ID: 1167320522

View in Genome Browser
Species Human (GRCh38)
Location 19:48794896-48794918
Sequence GCAGATAGTAAGTTCAGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167320510_1167320522 26 Left 1167320510 19:48794847-48794869 CCTAGAGACTGGGAGACGGGAAA 0: 1
1: 0
2: 2
3: 20
4: 228
Right 1167320522 19:48794896-48794918 GCAGATAGTAAGTTCAGTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 111
1167320507_1167320522 30 Left 1167320507 19:48794843-48794865 CCGGCCTAGAGACTGGGAGACGG No data
Right 1167320522 19:48794896-48794918 GCAGATAGTAAGTTCAGTGCCGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167320522 Original CRISPR GCAGATAGTAAGTTCAGTGC CGG Intergenic
902445388 1:16460181-16460203 CCAGATTGAAAGTTCAGGGCTGG + Intergenic
906328771 1:44867019-44867041 GCAGTCAGTCAGTTGAGTGCAGG + Intronic
908416360 1:63916810-63916832 GCAGTGAGTAACTTCAATGCAGG - Intronic
923295166 1:232587605-232587627 ACAGCTAGTAAGTACAGTGTGGG - Intergenic
923897537 1:238288752-238288774 GCTGATACTCAGTTCAGTGAGGG - Intergenic
1063108589 10:3015441-3015463 GCAGTTAGAAAGTGCAGTTCAGG - Intergenic
1064863261 10:19850633-19850655 ACAGATAGTAATTTAAATGCAGG - Intronic
1068787365 10:60990931-60990953 ACAGATGCTAAGTTCAGTGTTGG - Intronic
1070175860 10:73968641-73968663 GCAGATTGTATGTGTAGTGCTGG - Intergenic
1070442154 10:76456948-76456970 GAAGATAGGAAGTTGAGTGTTGG + Intronic
1070577885 10:77693538-77693560 GCAGAAAGTCAGTGCAGAGCTGG - Intergenic
1070716680 10:78727428-78727450 GGAGAGAATGAGTTCAGTGCCGG + Intergenic
1070732564 10:78841487-78841509 GAAGATCATAAGTTCAGTGTTGG + Intergenic
1073527606 10:104199516-104199538 GCAGAAGGTAAGTTCCGTGAGGG - Intronic
1076129201 10:128001356-128001378 GCTGATAGTAAGTAAAGTGTAGG + Intronic
1083547329 11:63558665-63558687 GCAAACAGTGAGTTCAGTCCTGG + Intronic
1083669398 11:64291779-64291801 GCCGACAGTAAGTGCGGTGCGGG + Intronic
1084907870 11:72362570-72362592 ACAGTCAGTAAGTTCAGAGCTGG - Intronic
1086054417 11:82630178-82630200 GCAGATAGGGATTACAGTGCTGG - Intergenic
1086764547 11:90678487-90678509 GCAGAGATTAAGTTCTTTGCAGG - Intergenic
1086892507 11:92273950-92273972 GCAGGTTGCAAGTTTAGTGCGGG + Intergenic
1087904268 11:103677382-103677404 GTAGATAGTAAGTTCTTTGGGGG + Intergenic
1089280347 11:117369942-117369964 GTGGATAGAAAGGTCAGTGCTGG - Intronic
1093147838 12:15588171-15588193 GAAGATAGTAAGTGCAGTTCTGG + Intronic
1097396605 12:59082746-59082768 ACAGATAGAAAGATCAGTGAAGG - Intergenic
1098187489 12:67912957-67912979 CTAGATAGTAAGTTCAGGGAGGG + Intergenic
1099831624 12:87850942-87850964 ACAGATAGTATGTTCAATGATGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103167008 12:118778845-118778867 GCAGAGGGTGAGCTCAGTGCAGG + Intergenic
1105827186 13:24133218-24133240 GCAGAGAGGAAGTTCTGTGGTGG - Intronic
1108235659 13:48402144-48402166 ACAGATAGTAAGTTCAGTATTGG - Intronic
1110213540 13:73001433-73001455 CCTGATAGTAAATTCAGTGATGG + Intronic
1112858043 13:103794805-103794827 CCAAATAGAAAGTTCAGTGGAGG - Intergenic
1113632487 13:111897689-111897711 CCAGATAGCAAGTCCCGTGCTGG + Intergenic
1116756430 14:48954513-48954535 GTAGATAGTAAGTTCAGAGAAGG - Intergenic
1117323630 14:54648304-54648326 GCAGATTGAGACTTCAGTGCTGG + Intronic
1118633148 14:67724465-67724487 GCCGATAGGAAGTTCTTTGCTGG + Exonic
1122808148 14:104271204-104271226 GGAGACAGTAAGATCAGTGTTGG - Intergenic
1135853279 16:25983808-25983830 ACAGATAGTAATTTCAGGGTTGG + Intronic
1138325661 16:56164819-56164841 GAAGATAGTAAGTTAATAGCTGG - Intergenic
1139809187 16:69598548-69598570 GAAGATAATAAGTTCAGTTTGGG + Intronic
1140441785 16:74993461-74993483 GCAGCTAGTAAGAGCAGAGCTGG - Intronic
1140998351 16:80283450-80283472 ACAACTAGGAAGTTCAGTGCTGG - Intergenic
1147713747 17:42489721-42489743 AGAGATGGTAAGTTCAGTTCCGG + Intronic
1148333433 17:46825659-46825681 GCAGATGGCAAGTTCCTTGCAGG - Intronic
1150516062 17:65810490-65810512 TCAGATTGTAAGTTCAATGTTGG - Intronic
1157655310 18:49381343-49381365 GCAGTTAGTAAGCACAATGCAGG - Intronic
1157656871 18:49399142-49399164 GCAGACAGACAGTTCAGTACAGG + Intronic
1161343795 19:3757400-3757422 TCAGATAGTAAGTTCTGGCCGGG - Intronic
1162825423 19:13248440-13248462 GCAGAGGGGAAGCTCAGTGCTGG + Intronic
1167320522 19:48794896-48794918 GCAGATAGTAAGTTCAGTGCCGG + Intergenic
925664050 2:6234181-6234203 GCAGGCAGTAAGTGCAGAGCCGG + Intergenic
928126499 2:28620233-28620255 GCAAAAAGAAAGTTCAGGGCTGG - Intronic
930228263 2:48816668-48816690 GCAGAAAGTAAGTTCTTTGAAGG - Intergenic
931067401 2:58601882-58601904 GCAGGTAGTATGTGCAGTGGAGG - Intergenic
932534552 2:72579253-72579275 GAAAATAGTAAGTTGAATGCAGG + Intronic
934512469 2:94956800-94956822 GCAGCTAATGAGTCCAGTGCAGG - Intergenic
935675549 2:105592471-105592493 GCAGATAATGAGTCCAGTGTTGG - Intergenic
942715426 2:178886207-178886229 GCAGACAGAAACTTCAGGGCAGG + Intronic
945327208 2:208496163-208496185 ACAGATACTATGTTAAGTGCTGG + Intronic
946861364 2:224002919-224002941 CTAGATTGTAAGCTCAGTGCGGG - Intronic
947229803 2:227873231-227873253 GCATAGAGTAAAATCAGTGCAGG - Intronic
1170593240 20:17786983-17787005 GCAGACAGTGAGATCAGTTCTGG - Intergenic
1173269895 20:41524112-41524134 GCCTATAGGAAGGTCAGTGCTGG - Intronic
1175576659 20:60065592-60065614 GCAGATAGAAAGTTCCATGCCGG + Intronic
1181868910 22:25882284-25882306 GCTGCTAGGAAGTTCAGTGTTGG - Intronic
950627698 3:14260223-14260245 GCACATGGTGAGTTCAGAGCAGG - Intergenic
952032343 3:29159109-29159131 GAAGATAATACGTTCAGGGCTGG + Intergenic
953388424 3:42520476-42520498 TCAGGTAGTGAGCTCAGTGCGGG + Intronic
955504953 3:59622900-59622922 GCAGATAGAAAATGCAGTGTTGG - Intergenic
955566423 3:60251811-60251833 GCACATAGTTAGTTCACAGCAGG - Intronic
956335926 3:68163622-68163644 ACAGCTAGTAATTTCAGTCCAGG - Intronic
957229974 3:77500360-77500382 ACAGATTCTAAGTTCAGTTCTGG - Intronic
964894830 3:161583124-161583146 GCAGATAGTGAGTGGAGAGCTGG + Intergenic
965682249 3:171263655-171263677 GTGAATAGTAAGTTCAGTGAAGG + Intronic
965682318 3:171264229-171264251 GTGAATAGTAAGTTCAGTGAGGG - Intronic
965723897 3:171692819-171692841 GAAGTTAGAAAGTACAGTGCAGG - Intronic
967221489 3:187251511-187251533 GCAGCTAGGAAATTCTGTGCTGG + Intronic
971681574 4:29707302-29707324 GCTGATAGTAATATCAGTCCAGG - Intergenic
973738336 4:53894292-53894314 GCTGATGGTACGTTAAGTGCTGG + Intronic
975816501 4:78222556-78222578 GCAGTGAGTAAGTTCAGGGGTGG + Intronic
977473227 4:97469536-97469558 GAAGATACTAGGTTCAGTTCTGG + Intronic
982939074 4:161525179-161525201 TCAGAAAGAAAGTTGAGTGCAGG - Intronic
983944022 4:173566456-173566478 GCTTATATTAAGTTAAGTGCAGG + Intergenic
983986755 4:174068715-174068737 GAAGAAAGTAAATTCAGTGTAGG - Intergenic
984524030 4:180835287-180835309 GAAGATAATGAGTTCAATGCTGG - Intergenic
984934153 4:184875269-184875291 GTAGATAGGAAGTGCAGTCCAGG + Intergenic
992116088 5:73539665-73539687 GCAGACAGAAAGATTAGTGCTGG + Intergenic
998296381 5:140973276-140973298 TCAGATAGAAAAATCAGTGCTGG - Intronic
1000462259 5:161537423-161537445 GCAGATAGTGAGTTCACTTTGGG - Intronic
1001934123 5:175692634-175692656 GCAGCTGGAAAGTTCAGGGCAGG + Intergenic
1010839675 6:80634546-80634568 GGAGATAGGTAGTTCAGAGCTGG + Intergenic
1011777642 6:90749463-90749485 GCAACCAGTAAGTTCATTGCTGG - Intergenic
1015620666 6:135128557-135128579 GCTTATAGTAAATTTAGTGCTGG - Intergenic
1017747190 6:157457477-157457499 GCAGAAAGTAAGAACAGTACAGG - Intronic
1019184256 6:170211886-170211908 GCTGAGAGTCAGGTCAGTGCTGG - Intergenic
1026467037 7:70663023-70663045 GAAGATAGTAAGTTCTATGGAGG + Intronic
1029210654 7:98905586-98905608 GCAGAGAGTAAGTTTAGGGGTGG + Intronic
1031587282 7:123547340-123547362 GAAAATAGTAAGTGCAGTGAAGG - Intronic
1034511669 7:151540371-151540393 GCAGGTAGTATGTACAGTACAGG - Intergenic
1042370746 8:67988162-67988184 GCAGATAGTAAGGTAACTGTGGG - Intronic
1044118311 8:88362152-88362174 GCAGTTAGTAAGTATTGTGCTGG + Intergenic
1045336699 8:101210929-101210951 GTAGATAGTAAGTACAGCACAGG - Intergenic
1047980188 8:130173150-130173172 GCAGAAAGTAATTTCAGGGAGGG + Intronic
1048256097 8:132906333-132906355 GCAGATACTAAGTTCAGGCCTGG + Intronic
1048619393 8:136115149-136115171 GCAGATATTAAGTTAAATGCTGG + Intergenic
1048914161 8:139165745-139165767 GCAGACACTGAGTTCACTGCAGG - Intergenic
1050564653 9:6869587-6869609 GCAGATCCTAAGGGCAGTGCTGG + Intronic
1051486005 9:17608861-17608883 GTAGACAGAAAATTCAGTGCAGG + Intronic
1053341682 9:37341504-37341526 GGAGAAAGTAAGTTCTGTGAGGG - Intronic
1054987646 9:71280984-71281006 GTTGATAGTAAGCTCTGTGCAGG + Intronic
1056739286 9:89239479-89239501 TCAGCTAGTAAGTACAGAGCTGG - Intergenic
1061809673 9:133155025-133155047 GCAGATAGAAAGTACAGTGTAGG - Intronic
1186759597 X:12709686-12709708 TCAGATTGTGAGTTCACTGCTGG + Intronic
1188008593 X:25035718-25035740 GGAAATAGTAGGTTCAGGGCTGG - Intergenic
1189158569 X:38786097-38786119 GCAGATAGACAGTTCATGGCTGG + Intergenic
1191041762 X:56089117-56089139 GCAAATATTAACTTCAGTGGTGG - Intergenic
1192618627 X:72654329-72654351 GCAGCTTGTAAGTTCAGTAGTGG - Intronic
1197354611 X:125422243-125422265 GAAGATATTAAATCCAGTGCAGG + Intergenic