ID: 1167317037

View in Genome Browser
Species Human (GRCh38)
Location 19:48770275-48770297
Sequence CTGTGTTTCCACTTGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167317037_1167317040 3 Left 1167317037 19:48770275-48770297 CCTTTCACCAAGTGGAAACACAG No data
Right 1167317040 19:48770301-48770323 GAAGGTGCCAGCAATGAACAAGG No data
1167317037_1167317042 10 Left 1167317037 19:48770275-48770297 CCTTTCACCAAGTGGAAACACAG No data
Right 1167317042 19:48770308-48770330 CCAGCAATGAACAAGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167317037 Original CRISPR CTGTGTTTCCACTTGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr