGGGGGGGCGGGGAAAGGCAGG - Intergenic
996141336 5:119913317-119913339 AAGTGGGGGCAGGTTTAGGTGGG + Intergenic
996574747 5:124968442-124968464 ATGGTGGTGCAGGATATGGAAGG + Intergenic
996725495 5:126670306-126670328 ATGGTGGTGCAGGATATGGAAGG + Intergenic
996753746 5:126915129-126915151 AAGGGGCTGCAAGAGAAGGAGGG + Exonic
997197075 5:131987458-131987480 ATAGGGAGGCAGGAGAAGGAGGG + Intronic
998028024 5:138837519-138837541 AAGGGGGGGGAGGAGAGGGAGGG - Intronic
998114337 5:139524690-139524712 AGGGGAGGGCAGCACAAGGAGGG - Intergenic
998352739 5:141511938-141511960 ATGGGGTGGTAAGATAAGGAAGG + Exonic
998386239 5:141758585-141758607 AGGGGTGGGCAGGTTAGGGATGG + Intergenic
998513888 5:142735862-142735884 AAGTGAGGGCAGGATTGGGAGGG - Intergenic
999258328 5:150222322-150222344 GAGGGGTGGCATGATGAGGAAGG - Intronic
999366896 5:151029058-151029080 AAGGTGGGGCAGGGTAAAGGGGG + Intergenic
1000225936 5:159262120-159262142 GAGGCTGGGAAGGATAAGGAGGG - Intergenic
1000370253 5:160528328-160528350 AAGAGGGGACAGGATGGGGATGG - Intergenic
1000438842 5:161244149-161244171 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1001213411 5:169832466-169832488 AAGGGGAGGCAGGGTAAACAAGG - Intronic
1001353963 5:171002547-171002569 ATGGTGGTGCAGGATATGGAAGG + Intronic
1001414482 5:171535301-171535323 CTGTGGGGGCAGGAGAAGGATGG + Intergenic
1001559126 5:172658074-172658096 ACAAGGGGGCAGGGTAAGGAGGG - Intronic
1002080890 5:176736735-176736757 CAGGGAGGACAGGAGAAGGAAGG - Intergenic
1002713529 5:181209965-181209987 GGGGGGGGGCTGGGTAAGGAGGG + Intergenic
1002827679 6:788003-788025 AAATGGGGGGAGGATGAGGATGG + Intergenic
1003167615 6:3694964-3694986 AAGGAGGAGGAGGACAAGGAGGG - Intergenic
1003566187 6:7224521-7224543 AAGTGGGGGTGGGAGAAGGAAGG + Intronic
1004020649 6:11773232-11773254 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1005148348 6:22718769-22718791 AAAGGGAGGCAGAATAAGAATGG + Intergenic
1005768985 6:29045837-29045859 GAGTGGGGGCAGGAGATGGATGG + Intergenic
1006325114 6:33347829-33347851 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1006368689 6:33631345-33631367 ACAAGGGGGCAGGGTAAGGAGGG + Intronic
1006484440 6:34327083-34327105 ACAAGGGGGCAGGGTAAGGAGGG + Intronic
1007310357 6:40940530-40940552 AGGGTGGGGGAGGATAAAGATGG + Intergenic
1007388384 6:41534893-41534915 GAGGGTAGGCAGGGTAAGGATGG - Intergenic
1007519067 6:42437652-42437674 AATGGGAGGTAGGATAAGCAAGG + Intronic
1007551598 6:42733992-42734014 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1008030052 6:46685615-46685637 AAGGGGTGGAAGGATAGGGGAGG + Intergenic
1008444447 6:51571806-51571828 AAGTGGGGTCAGGATAATAATGG + Intergenic
1009464665 6:63954434-63954456 ATGGTGGTGCAGGATATGGAAGG - Intronic
1009749973 6:67870194-67870216 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1009828392 6:68897593-68897615 AGGGGAGGGCAGGAAGAGGAAGG + Intronic
1009828422 6:68897724-68897746 AGGGGAGGGCAGGAAGAGGAAGG + Intronic
1010144583 6:72652456-72652478 AAGGGGAGGGAGGAAAAAGAGGG - Intronic
1010203135 6:73299858-73299880 AAGTGGGGGCGGGGTAAGGAGGG + Intronic
1012319046 6:97819806-97819828 AAGGGGAGGCAGAACAGGGAAGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013661436 6:112300759-112300781 AAAGCAGGGCAGGATAAGGGTGG + Intergenic
1013807762 6:114013647-114013669 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1015801071 6:137062651-137062673 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1016751219 6:147632324-147632346 ATGGTGGTGCAGGATATGGAAGG + Intronic
1017270133 6:152494655-152494677 ATGGTGGTGCAGGATATGGAAGG - Intronic
1017384113 6:153862320-153862342 AAAGGGGGGAAGGAAAGGGAAGG + Intergenic
1018077880 6:160232495-160232517 ATGGTGGTGCAGGATATGGAAGG - Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018928802 6:168225943-168225965 GAGGGGGAGAAGGAGAAGGAGGG - Intergenic
1018928808 6:168225961-168225983 GAGGGGGAGAAGGAGAAGGAGGG - Intergenic
1018928814 6:168225979-168226001 GAGGGGGAGAAGGAGAAGGAGGG - Intergenic
1018928820 6:168225997-168226019 GAGGGGGAGAAGGAGAAGGAGGG - Intergenic
1019258823 7:68618-68640 AAAGGGGGCCATGAAAAGGAGGG + Intergenic
1019375503 7:689620-689642 AAAGATGGGGAGGATAAGGAGGG + Intronic
1019409872 7:901755-901777 AAGGGTGGGCGGGGGAAGGAGGG - Intronic
1019774669 7:2905562-2905584 AAGGGGGTGAAGGAGAAGAATGG + Intergenic
1019932080 7:4230391-4230413 AAGGGAGGGCAGGGGAGGGAAGG + Intronic
1020125794 7:5531866-5531888 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1020415458 7:7940880-7940902 GAAGAGGGGCAGGAGAAGGAAGG + Intronic
1020794509 7:12663840-12663862 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1020812496 7:12864267-12864289 CAGGGGAGGCAGGCCAAGGAGGG - Intergenic
1021172311 7:17413722-17413744 AAATGTGGGGAGGATAAGGAAGG + Intergenic
1021172997 7:17418266-17418288 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1021469168 7:20981652-20981674 AAGGGGAGGGAGGGGAAGGAGGG - Intergenic
1021576510 7:22110149-22110171 AAGTGAGGGCAGGGAAAGGATGG - Intergenic
1021660873 7:22916903-22916925 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1022174862 7:27863211-27863233 AAGAGAGGGAAGGATAATGATGG - Intronic
1022730013 7:33013453-33013475 GTGGTGGGGGAGGATAAGGATGG + Intergenic
1023082301 7:36536985-36537007 AAGAGGGGGCTGCATTAGGAAGG - Intronic
1023788700 7:43734782-43734804 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1023879899 7:44312403-44312425 CTGGGAGGGCAGGAGAAGGAGGG + Intronic
1023916994 7:44597055-44597077 AAGGGAGGGGAGGAGAGGGAGGG + Intergenic
1023983984 7:45084864-45084886 AAGGGGCTGCAGGCTCAGGATGG - Exonic
1024233104 7:47377770-47377792 ATGGGGGAGAAGGAGAAGGAGGG - Intronic
1025139451 7:56450056-56450078 AAGGGGGGGGAGGGGAGGGAAGG - Intergenic
1026238030 7:68545772-68545794 AAGGAGGAGAAGGAGAAGGAGGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026738748 7:72965418-72965440 AAGGGGGGGCGGGCGAGGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026870151 7:73846145-73846167 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1026979205 7:74516776-74516798 AAGGGGGGCCAGGGCAAGGCGGG - Intronic
1027104986 7:75399651-75399673 AAGGGGGGGCGGGCGAGGGAGGG - Intronic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027354639 7:77343404-77343426 ATGGAGGTGCAGGATATGGAAGG - Intronic
1028427536 7:90706968-90706990 ATGGGGAGGCAGGACAGGGAGGG - Intronic
1029255729 7:99268304-99268326 AAGGGTGGGTAGGGAAAGGAGGG - Intergenic
1029373276 7:100162856-100162878 AGGGGAGGGGAGGAAAAGGAAGG + Intronic
1029422104 7:100477195-100477217 GAGGGGGGGGAGGAGGAGGAAGG + Intronic
1029550189 7:101233256-101233278 AAGGGTGGGCGGGATTTGGATGG - Intronic
1029666200 7:101996694-101996716 AAGGGAGGGAAGGAAAAAGACGG - Intronic
1030445575 7:109644163-109644185 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1030873030 7:114781189-114781211 GAGCTGGGGCAGGAAAAGGAGGG - Intergenic
1031060708 7:117048225-117048247 AAGGGGAGGCAGGAGAGGCAGGG + Intronic
1031083738 7:117282352-117282374 AAGGGGAGGGAGGAGAAAGAAGG + Intronic
1031866131 7:127039989-127040011 AAGGGAGGGGAGGGTGAGGAGGG + Intronic
1032183878 7:129706413-129706435 AAGGTGGGGCCGGAGAAGAAGGG + Intronic
1033084984 7:138333046-138333068 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1033088869 7:138366914-138366936 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1033211780 7:139465275-139465297 ATGGTGGTGCAGGATATGGAAGG - Intronic
1033227059 7:139570731-139570753 AAAGGGAGGGAGGATGAGGATGG + Exonic
1033464724 7:141580145-141580167 ATGGTGGTGCAGGATATGGAAGG + Intronic
1033625842 7:143108838-143108860 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1034013380 7:147555223-147555245 AAAAGGGAGCAGAATAAGGAGGG + Intronic
1034645667 7:152644324-152644346 AAGAGGGGGCAGAATGAGGCAGG - Intergenic
1034781537 7:153886764-153886786 AAGCGGGGGAAGGCTAGGGATGG - Intergenic
1035156767 7:156920570-156920592 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1035722044 8:1799288-1799310 AAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1035722051 8:1799303-1799325 GAGGAGGGGGAGGAGAAGGAGGG - Intergenic
1036409329 8:8484275-8484297 CAGGGGAAGCAGGTTAAGGAAGG - Intergenic
1036427083 8:8654621-8654643 AAAGGAGGGCAGGAGAAGGTTGG + Intergenic
1036549992 8:9807263-9807285 ACGGTGGTGCAGGATATGGAAGG - Intergenic
1036991992 8:13608421-13608443 CAAGGGGGGCAGGGTAAGGAGGG - Intergenic
1037025252 8:14027811-14027833 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1037585388 8:20272387-20272409 AAGGGGGGTCAGGCTCAGAAGGG - Intronic
1037590802 8:20310550-20310572 AAGGAGGGCCAGGACATGGACGG - Intergenic
1037733149 8:21546116-21546138 ATGGGGATGCAGGAGAAGGAGGG + Intergenic
1037818381 8:22123891-22123913 AAGGAGGGGCAGGAGAAGCAAGG + Intronic
1039630267 8:39103658-39103680 AAGGAGGTGCAGGAGCAGGACGG - Exonic
1039691292 8:39867639-39867661 AAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1039941551 8:42095689-42095711 TAGGAGGGGCAGGAGAAAGAAGG - Intergenic
1040648320 8:49423918-49423940 ATGGCGGTGCAGGATATGGAAGG - Intergenic
1040959643 8:53018616-53018638 AAGGGGGGGCAGGGCCAAGATGG + Intergenic
1041570112 8:59328378-59328400 AAGGAGGGGAAGGAGGAGGAAGG - Intergenic
1041650231 8:60294990-60295012 CAAGGGGGTCAGGGTAAGGAGGG - Intergenic
1041686237 8:60647578-60647600 AAGGAGGGGCTGGATCATGATGG + Intergenic
1041742950 8:61176530-61176552 AAGAGGGGGCAGGACCAAGATGG + Intronic
1042706400 8:71668703-71668725 CATGGTGTGCAGGATAAGGAAGG - Intergenic
1042933892 8:74039569-74039591 CAAGCGGGGCAGGGTAAGGAGGG + Intergenic
1043266623 8:78274156-78274178 AAGGGTGGGGAGGATAAAAAGGG + Intergenic
1043599170 8:81917839-81917861 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1043820656 8:84859279-84859301 AAAAGGTGGCAGGATGAGGAGGG + Intronic
1043838007 8:85067107-85067129 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1044896353 8:96896462-96896484 AAAGGGGGTCAGTATGAGGAAGG - Intronic
1045130012 8:99140624-99140646 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1045307309 8:100969377-100969399 ACAAGGGGGCAGGGTAAGGAGGG - Intergenic
1045533101 8:103002804-103002826 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1045788541 8:105955011-105955033 CAGTGGGGGCAGGAGCAGGATGG + Intergenic
1046075148 8:109304587-109304609 ATGGTGGTGCAGGATATGGAAGG - Intronic
1046162559 8:110386706-110386728 AAGTGGGGGAAGGATATGAACGG - Intergenic
1046358875 8:113124201-113124223 GAGTGGGGTAAGGATAAGGATGG + Intronic
1046413669 8:113882431-113882453 CAAGGGGGGCAGGGTAAGGAGGG - Intergenic
1046413842 8:113884368-113884390 CAAGGGGGGCGGGGTAAGGAGGG + Intergenic
1046910486 8:119621012-119621034 AAAGGGAAGCAGGATAGGGAAGG - Intronic
1047388245 8:124429283-124429305 AAGGAGGAGGAGGAGAAGGAAGG + Intergenic
1047701867 8:127456897-127456919 TAGGAGGGCCAGGGTAAGGAGGG - Intergenic
1047718782 8:127619792-127619814 AAGGGGAGGAAGGAGAGGGAAGG - Intergenic
1047973400 8:130106597-130106619 ATAGGTGGCCAGGATAAGGAGGG - Intronic
1048680611 8:136837400-136837422 AAGGAAGGGAAGGATAGGGAAGG - Intergenic
1049122018 8:140747640-140747662 AAGGGGGAGGAGGAAGAGGAGGG + Intronic
1049515019 8:143049704-143049726 AAGGAGGAGGAGCATAAGGAGGG - Intronic
1049570704 8:143369091-143369113 GAGGGGGGGCAGGAAAAGGCCGG - Intronic
1049768289 8:144366089-144366111 CAAGGGGGGCAGGGTAAGGAGGG - Intergenic
1049869299 8:144960993-144961015 CAAGGGGCGCAGGATAAGGAGGG + Intergenic
1049875078 8:145012182-145012204 AAGGAGGTGCAGGACAAGGCAGG - Intergenic
1050575155 9:6987258-6987280 AGGAGGGGGCAGGACAAGAAAGG - Intronic
1050675798 9:8051845-8051867 AAGGGAAGGAAGGAGAAGGAAGG + Intergenic
1051173035 9:14338829-14338851 AAGGAGGGGCAGGAGAAAGGAGG - Intronic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053037798 9:34840410-34840432 AAGGAGGAGGAGGAGAAGGAGGG - Intergenic
1053059700 9:35021336-35021358 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1053170053 9:35872027-35872049 AGGGTGGGGGAGGACAAGGATGG - Intergenic
1053293340 9:36896567-36896589 AAGGGAGGGCTGGAGAGGGATGG - Intronic
1054909456 9:70440768-70440790 AAGGGGAGGAAGGAAAGGGAAGG + Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055069228 9:72149430-72149452 AAGCGGGGGCAGGACAAGGCCGG + Exonic
1055778345 9:79790937-79790959 AGGGTGGGGCAGGATGAGGGTGG + Intergenic
1055779153 9:79800500-79800522 AAGGGTGGGCAGGAGAAGGTAGG - Intergenic
1056163157 9:83918325-83918347 GGGGGGGGGCAGGACAGGGAGGG + Intronic
1056186285 9:84138135-84138157 AAGTGGGGGCAGCAGAGGGAAGG - Intergenic
1056860732 9:90178661-90178683 AAGGGGAGGCAGGATAAGCAGGG + Intergenic
1057267797 9:93630496-93630518 GAGGCGGGGCTGGAAAAGGAGGG - Intronic
1057483307 9:95462625-95462647 GAGGGGGTGGAGGAGAAGGAAGG + Intronic
1058172949 9:101705016-101705038 AAGGGGGGGCAGGGAAATGCTGG + Intronic
1059114099 9:111585373-111585395 AAGGATGAGCAGGATAACGAAGG + Intronic
1059411377 9:114134526-114134548 AAAGGGGAGCAGGAGAGGGAAGG + Intergenic
1059773099 9:117446463-117446485 AAGAGGGAGGAGGATAAGCAGGG - Intergenic
1060196283 9:121625635-121625657 ATGGGATGGCAGGATCAGGAGGG + Intronic
1060426971 9:123514255-123514277 AAGGGATGGCAGGGCAAGGAGGG + Intronic
1060563576 9:124568778-124568800 AAGGTGGGGGAAGAGAAGGATGG + Intronic
1061066258 9:128279412-128279434 CAAGGGGGGCAGGGTAAGGAAGG + Intronic
1061067082 9:128285246-128285268 AAAGGGGGGAAGGAAAGGGAAGG + Intronic
1061560078 9:131396281-131396303 AAGGGAAGGAAGGAAAAGGAAGG - Intronic
1061799111 9:133104477-133104499 AGGGGGAGGCAGGCTCAGGAAGG - Intronic
1061969455 9:134035968-134035990 CAGGAGGGGCAGGCCAAGGAGGG + Intronic
1061972291 9:134051265-134051287 AAGGGGGAGCAGGATTTGGGAGG + Intronic
1062053494 9:134458959-134458981 AAGGTGGGGCGGGATATGGAGGG + Intergenic
1062173832 9:135149756-135149778 ACAAGGGGGCAGGGTAAGGAGGG + Intergenic
1062692305 9:137848661-137848683 ATGGTGGTGCAGGATATGGAAGG - Intronic
1062722286 9:138050734-138050756 AAGAGGGGACAGGAGCAGGAGGG - Intronic
1203780101 EBV:96257-96279 GAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780114 EBV:96290-96312 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780133 EBV:96341-96363 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780138 EBV:96356-96378 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780143 EBV:96371-96393 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780148 EBV:96386-96408 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780157 EBV:96410-96432 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780166 EBV:96434-96456 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780195 EBV:96512-96534 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780204 EBV:96536-96558 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780213 EBV:96560-96582 CAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1203780228 EBV:96602-96624 GAGGAGGGGCAGGAGCAGGAGGG + Intergenic
1185586329 X:1244445-1244467 AAGGGAAGGAAGGAGAAGGAAGG + Intergenic
1185603633 X:1355080-1355102 AAGGAGGGGCAGGAGGAAGAAGG + Intronic
1185630686 X:1514392-1514414 AAGGGAGGGGAGGAAAGGGAAGG - Intronic
1185630725 X:1514507-1514529 AAGGGAGGGGAGGAAAGGGAAGG - Intronic
1185630756 X:1514596-1514618 AAGGGAGGGGAGGAAAGGGAAGG - Intronic
1185630772 X:1514641-1514663 AAGGGAGGGGAGGAAAGGGAAGG - Intronic
1185640637 X:1588113-1588135 AGGGGAGGGGAGGAGAAGGAAGG - Intergenic
1185714577 X:2330696-2330718 GATGAGGGGCAGGAGAAGGAGGG + Intronic
1186246643 X:7622565-7622587 AAGGGAGGGGAGGAAAAGGGAGG - Intergenic
1186436603 X:9548319-9548341 ATGGGGTGGTGGGATAAGGATGG - Intronic
1187102415 X:16207637-16207659 AAGGGGAGGCAGGAGAGGCAGGG + Intergenic
1188332724 X:28894149-28894171 ATGGTGGTGCAGGATATGGAAGG + Intronic
1188662104 X:32773548-32773570 TGGGGAGGACAGGATAAGGAGGG - Intronic
1189217319 X:39337399-39337421 AAGGGGGAGAGGGATAAGGGGGG - Intergenic
1189551340 X:42096708-42096730 GAGGGAGGGAAGGATAAGAAAGG - Intergenic
1191013913 X:55790022-55790044 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1192706441 X:73531856-73531878 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1192731218 X:73804283-73804305 ATGGTGGTGCAGGATATGGAAGG + Intergenic
1193300855 X:79886847-79886869 CAGGAGGGGCAGGATTAGGCAGG - Intergenic
1193924098 X:87464409-87464431 AGGTGGGGGCAGGGTTAGGAAGG - Intergenic
1194610287 X:96035151-96035173 AAAGGGAAGCAGGATAGGGAAGG - Intergenic
1194780729 X:98022883-98022905 AAGGGGTGGGAAGATCAGGAAGG - Intergenic
1195859884 X:109372188-109372210 CAGGGTGGGCAGGAAAAGGGAGG + Intergenic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1197151394 X:123223707-123223729 AATGTGGGGCAGGATAAGGGTGG + Intronic
1197286958 X:124607022-124607044 AAGGAGGAGGAGGATAAGGGAGG + Intronic
1197500031 X:127230976-127230998 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1198301561 X:135338861-135338883 AAAAGGGGGAAGGATTAGGAGGG - Intronic
1198966242 X:142230948-142230970 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1199298600 X:146186941-146186963 CAGGTGGGGCAGGGTAAGGTGGG + Intergenic
1199818871 X:151424642-151424664 AGTGGGGGGGAGGAGAAGGAGGG + Intergenic
1199966533 X:152825031-152825053 AAGGCGGGGGAGGATGTGGATGG - Intergenic
1200088720 X:153624545-153624567 AAGGGGGTGAAGGAGAAGGGGGG - Intergenic
1200112028 X:153745194-153745216 AAGGGAGGGCAGGGGAAGGGAGG + Intergenic
1200813154 Y:7505124-7505146 ATGGTGGTGCAGGATATGGAAGG - Intergenic
1201146280 Y:11067066-11067088 AAGGGAGGGAAGGAGAGGGAGGG + Intergenic
1201146560 Y:11067950-11067972 AAGGGAGGGAAGGAGAGGGAGGG + Intergenic
1201486138 Y:14496469-14496491 AAGAGGAGGCAGGATGAGGAAGG - Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic