ID: 1167316297

View in Genome Browser
Species Human (GRCh38)
Location 19:48765067-48765089
Sequence AAAGTTGCACAGTTAGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167316293_1167316297 9 Left 1167316293 19:48765035-48765057 CCTCACATTTAAGTGAGCTGTAC No data
Right 1167316297 19:48765067-48765089 AAAGTTGCACAGTTAGCACTAGG No data
1167316292_1167316297 20 Left 1167316292 19:48765024-48765046 CCTCTTCTTTTCCTCACATTTAA No data
Right 1167316297 19:48765067-48765089 AAAGTTGCACAGTTAGCACTAGG No data
1167316291_1167316297 29 Left 1167316291 19:48765015-48765037 CCTCACACTCCTCTTCTTTTCCT No data
Right 1167316297 19:48765067-48765089 AAAGTTGCACAGTTAGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167316297 Original CRISPR AAAGTTGCACAGTTAGCACT AGG Intergenic
No off target data available for this crispr