ID: 1167323286

View in Genome Browser
Species Human (GRCh38)
Location 19:48809503-48809525
Sequence GGGGGCAGTTCTAGACGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167323286_1167323295 14 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1167323295 19:48809540-48809562 CTCTCCCCCATCACAGACCAGGG 0: 1
1: 0
2: 1
3: 26
4: 303
1167323286_1167323287 -10 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 86
1167323286_1167323294 13 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1167323294 19:48809539-48809561 ACTCTCCCCCATCACAGACCAGG 0: 1
1: 1
2: 1
3: 47
4: 445
1167323286_1167323300 28 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1167323300 19:48809554-48809576 AGACCAGGGCTGTTCTATGATGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167323286 Original CRISPR GGGGGCAGTTCTAGACGTGA TGG (reversed) Intronic
901761970 1:11477711-11477733 GGGGGCAGTTCCTGGGGTGAAGG - Intergenic
904110967 1:28125760-28125782 GAGGACAGTTCTAGACAAGAGGG - Intergenic
905547307 1:38810084-38810106 CAGGGCAGTCCTAGAAGTGAAGG - Intergenic
906237162 1:44219005-44219027 GAGGGCACTTCTAGGAGTGAGGG - Intronic
1064345257 10:14526587-14526609 AGGGGCAGTTCTAGAGATAAAGG - Intronic
1066758750 10:38736101-38736123 GAGGGCAGGACTAGCCGTGAAGG + Intergenic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1072907509 10:99467994-99468016 GGGGGCTGTGCTAGAAGTCAGGG + Intergenic
1073525298 10:104175533-104175555 AGGGGCATTTGTAGACATGATGG + Intronic
1077044554 11:538618-538640 AGGGGCAGCTCTAGACGGGATGG + Exonic
1083179027 11:60972469-60972491 GGGGGCAGCTTGAGACGTGGGGG - Intronic
1084393209 11:68892004-68892026 GGGGACAGTGCTAGGCGTCATGG + Intronic
1086228902 11:84545320-84545342 GGAAGCAGTTTTAGAGGTGAAGG - Intronic
1089211801 11:116809007-116809029 TGGGGCATTTCTCGACCTGATGG - Intergenic
1091030248 11:132180523-132180545 GTTTGCAGTTCTAGACTTGAGGG - Intronic
1091834609 12:3576844-3576866 GGGAGCAGAGCAAGACGTGAAGG - Intronic
1096422805 12:51474716-51474738 GGGGGCAGATCCAGACATGTAGG + Intronic
1102677239 12:114667253-114667275 GGGGACAGTTCCTGACGTGTAGG - Intergenic
1103321402 12:120094680-120094702 GGGGGCAGTGCCAGGCGGGAGGG - Intergenic
1107659847 13:42627411-42627433 GGGGGCTATACTAGTCGTGAGGG + Intergenic
1108104859 13:46997899-46997921 GGGGACAGTTGGAGAGGTGATGG - Intergenic
1110401097 13:75092947-75092969 GGGGGCAGATCAAGAGGTCAGGG + Intergenic
1116780149 14:49228069-49228091 ATGGGCAGTTCTAGACTTGTTGG - Intergenic
1125320622 15:38484306-38484328 GGGGGCATTTCTGGAGGTGGTGG - Exonic
1129292779 15:74581150-74581172 GAGGGCAGGTCTACAAGTGAGGG - Intronic
1138654412 16:58482490-58482512 GGGGACAGTGCTACACATGAAGG - Intronic
1146481833 17:33211125-33211147 GGGGACAGTTCCAGGGGTGACGG + Intronic
1148735894 17:49864665-49864687 GGGGGCAGATATACACGTGCAGG + Intergenic
1151664910 17:75540305-75540327 GGGGGCTGGTCTAGACCTGGCGG - Intronic
1152768516 17:82153774-82153796 TGGGGCAGTCCTAGGCGTGGGGG - Intronic
1158159570 18:54465663-54465685 GGCTGCAGTTCCAGACTTGAGGG + Intergenic
1159909995 18:74136850-74136872 GGGGGCAGTTCTAGGGATAAAGG + Intronic
1162890322 19:13728145-13728167 GGGGACAGTGCTCGAGGTGATGG - Intergenic
1164405485 19:27941731-27941753 GCGAGCAGTTCTAAAAGTGAGGG + Intergenic
1166685584 19:44794228-44794250 GGGGGCAGATCTGGCCGTGGGGG - Exonic
1167323286 19:48809503-48809525 GGGGGCAGTTCTAGACGTGATGG - Intronic
925521517 2:4751348-4751370 GGAGGCAGTGGTAGAGGTGAGGG + Intergenic
927852975 2:26511299-26511321 GGGGGCAGTTCTAGGGGTGTAGG + Intronic
931266032 2:60661119-60661141 GGGGGCAGATCTAGATTTGGGGG - Intergenic
932101748 2:68907746-68907768 GAGGGCAGTGTTAGACATGAGGG + Intergenic
935468032 2:103422733-103422755 GGGGGCAGTTCATGAATTGAAGG - Intergenic
937215995 2:120313976-120313998 GAGGGCAGTCCTTGAAGTGAAGG - Intergenic
948980159 2:241490385-241490407 GCTGGCACTTCTTGACGTGAGGG - Intronic
1168801200 20:644367-644389 GGGGGCTGTTTTAGACGCTATGG + Intergenic
1174487980 20:50873140-50873162 GCCGGCAGCTCTAGATGTGATGG - Intronic
1184748379 22:46469905-46469927 AGGAGCTGTTCTAGATGTGACGG - Intronic
950765572 3:15270586-15270608 GGGGGCAGCTCTAGACGTGGTGG - Intronic
954811273 3:53249832-53249854 GGGGACACTTCTAGAGGTCAGGG - Intronic
964759617 3:160122326-160122348 GGGGGCTGTGCTAGAGGTGGGGG + Intergenic
966236131 3:177703877-177703899 GGGGGCAGTTGCAGGCGAGATGG - Intergenic
976112302 4:81688952-81688974 GGGAGCAGTGGTAGAGGTGATGG + Intronic
977019910 4:91746338-91746360 GAGGGAAGTTCTAGGGGTGAAGG + Intergenic
994898791 5:105744149-105744171 GGTGGCAGTTCCAGACTTGAGGG - Intergenic
997574954 5:134967644-134967666 GGGGGCACTTCTTGAAGGGAGGG + Exonic
1004021891 6:11783440-11783462 GAGGGCAGTTGTAGAAGGGATGG - Intronic
1005922650 6:30415783-30415805 GGGGGCAGCCCTAGCCCTGAGGG - Intergenic
1011017469 6:82772984-82773006 GGGGGCAGATTTAGCGGTGAGGG - Intergenic
1011657313 6:89563698-89563720 GGGGGCAGTTTAAGAAGGGATGG - Intronic
1012013205 6:93819341-93819363 GTGGGAAGTTTTTGACGTGAAGG - Intergenic
1013177358 6:107689291-107689313 TGGAGCAGTTCTAGATGAGAGGG + Intergenic
1022456072 7:30559480-30559502 GGGGGCAGAAGTAGAGGTGAGGG - Intergenic
1026969759 7:74460849-74460871 GGGGGCGGTTGTGGACTTGAGGG + Intronic
1031757304 7:125661290-125661312 GGGAGAAATTCTAGAGGTGAAGG + Intergenic
1036723940 8:11201753-11201775 GGGGGCAGTGCCAGACGTTTTGG + Intergenic
1040080042 8:43276000-43276022 GGGGCCAGCTCTGGAGGTGAAGG + Intergenic
1040850937 8:51899566-51899588 GGGGGAACTTCTGGACGTCAAGG - Intergenic
1049139827 8:140943211-140943233 GGGGGCACTTCTTGGGGTGATGG - Intronic
1049462530 8:142736735-142736757 GGAGGCAGTTCTGGATGTGCAGG - Exonic
1049708633 8:144053951-144053973 GGGGACAGTTTTAGAGGTGGAGG - Intronic
1052397845 9:27962525-27962547 GGGAGCAGTTCCAGATGTAAAGG - Intronic
1055518421 9:77056465-77056487 GGAGGCAGCTCTAAACTTGATGG - Intergenic
1060490532 9:124080862-124080884 AGGGGCATTTCAAGAAGTGAAGG + Intergenic
1061135963 9:128733652-128733674 GGGGGCAGTGCTAGAAATGGGGG + Intronic
1186588455 X:10902124-10902146 AGGGGTAGTGCTAGACATGAGGG + Intergenic
1196946023 X:120827221-120827243 GGGGCCTGTTATAGAGGTGAGGG - Intergenic