ID: 1167323286

View in Genome Browser
Species Human (GRCh38)
Location 19:48809503-48809525
Sequence GGGGGCAGTTCTAGACGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167323286_1167323287 -10 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data
1167323286_1167323295 14 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC No data
Right 1167323295 19:48809540-48809562 CTCTCCCCCATCACAGACCAGGG No data
1167323286_1167323300 28 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC No data
Right 1167323300 19:48809554-48809576 AGACCAGGGCTGTTCTATGATGG No data
1167323286_1167323294 13 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC No data
Right 1167323294 19:48809539-48809561 ACTCTCCCCCATCACAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167323286 Original CRISPR GGGGGCAGTTCTAGACGTGA TGG (reversed) Intronic