ID: 1167322640

View in Genome Browser
Species Human (GRCh38)
Location 19:48806069-48806091
Sequence CGGGAGAGGGGACAGCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167322640_1167322649 15 Left 1167322640 19:48806069-48806091 CCCAATGGCTGTCCCCTCTCCCG 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1167322649 19:48806107-48806129 TCCCTCTCCCGCCAGCCCCCCGG 0: 1
1: 1
2: 11
3: 71
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167322640 Original CRISPR CGGGAGAGGGGACAGCCATT GGG (reversed) Intronic
900329818 1:2128395-2128417 TGGGACAGGCGACAGCCCTTGGG - Intronic
900524825 1:3123475-3123497 TGGAGGAGGGGGCAGCCATTCGG + Intronic
900526641 1:3132548-3132570 GGGTGGAGGGGAGAGCCATTTGG - Intronic
900578475 1:3395812-3395834 GGGGCGAGGGGACCTCCATTTGG - Intronic
900913928 1:5621192-5621214 GGGGAGAGGGGGCAGCCTTTGGG + Intergenic
901637601 1:10677547-10677569 TGGGACAGGGGACAGCTATCAGG + Intronic
902408163 1:16197716-16197738 CGGGAGGGGGTACAGCCCCTGGG + Intergenic
903478456 1:23636330-23636352 CGGGGCAGGGGACAGCCAAGGGG + Intronic
905091989 1:35437158-35437180 AGGGAGAGGGGAGAGCCATGGGG - Intronic
907464784 1:54627847-54627869 TGGGAGAGGGCACAGGCATGAGG + Intronic
909111417 1:71483032-71483054 CAGGATAGGGCACACCCATTGGG + Intronic
915600462 1:156920312-156920334 CGGGAGCGGGGACAGGGATAGGG - Intergenic
916090535 1:161305320-161305342 CGGGAGAGGAAACAGCCAGGGGG + Exonic
919306582 1:195848096-195848118 CGGATCAGGGGACATCCATTGGG - Intergenic
920362619 1:205429790-205429812 GGGGAGCAGGGACAGGCATTTGG + Intronic
922774514 1:228208552-228208574 CAGCAGAGGGGACAGCCAGAGGG + Intronic
923653637 1:235896974-235896996 GGGAAGAAGGGAGAGCCATTGGG - Intergenic
924330428 1:242935814-242935836 TGGGGGAGGGCACAGACATTTGG - Intergenic
1068301648 10:55150170-55150192 CTGGAGAGGCAACAGCCAATCGG + Intronic
1071128551 10:82364918-82364940 GGGGAGTGGGGGCAGCCATTGGG + Intronic
1072213786 10:93271229-93271251 AGGGAGATGGGACAGTCAATAGG + Intergenic
1072288833 10:93943503-93943525 CATGAGAGGAGACAGCCATCAGG - Intronic
1072719471 10:97771828-97771850 CTGGAGAGGGCGCAGCCATGCGG - Exonic
1075651770 10:124132099-124132121 AGGGAGAGGGGAATGGCATTTGG - Intergenic
1083367029 11:62147611-62147633 CGGGAGAGGGAACAGCTACGGGG - Intronic
1083765734 11:64840594-64840616 CGTGAAAGGGGACAGCCGTTGGG - Exonic
1084387606 11:68854218-68854240 AGGGAAAGGAGACAGCCATTGGG - Intergenic
1084492543 11:69486652-69486674 GGAGAGAGGGGACAGCCTATGGG + Intergenic
1089645267 11:119874771-119874793 GTGGAGAGGGGAGAGCAATTTGG - Intergenic
1090600272 11:128362820-128362842 TGTGAGAGGGGAGAGGCATTTGG - Intergenic
1092059475 12:5536711-5536733 CTGGAAAGGAGACAGCCATGGGG + Intronic
1092898605 12:13037568-13037590 GGGGAGAAGTGACAGCCATGAGG + Intergenic
1096615398 12:52830151-52830173 GGGGAGAGGGGACATCCCTGGGG - Intronic
1096838888 12:54369372-54369394 GGTGGGAGGGGACAGCCATGAGG + Exonic
1099170328 12:79356142-79356164 TGGGAGAGAGAACAGCCATGGGG + Intronic
1101416444 12:104512749-104512771 TGGGAGAGGGGAAAGCATTTTGG + Intronic
1102552407 12:113701247-113701269 CTGGAGGGGAGAAAGCCATTAGG - Intergenic
1103615008 12:122146248-122146270 GGGGAGAGGGGACAGCAAGGTGG + Exonic
1112159076 13:96849544-96849566 AGCGGGAGGGGACAGCCCTTAGG + Intergenic
1114657658 14:24325741-24325763 CTGGGGAGGGGTCAGCCCTTGGG - Intronic
1115169274 14:30485726-30485748 CTGGAGATGGCACAACCATTAGG + Intergenic
1119610316 14:76056339-76056361 AGGGAGAGGGGAGAGTCCTTGGG + Intronic
1121614082 14:95301250-95301272 CGAGAGTGGGGACAGCTCTTTGG + Intronic
1122163273 14:99802130-99802152 TGGGAGTGGGGAGAGCCATTCGG + Intronic
1122879213 14:104682500-104682522 AGGGAGCAGGGACAGCCATCCGG + Intergenic
1126678891 15:51185261-51185283 GGGGAGAGGGGAAAGCAGTTTGG + Intergenic
1127414830 15:58748721-58748743 CGGGAGAAGGGTAAACCATTTGG - Intronic
1128768943 15:70267545-70267567 AGGCAGAGGGGACAGGCAGTGGG - Intergenic
1128815560 15:70605702-70605724 AGGGGGAGGGGACAGACAGTGGG - Intergenic
1131165792 15:90141503-90141525 CAAGAGTGAGGACAGCCATTGGG - Intergenic
1131175138 15:90204500-90204522 AGGATGAGGGGACAGCCACTGGG + Intronic
1132977305 16:2717158-2717180 TGGGAGAGGGGTCAGCTCTTGGG - Intronic
1135909532 16:26546371-26546393 TGGGAGACGGGGCAGCCATGAGG + Intergenic
1138435647 16:56998329-56998351 CAGGAGAGGGGACAGGCATGGGG - Intronic
1139302360 16:65956222-65956244 CCTGAGAGGAGAAAGCCATTGGG + Intergenic
1143868397 17:9940579-9940601 AGGGAGAGGGGACAGCACTGGGG - Intronic
1145241775 17:21244289-21244311 CGGGTGGAGGGACAGGCATTTGG + Intronic
1146229306 17:31094664-31094686 CGGGGGAGGGGACAGCTGTAGGG + Intergenic
1146436615 17:32855318-32855340 AGAGAGAGGGGACAGTAATTAGG - Intronic
1147989823 17:44325743-44325765 GGGGAGACGGGAGAGCCATGGGG + Intergenic
1149613521 17:57977075-57977097 GGGGAGAGGGGACGGGCAATGGG - Intronic
1152621893 17:81368967-81368989 CGGGAGCAGGGCCAGCCATGAGG - Intergenic
1157451820 18:47794825-47794847 CTCGAGAAGAGACAGCCATTAGG - Intergenic
1158186700 18:54779866-54779888 CAGGAGAGGGGACAGCCAAGGGG - Intronic
1160391083 18:78533741-78533763 CAGGAGAGGGGACAGGGATAAGG - Intergenic
1160619478 18:80160610-80160632 CGGGAGAGGGGACAGTTAGAGGG + Intronic
1164836988 19:31362341-31362363 CAGGAGAGGGGACTGGAATTGGG - Intergenic
1165909760 19:39218134-39218156 TGGGAGAGGGGACTTCCAGTAGG + Intergenic
1167322640 19:48806069-48806091 CGGGAGAGGGGACAGCCATTGGG - Intronic
925738874 2:6987600-6987622 AGGGTGAAGGGTCAGCCATTGGG - Intronic
926160186 2:10482339-10482361 CTGAAGAGGGGACAGCCTTGTGG - Intergenic
926355510 2:12037521-12037543 AGGGAGCTGGGCCAGCCATTGGG - Intergenic
932702488 2:74001259-74001281 CCGGGGAGGGGACAGCAATTAGG + Intronic
934846083 2:97662156-97662178 GGGGAGAGGGGACATGCAGTGGG + Intronic
935236654 2:101144400-101144422 TGGGGGAGGAGACAGCCATGAGG + Intronic
935785004 2:106540956-106540978 GGGGAGTGGAGACAGCCTTTTGG + Intergenic
936077114 2:109408560-109408582 TGGTAGAGGGGACAGCGAATGGG - Intronic
937223092 2:120353300-120353322 CTGGAGAGGGGACACCCAGCTGG - Intergenic
938313360 2:130309585-130309607 TGGGAGACTGGGCAGCCATTGGG - Intergenic
940668551 2:156639430-156639452 TGGGAGAGGGGATAAGCATTAGG - Intergenic
944122599 2:196256786-196256808 CAGGAGAGAGGCCACCCATTAGG + Intronic
945268712 2:207917030-207917052 AGGGAGAGGGAAGAGCTATTAGG + Intronic
947749783 2:232526128-232526150 CGGGAGAGGGGACAGGTGTTGGG - Intronic
948431620 2:237922654-237922676 CAGGAGAGGGTACAACCATCAGG + Intergenic
949070158 2:242019578-242019600 CGGCAGAGGGGAGAGACCTTAGG + Intergenic
1172767706 20:37359553-37359575 CTGGGGAGGGAACAGCCAGTGGG + Intronic
1178894711 21:36548890-36548912 CTGGAGAAGGGGCAGCCACTGGG - Intronic
1179879711 21:44288321-44288343 TGGGAAAGGGAACACCCATTGGG - Intronic
1181987251 22:26808786-26808808 TGGGAGACAGGACAGCCAGTTGG - Intergenic
1183099296 22:35574227-35574249 GGGGAGAGGGGACATTCTTTGGG - Intergenic
1183618016 22:38956741-38956763 CAGGACAGGGGACAGCCCCTGGG + Intronic
1184375916 22:44112456-44112478 AGGCAGAGGGGACAGCCAGGAGG - Intronic
952175920 3:30862791-30862813 AGGAAGAGGGGACATACATTTGG - Intronic
953348712 3:42198232-42198254 CAGGAGAGGGGACATCCATCTGG + Intronic
954034562 3:47844260-47844282 AGGAAGAGGGGACAGGCAATTGG + Intronic
954383005 3:50229553-50229575 TGTGAGAGGGGACTGCCATGAGG - Intronic
954410534 3:50368768-50368790 AGGCAGAGGGAACAGCCAGTCGG - Intronic
961770920 3:129249479-129249501 CGGGAGTGGGGAAAGCCAGACGG - Intergenic
962636715 3:137339023-137339045 CAACAGAGGGGACAGGCATTGGG - Intergenic
963751008 3:149180041-149180063 CGGGAAAGGTGCCAGCCACTGGG - Intronic
963966553 3:151378109-151378131 CTGGAGAAGGGACAGCACTTGGG + Exonic
965423330 3:168490006-168490028 CAGTAGAGGGGACATCCTTTGGG + Intergenic
968467799 4:761567-761589 CGGGATAGGAGACAGCCCTAAGG + Intronic
968561506 4:1285577-1285599 CTGGAGTGGGGACAGCCTTGTGG + Intergenic
969663365 4:8543326-8543348 GGGCAGTGGGGACAGCCATGAGG - Intergenic
976104356 4:81600995-81601017 GGCTAGAGGGGACAGCCATGGGG + Intronic
976213649 4:82695044-82695066 CTGAAGTGGGGACAGCCATGTGG + Intronic
976981938 4:91243032-91243054 TGGGAGAGGGGAGAGGCACTGGG - Intronic
985663326 5:1168390-1168412 TGGGAAAGGGCACAGGCATTTGG - Intergenic
986693239 5:10331196-10331218 AGGGAGAGGGGAGAGCCAGCCGG - Intergenic
987898883 5:23984730-23984752 TGGGAGAGGGGTAAGCAATTTGG - Intronic
988678843 5:33463755-33463777 CTGGCGAGGGGACAGCCAAAAGG - Exonic
988778641 5:34499456-34499478 CAGGAGAGGGGACAGGCATTAGG - Intergenic
990308640 5:54517918-54517940 CGGGAGTCGGGACCGCCAGTCGG + Exonic
991492241 5:67194744-67194766 AGGGTGAGGGGACAGCCTTCTGG + Intronic
991501114 5:67278672-67278694 CGGGAGAGGGGAAATCCCTGTGG + Intergenic
994434229 5:99707769-99707791 GGGGAGAGGGTGCAGGCATTGGG + Intergenic
995627153 5:114092151-114092173 CGGGGGTGGGTACAGGCATTGGG + Intergenic
995685580 5:114768423-114768445 GGGGAGAGAGGACAGCAATAAGG - Intergenic
997369379 5:133348399-133348421 AGGGAGAGGGGAAAGGAATTTGG + Intronic
998591387 5:143482435-143482457 TGGGTGAGGGGCCAGCCATGAGG - Intergenic
1001673282 5:173491974-173491996 CGGGAGATGCCACAGCCATTTGG + Intergenic
1002495118 5:179606466-179606488 TGGGAGAGGAGGCAGACATTCGG + Intronic
1004534817 6:16490391-16490413 GAAGAGAGAGGACAGCCATTTGG - Intronic
1005993004 6:30914936-30914958 CGGGAGATGGGAGATCCATGGGG - Exonic
1006918785 6:37614094-37614116 TGGGAGTGGGGACAGGTATTGGG + Intergenic
1007733351 6:43965212-43965234 CGGGAGAGGGTGCAGCAAGTTGG - Intergenic
1007735751 6:43981351-43981373 TGGGAGAGGGGACAGTGAGTTGG + Intergenic
1014023558 6:116618167-116618189 GGGCAGAGGGAACAGCCATGGGG - Intronic
1016882148 6:148921825-148921847 CGGCAGTGGGGACAGCCAACTGG - Intronic
1017771843 6:157650116-157650138 CGGGAGAGGGGCCAGCTTCTGGG + Intronic
1018065027 6:160118730-160118752 TGGGAGAGGGGCCAGGCAGTGGG + Intergenic
1021848857 7:24788379-24788401 CTGAGGAGGGGACAGCCATCGGG - Intergenic
1027236936 7:76303751-76303773 CGGGGGAGGGGACTGCCTTTCGG - Intronic
1027374373 7:77536565-77536587 GGTGAGAGTGGACAGCAATTAGG - Intergenic
1029996418 7:105012705-105012727 CGGGGGAGGGGACAGGGCTTGGG - Intergenic
1030763484 7:113379897-113379919 CCGGTGAGAGGACAGCTATTGGG + Intergenic
1031067771 7:117124810-117124832 CAGGTCAGAGGACAGCCATTTGG + Intronic
1033566218 7:142580717-142580739 CAGGAGAGGTGACAGCTAATGGG + Intergenic
1034417106 7:150971019-150971041 CTGGGGAGGGGTCAGCCATGAGG + Intronic
1034425054 7:151009792-151009814 AGAGGGAGGGGACAGCCTTTTGG - Intronic
1034525454 7:151657460-151657482 TGGGAGTGGGGAGTGCCATTTGG + Intronic
1036563524 8:9918460-9918482 CGGGGGAGGAGGTAGCCATTAGG + Intergenic
1038680107 8:29658878-29658900 CGTGAAAGGTGACAGCCACTGGG - Intergenic
1038809293 8:30823509-30823531 CTGGAGATGGAATAGCCATTTGG + Intergenic
1042128230 8:65560337-65560359 CGGGTGAGGGGGCCGCCATAAGG + Intergenic
1044700043 8:94957462-94957484 AGTGAGAAGGGACAGCCAATGGG + Intronic
1044904877 8:96990204-96990226 AGGGAGAGGAGACATCAATTTGG - Intronic
1048857138 8:138695007-138695029 AGGCAGAGGGAACAGCCTTTGGG - Intronic
1049668406 8:143859018-143859040 CGGGCGAGGGGACGGCGACTCGG - Exonic
1049668825 8:143860626-143860648 CGGGCGAGGGGACGGCGACTCGG - Exonic
1049669240 8:143862228-143862250 CGGGCGAGGGGACGGCGACTCGG - Exonic
1049669652 8:143863821-143863843 CGGGCGAGGGGACGGCGACTCGG - Exonic
1049670067 8:143865429-143865451 CGGGCGAGGGGACGGCGACTCGG - Exonic
1056950568 9:91037637-91037659 CGGGAGGGGGGACAGCAGTGGGG - Intergenic
1057083406 9:92189067-92189089 CGGGGGTGGGCACAGCCACTTGG - Intergenic
1059302146 9:113322679-113322701 CAGGTTAGGGGACAGCAATTGGG + Intronic
1059658060 9:116374446-116374468 TGGGAAAGGGGACAGGCAGTGGG - Intronic
1060819163 9:126651616-126651638 GGGGAGAGGGGTCAGGCAGTGGG - Intronic
1061272198 9:129549990-129550012 GGGGAGAGGGGACGGCCAGCGGG + Intergenic
1061318727 9:129814514-129814536 AGGGAGAGGGCACACCCAGTAGG - Intronic
1061815519 9:133192252-133192274 CCAGTGAGGGGAAAGCCATTGGG - Intergenic
1061825891 9:133257929-133257951 AGGGAAAGAGGACAGCCATGTGG + Intronic
1186619655 X:11225139-11225161 CGGGAGATGTTGCAGCCATTGGG + Intronic
1194701521 X:97119867-97119889 TGGGAGTGGGGCCAGCCCTTTGG - Intronic
1195238609 X:102927862-102927884 AGGGAGTGGGGATAACCATTAGG + Intergenic
1195288691 X:103410403-103410425 AGGGAGTGGGGATAACCATTAGG + Intergenic
1197263112 X:124337285-124337307 GGGGAGAGGGGACAGTGACTTGG - Intronic
1197407449 X:126069501-126069523 GGGGAGAGGGAACAGTCAATAGG + Intergenic
1198420637 X:136468225-136468247 AGTTAGAGGGGACAGCCAATGGG - Intergenic