ID: 1167323103

View in Genome Browser
Species Human (GRCh38)
Location 19:48808159-48808181
Sequence GACCCACGCTCTGATCACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167323103_1167323105 -6 Left 1167323103 19:48808159-48808181 CCGGGGTGATCAGAGCGTGGGTC 0: 1
1: 0
2: 0
3: 3
4: 137
Right 1167323105 19:48808176-48808198 TGGGTCCCCAGATTGCCTTTGGG 0: 1
1: 0
2: 2
3: 13
4: 128
1167323103_1167323104 -7 Left 1167323103 19:48808159-48808181 CCGGGGTGATCAGAGCGTGGGTC 0: 1
1: 0
2: 0
3: 3
4: 137
Right 1167323104 19:48808175-48808197 GTGGGTCCCCAGATTGCCTTTGG 0: 1
1: 0
2: 4
3: 16
4: 137
1167323103_1167323106 -3 Left 1167323103 19:48808159-48808181 CCGGGGTGATCAGAGCGTGGGTC 0: 1
1: 0
2: 0
3: 3
4: 137
Right 1167323106 19:48808179-48808201 GTCCCCAGATTGCCTTTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167323103 Original CRISPR GACCCACGCTCTGATCACCC CGG (reversed) Intronic
901264032 1:7895341-7895363 GAGTCTCGCTCTTATCACCCAGG - Intergenic
903688141 1:25147668-25147690 CTCCCATCCTCTGATCACCCAGG - Intergenic
904359151 1:29961013-29961035 TACCCAGGCTCAGATCAACCAGG + Intergenic
905344386 1:37301562-37301584 GACTGCCTCTCTGATCACCCAGG - Intergenic
906446818 1:45907484-45907506 GAGTCTCGCTCTTATCACCCAGG + Intronic
908466683 1:64402956-64402978 GAGCCACCCTCAGGTCACCCTGG + Intergenic
912307127 1:108579801-108579823 AACCCACTCTCTTATCACCCAGG + Intronic
921122892 1:212151920-212151942 GAGCCTCGCTCTTATCTCCCAGG - Intergenic
1062959397 10:1561527-1561549 GACCCCTTCTCTGTTCACCCAGG + Intronic
1064319070 10:14285180-14285202 GACCCTCACTCTTATCACGCTGG - Intronic
1065705662 10:28469504-28469526 GACCCCAGCCCTGACCACCCAGG - Intergenic
1065773829 10:29101412-29101434 GACCCAAGTTGTGATTACCCTGG + Intergenic
1073009095 10:100346549-100346571 CAGCCACGCGCTGCTCACCCGGG - Intergenic
1076954471 10:133688617-133688639 TACCTTTGCTCTGATCACCCAGG - Intergenic
1077526315 11:3067848-3067870 GACCCCCTCTCTGCTCACCAGGG + Intergenic
1080254255 11:30271395-30271417 GAGCCTCGCTCTTGTCACCCAGG + Intergenic
1081162992 11:39774308-39774330 TATCCTCGCTCTGATCACCTTGG - Intergenic
1082878010 11:58007685-58007707 GAGTCTCGCTCTTATCACCCAGG - Intergenic
1084747622 11:71183338-71183360 GAGCCCCTCTCTGCTCACCCGGG - Intronic
1102988859 12:117300449-117300471 CACCCTGGCTCTGACCACCCAGG + Intronic
1103174356 12:118849161-118849183 GACCCATGCTGATATCACCCAGG + Intergenic
1104978310 12:132561833-132561855 GAACCAGGCACTGAACACCCAGG - Intronic
1105390473 13:19972960-19972982 GAGTCTCGCTCTTATCACCCAGG + Intronic
1106941891 13:34789050-34789072 GAGCCTCGCTCTTGTCACCCAGG - Intergenic
1108802831 13:54120502-54120524 GACCCTCCCTCTTGTCACCCAGG - Intergenic
1115554038 14:34529988-34530010 GAGTCTCGCTCTCATCACCCAGG - Intronic
1118338419 14:64874904-64874926 GAACCAGGCTCAGATCATCCAGG - Intronic
1122791008 14:104184168-104184190 GAGCCACGGTCTGATTTCCCGGG + Intergenic
1202867390 14_GL000225v1_random:130765-130787 TACCTTTGCTCTGATCACCCAGG + Intergenic
1127959852 15:63882620-63882642 GGGCCAAGCTCTGAGCACCCTGG + Intergenic
1130846188 15:87748338-87748360 GAGCCTCGCTCTTGTCACCCAGG - Intergenic
1131034681 15:89214433-89214455 GAGTCTCGCTCTGGTCACCCAGG - Intronic
1131654411 15:94440763-94440785 CACCCACTCTCTGATTGCCCTGG - Intronic
1133275942 16:4638552-4638574 CACCCACGCATTGATCCCCCTGG - Intronic
1135975036 16:27103102-27103124 GAACCACGTACTCATCACCCTGG - Intergenic
1136112855 16:28075704-28075726 GACCCAGGCCCTGCTCACCGTGG - Intergenic
1137278060 16:46950427-46950449 GAATCTCGCTCTTATCACCCAGG + Intergenic
1139307827 16:66002819-66002841 GAGCCAGGCTCAGAACACCCTGG + Intergenic
1139819418 16:69708939-69708961 GAGTCTCGCTCTTATCACCCAGG + Intronic
1141501985 16:84450696-84450718 CACCCCCTCTCAGATCACCCAGG + Intronic
1142028966 16:87829054-87829076 GCCCCCCACTCTGACCACCCAGG - Intergenic
1142059059 16:88018132-88018154 GTCACACACTCTGCTCACCCTGG - Intronic
1143857604 17:9863840-9863862 GCCCCATGTTCTGATCATCCTGG + Intronic
1150056216 17:62019767-62019789 GAGCCTCGCTCTTGTCACCCAGG + Intronic
1150339684 17:64356498-64356520 GAGTCCCGCTCTTATCACCCAGG + Intronic
1152231752 17:79117402-79117424 ACCCCACGCTCCCATCACCCGGG + Intronic
1152650095 17:81488597-81488619 GAGCCCCGCTCTGGCCACCCGGG - Intergenic
1152965299 18:108955-108977 TACCTTTGCTCTGATCACCCAGG + Intergenic
1161285195 19:3464836-3464858 GGCCCACGCTTTGATCCCCAAGG - Intronic
1161395521 19:4043123-4043145 GACCCAGGATCCGGTCACCCTGG + Intergenic
1162373601 19:10292691-10292713 GGCCCAAGCTCTGGTCACACTGG + Exonic
1162983046 19:14251130-14251152 GAGTCTCGCTCTGAACACCCAGG + Intergenic
1162986718 19:14275430-14275452 GAGTCTCGCTCTTATCACCCAGG + Intergenic
1163139504 19:15336995-15337017 GAGCCTCGCTCTGTCCACCCAGG - Intergenic
1164566838 19:29331884-29331906 GACCGAGGCTCTGAGCAGCCAGG + Intergenic
1166945573 19:46394079-46394101 GACCCAAGCTCTGGCCACCAGGG + Intergenic
1167323103 19:48808159-48808181 GACCCACGCTCTGATCACCCCGG - Intronic
1167933081 19:52884264-52884286 GAGTCACGCTCTTATCACCCAGG + Intronic
926909287 2:17835284-17835306 GACCCTCACTCTTGTCACCCAGG - Intergenic
936256918 2:110923908-110923930 GAGTCTCGCTCTTATCACCCAGG - Intronic
936343733 2:111659575-111659597 GCCCCACGCCCTGATCTCCAGGG + Intergenic
936378392 2:111962471-111962493 GACTCACTCTGTCATCACCCAGG - Intronic
936662785 2:114560566-114560588 GCCCCACTCTCTCCTCACCCAGG - Intronic
937642410 2:124228546-124228568 TATCTAAGCTCTGATCACCCAGG + Intronic
937901336 2:127021692-127021714 GAGTCACGCTCTTGTCACCCAGG + Intergenic
938305777 2:130253159-130253181 GCCCCGCGCTCAGAGCACCCCGG + Intergenic
943597694 2:189878016-189878038 GACTCTCGCTCTTGTCACCCAGG + Intergenic
1169091710 20:2864914-2864936 GACCCTCGCCCTCCTCACCCAGG - Intronic
1170688941 20:18594600-18594622 TACCCAAGCTCTGAGCACCAAGG - Intronic
1170847831 20:19976955-19976977 TAACCACGCCCTGATCAACCAGG - Intronic
1171882999 20:30631747-30631769 GACCCTCTCTCTGACCACTCTGG + Intergenic
1172156291 20:32827380-32827402 GAGTCTCGCTCTTATCACCCAGG - Intronic
1173595868 20:44258129-44258151 GACCCAAGCATTGAGCACCCAGG + Intronic
1175769017 20:61611219-61611241 GCCCCACCCTCTGATCCCCAGGG - Intronic
1175800714 20:61799747-61799769 GGCCCACGCCCTGCCCACCCAGG - Intronic
1175945550 20:62556866-62556888 GGCCCAGCCTCTGATCACCGTGG - Intronic
1180187171 21:46145652-46145674 GACCCCCGCAGGGATCACCCGGG - Intronic
1181339326 22:22165748-22165770 GGCACAGGCTCTGATCAGCCAGG + Intergenic
1182689587 22:32149278-32149300 GACCCACTCTGTAATGACCCAGG + Exonic
1183513149 22:38247702-38247724 AACCCACACTCTGTTCAGCCAGG + Intronic
1183730213 22:39614362-39614384 GACCTACCCTCTGCTCTCCCCGG - Intronic
1184176140 22:42790241-42790263 GAGTCTCGCTCTTATCACCCAGG - Intergenic
1184651227 22:45920286-45920308 GACACATGCTCTGCCCACCCAGG - Intergenic
1185245221 22:49769731-49769753 GGCCCAGGCTCTGAGCACCCAGG - Intergenic
953864857 3:46575429-46575451 GGCCCAGGCTCTGAATACCCTGG + Intronic
954850854 3:53598821-53598843 GACCCAGTCTCTCAACACCCAGG - Intronic
957248556 3:77743430-77743452 GAGCCTCGCTCTTGTCACCCAGG - Intergenic
957514098 3:81229208-81229230 GAAGAACTCTCTGATCACCCTGG - Intergenic
960375934 3:116901143-116901165 GAGTCTCGCTCTGGTCACCCAGG - Intronic
961359302 3:126357171-126357193 GGCCAGCCCTCTGATCACCCGGG + Intronic
961639280 3:128354839-128354861 ATCCCAGGCTCTGATTACCCTGG + Intronic
963178072 3:142322647-142322669 GAACCTCGCTCTGTTCGCCCAGG - Intronic
967389003 3:188937395-188937417 GACCCACACTCCGATCCCCTTGG - Intergenic
968313657 3:197704406-197704428 GACTTACGCTCTTGTCACCCAGG - Intronic
968453919 4:687785-687807 GACCCAAGCTCTGCTCCGCCTGG + Intronic
969539061 4:7774493-7774515 GACCCACACGCTGCTCACCGAGG - Intronic
970401352 4:15720556-15720578 CACCCAGGCTCTTGTCACCCTGG - Intronic
974564253 4:63563675-63563697 GTCCCAAGATCTGATCCCCCAGG + Intergenic
975873779 4:78811997-78812019 GAGTCTCGCTCTTATCACCCAGG + Intronic
981847352 4:149184614-149184636 GAGTCTCGCTCTTATCACCCAGG - Intergenic
984251760 4:177344585-177344607 GAGTCTCACTCTGATCACCCAGG + Intronic
985464157 4:190178729-190178751 TACCTTTGCTCTGATCACCCAGG - Intronic
988614790 5:32764760-32764782 GACCCTCACTCTTGTCACCCAGG - Intronic
990079853 5:51899566-51899588 GACCTCCTCTCTGATCATCCCGG + Intergenic
993489972 5:88535304-88535326 GAGTCTCGCTCTGTTCACCCAGG + Intergenic
994411551 5:99412675-99412697 GACACACAGTCTGATCTCCCTGG + Intergenic
994482276 5:100352575-100352597 GACACACAGTCTGATCTCCCTGG - Intergenic
996432498 5:123397296-123397318 GAGCCTCGCTCTTGTCACCCAGG - Intronic
996642260 5:125770470-125770492 ATCCCACGCTCTGAGCAACCAGG + Intergenic
999508080 5:152219056-152219078 GGCCATCGCTCAGATCACCCAGG - Intergenic
1000916530 5:167088599-167088621 GAGTCTCGCTCTTATCACCCAGG - Intergenic
1001487233 5:172128365-172128387 GACTCTCGCTCTTGTCACCCAGG + Intronic
1001642602 5:173255509-173255531 GTCTCACTCTGTGATCACCCAGG + Intergenic
1004967967 6:20876165-20876187 GACTCAGGATCTGAGCACCCTGG + Intronic
1006508927 6:34511282-34511304 GTCTCACACTCTGATCACCTGGG + Intronic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1010963580 6:82176493-82176515 GACTCTCGCTCTTGTCACCCAGG - Intronic
1012361335 6:98384485-98384507 GACCCAGGCACTAATCAGCCAGG - Intergenic
1013486921 6:110606204-110606226 GACACACGCTGTGACCCCCCAGG + Intergenic
1017886868 6:158606928-158606950 GACCCACCCTCTCACCACCACGG - Intronic
1024537579 7:50450659-50450681 GAGCCACGCTTTGCTCTCCCAGG - Intronic
1027825652 7:83112081-83112103 GAGTCTCGCTCTTATCACCCAGG + Intronic
1029404770 7:100368012-100368034 GAGCCTCACTCTCATCACCCAGG + Intronic
1030834086 7:114262030-114262052 GAGTCTCGCTCTTATCACCCAGG - Intronic
1034844827 7:154434858-154434880 GAGTCTCGCTCTGGTCACCCAGG + Intronic
1034954913 7:155328128-155328150 GACCCCTGCTCAGACCACCCCGG + Intergenic
1036241639 8:7086620-7086642 GACTCTCGCTCTGGCCACCCAGG + Intergenic
1037890848 8:22623064-22623086 CAGCCACGCTCAGACCACCCGGG + Intronic
1038450248 8:27634729-27634751 GACCCACCCTCTGACCTCCTTGG + Intronic
1038657509 8:29467733-29467755 GAGCCTCGCTCTTGTCACCCAGG + Intergenic
1049208305 8:141373565-141373587 GACCCAGGCTCTGAACTCTCTGG + Intergenic
1049582686 8:143420056-143420078 GAGCCAAGCTCTGTTCCCCCAGG + Intronic
1055565395 9:77563314-77563336 GACCCACTCTCTTGTCACCATGG - Intronic
1061482797 9:130905381-130905403 GATCCACGCCCTGACCACACAGG - Exonic
1203737352 Un_GL000216v2:149299-149321 TACCTTTGCTCTGATCACCCAGG - Intergenic
1185862644 X:3593501-3593523 GAGTCTCGCTCTTATCACCCAGG + Intergenic
1187570130 X:20492463-20492485 AATCCACACTCTGATCAGCCTGG - Intergenic
1189512954 X:41681918-41681940 GAGTCTCGCTCTTATCACCCAGG - Intronic
1193486605 X:82091445-82091467 CACTCAGGCTCTGGTCACCCAGG + Intergenic
1196708476 X:118738299-118738321 GTCCAACAATCTGATCACCCAGG + Intronic
1197815424 X:130493389-130493411 GACTCATGCTCTGGTCTCCCTGG - Intergenic