ID: 1167323287

View in Genome Browser
Species Human (GRCh38)
Location 19:48809516-48809538
Sequence AACTGCCCCCTTTATAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167323286_1167323287 -10 Left 1167323286 19:48809503-48809525 CCATCACGTCTAGAACTGCCCCC No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data
1167323281_1167323287 14 Left 1167323281 19:48809479-48809501 CCTTGTCACAGCCCACACATGAC No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data
1167323283_1167323287 2 Left 1167323283 19:48809491-48809513 CCACACATGACCCCATCACGTCT No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data
1167323282_1167323287 3 Left 1167323282 19:48809490-48809512 CCCACACATGACCCCATCACGTC No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data
1167323279_1167323287 25 Left 1167323279 19:48809468-48809490 CCGCAGTCTGCCCTTGTCACAGC No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data
1167323284_1167323287 -8 Left 1167323284 19:48809501-48809523 CCCCATCACGTCTAGAACTGCCC No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data
1167323280_1167323287 15 Left 1167323280 19:48809478-48809500 CCCTTGTCACAGCCCACACATGA No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data
1167323285_1167323287 -9 Left 1167323285 19:48809502-48809524 CCCATCACGTCTAGAACTGCCCC No data
Right 1167323287 19:48809516-48809538 AACTGCCCCCTTTATAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167323287 Original CRISPR AACTGCCCCCTTTATAGCCC AGG Intronic