ID: 1167325087

View in Genome Browser
Species Human (GRCh38)
Location 19:48819479-48819501
Sequence CAGATCAGGCAGGGCCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 749
Summary {0: 1, 1: 5, 2: 23, 3: 152, 4: 568}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167325087_1167325097 22 Left 1167325087 19:48819479-48819501 CCTTCAAGGCCCTGCCTGATCTG 0: 1
1: 5
2: 23
3: 152
4: 568
Right 1167325097 19:48819524-48819546 GCAACATCCCGTTCTCTCACTGG 0: 1
1: 0
2: 0
3: 5
4: 57
1167325087_1167325098 23 Left 1167325087 19:48819479-48819501 CCTTCAAGGCCCTGCCTGATCTG 0: 1
1: 5
2: 23
3: 152
4: 568
Right 1167325098 19:48819525-48819547 CAACATCCCGTTCTCTCACTGGG 0: 1
1: 0
2: 0
3: 8
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167325087 Original CRISPR CAGATCAGGCAGGGCCTTGA AGG (reversed) Intronic
900284848 1:1894189-1894211 CAGTACAGCCAGGGCCATGAAGG + Intergenic
900288069 1:1911249-1911271 CAGAGCCGGCAGGGCCCTGGTGG - Intergenic
900959017 1:5907568-5907590 TAGAACTGGCAGGGCCTTGGAGG - Intronic
901702898 1:11054871-11054893 CACATCATTCAGGGCCTGGAGGG + Exonic
901883110 1:12205383-12205405 CAGATCAGACAGGGCCTGGTAGG + Intronic
902408565 1:16199760-16199782 CAGACCATGAAGGGCCTTGTAGG - Intronic
902513206 1:16977093-16977115 CAGATCGGTAAGGGCCTTGCCGG - Exonic
902882828 1:19384188-19384210 CAGGTCTGGCAGGGTCTTGAAGG - Intronic
903052168 1:20609531-20609553 CAGATCACACAGGGCCTTACAGG + Intronic
903311914 1:22465509-22465531 CAGGCCAGGCAGGGGCCTGAAGG - Intronic
903554553 1:24184054-24184076 CAGATTGGGTAGGGCCTTGGTGG - Intronic
903926027 1:26831373-26831395 CAGATCATGCCTGGCCTAGAAGG + Intronic
904053485 1:27655362-27655384 TAGATCACGCAGGGCCTTGTAGG + Intergenic
904477483 1:30774592-30774614 CTGAGCAGGCATGGACTTGAGGG + Intergenic
905017780 1:34789341-34789363 CAGATCTTGCGGGCCCTTGAAGG - Intronic
905043023 1:34976168-34976190 CAAATCAGACAGGGCCTTGTAGG + Intergenic
905071621 1:35230813-35230835 CAGATCATGAATGGTCTTGAAGG + Intergenic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905400476 1:37699040-37699062 CTGCTCAGGCAGCGCCTTGTTGG + Intronic
905546876 1:38807207-38807229 CAGATCAGGAAGGGTCTTGTGGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906784017 1:48598116-48598138 CAGATCACACAGGGCCTTGAAGG + Intronic
906824068 1:48959864-48959886 CAGATCATGTAGGGCCTTGTAGG + Intronic
907021249 1:51068599-51068621 CAGATCATGAAGGGTCTTGTGGG - Intergenic
907324248 1:53626478-53626500 CAGGTCAGGGAGGGCCTCCACGG - Intronic
907469595 1:54664605-54664627 CCGACCAGGCAGGGCATTGAGGG + Intronic
907530221 1:55088037-55088059 CAGATCAAGCAAGGCCTTGTGGG + Intronic
907772947 1:57484221-57484243 CAGATCATCCTGGGCCTTGGGGG + Intronic
908582553 1:65531091-65531113 ATGATCAGGTAGGGCCTTGGAGG - Intronic
910322641 1:85965902-85965924 CAGGTCATGTAGGGCCTTGCAGG + Intronic
910662560 1:89689340-89689362 CAGATCACGTAGGGCCTTCTAGG + Intronic
910791395 1:91054761-91054783 CAGATGGTGCAGGGCCTTGCAGG + Intergenic
910806255 1:91192189-91192211 CAGACCAGGTAGGTCCTTGCAGG - Intergenic
910896744 1:92077746-92077768 GAAATCTGGCAGGGCTTTGAAGG + Intergenic
910902319 1:92134354-92134376 CAGATCATGGAGGGTCTTGCAGG - Intronic
911189998 1:94938591-94938613 CAGATGAAGCAGGGTTTTGAAGG + Intergenic
912373853 1:109194369-109194391 CTGGTCAGGAAGGGCCTTGAGGG - Intronic
912698478 1:111858748-111858770 CAGATCATGGAAGGCCTTGTAGG - Intronic
913286902 1:117234880-117234902 TAGATCATGTAGGGCCTTGTGGG + Intergenic
913467282 1:119156114-119156136 CAGCTCAGTCAGGTCCTTTAAGG + Intergenic
913483668 1:119314438-119314460 CACATCAGGAAAGGCCTTGCAGG + Intergenic
913589420 1:120309152-120309174 CAGTTCAGGCAAAGCCTTGGTGG + Intergenic
913618766 1:120589214-120589236 CAGTTCAGGCAAAGCCTTGGTGG - Intergenic
913958649 1:143323287-143323309 CAGAACAGGCAGGCCCATGGTGG + Intergenic
914052966 1:144148667-144148689 CAGAACAGGCAGGCCCATGGTGG + Intergenic
914126231 1:144817874-144817896 CAGAACAGGCAGGCCCATGGTGG - Intergenic
914571442 1:148921010-148921032 CAGTTCAGGCAAAGCCTTGGTGG + Intronic
914601390 1:149209252-149209274 CAGTTCAGGCAAAGCCTTGGTGG - Intergenic
915012422 1:152699663-152699685 CAGCCCAGGCAGGGGCCTGAAGG + Intergenic
915024950 1:152818873-152818895 GAGACCAGTCAGGGCCTTGAAGG - Intergenic
915113312 1:153578647-153578669 CAAATCATGCAGAGCCTTGTAGG + Intergenic
915189017 1:154133033-154133055 CAGATTAGGTAGGGCCTAGTAGG - Intronic
915276168 1:154789680-154789702 CAGGACAGGCAGGGCCTTGGGGG + Intronic
915647245 1:157281683-157281705 CAGATGGTGCAGGGCCTTGCAGG + Intergenic
915923991 1:160002365-160002387 CAGATCCTGCAGGGTCTTGTAGG - Intergenic
916395191 1:164379259-164379281 CATATCAGGAAGGGCCCTGTAGG + Intergenic
917739069 1:177945817-177945839 CAGAACAGGGAGGGCCTCTAGGG + Intronic
918327211 1:183421320-183421342 CAGATCATACAGGGCCTTGTAGG + Intergenic
918413264 1:184282470-184282492 CAGATCCTGCAGGGCCTTTCAGG + Intergenic
918897840 1:190370663-190370685 AAGGTAAGGCAGGGCCTTCATGG + Intronic
919436665 1:197571310-197571332 CAGATCATACAAGGCTTTGAAGG - Intronic
919525906 1:198650183-198650205 CAGGTCCCACAGGGCCTTGATGG + Intronic
919733753 1:200931316-200931338 CAGATCATGAAGGGTCTTGTGGG - Intergenic
919754315 1:201057158-201057180 CAGATCATCTAGGCCCTTGAAGG - Intronic
920034885 1:203059371-203059393 CAGTTCAGGAAGGGCCTTGCTGG - Intronic
920844122 1:209579249-209579271 CAGATCGTGCAAGGCCTTGAAGG - Intergenic
922011613 1:221594431-221594453 CAGATTACGCAGGGCCTCGGAGG + Intergenic
922249404 1:223834143-223834165 TAGCTCAGGCAGGGCCTTGTAGG + Intronic
922366708 1:224872039-224872061 CAGATTCTGCAGGGCCTTGAAGG + Intergenic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922541690 1:226425021-226425043 CAGAAAAGGCAGGGGTTTGAGGG + Intergenic
923616870 1:235545442-235545464 CAGGGCAGGCAGGGCCTTGGAGG + Intergenic
924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG + Intronic
924721502 1:246627274-246627296 AAGATCATGTAGGGCCTTGTAGG - Intronic
1063842833 10:10091219-10091241 AATATGAGGCAAGGCCTTGAAGG + Intergenic
1065679196 10:28211839-28211861 CAGATCACACAGGGCCTGAAAGG + Intronic
1066574498 10:36810693-36810715 GAGAAGAGGCAGGGGCTTGAAGG + Intergenic
1066962605 10:42235468-42235490 CAGAACAGGCAGGCCCATGGTGG + Intergenic
1069173363 10:65260485-65260507 CAGATCAGGCAGGGCCTTACAGG + Intergenic
1069750354 10:70741365-70741387 CAAATCAGGGATGGCCTTGATGG - Intronic
1069877777 10:71573767-71573789 CAGAAAAGGCAGTGCATTGAGGG + Intronic
1069899556 10:71699615-71699637 CCCATCAGCCAGGTCCTTGAAGG - Intronic
1070658464 10:78287619-78287641 CAGATCTTGCAGGGACTTCATGG - Intergenic
1070831807 10:79422397-79422419 CAGAGCAGGCTGGTCCTTGAAGG - Intronic
1071172943 10:82889011-82889033 CAGATCGGGAAGGTCCTTGAAGG + Intronic
1071476701 10:86031808-86031830 CAGGTCAGGTAGGGCTTTGTGGG - Intronic
1072149219 10:92672111-92672133 AAGACAAGCCAGGGCCTTGAGGG - Intergenic
1072185410 10:93033061-93033083 CAAATCATGTAAGGCCTTGAGGG + Intronic
1072565727 10:96615234-96615256 CAGATCACAAAGGGCCTTGTAGG + Intronic
1074726533 10:116315897-116315919 CAGATCCAGCAGGGCCTTGAAGG - Intergenic
1075258041 10:120940618-120940640 CAGAGCACGCAGGGCCTTGATGG - Intergenic
1075462524 10:122627018-122627040 CAGATCATTCAGGGCCTTGTGGG + Intronic
1075554695 10:123421901-123421923 CAGAGCACAAAGGGCCTTGAAGG - Intergenic
1077126775 11:942997-943019 CAGAACGTGCTGGGCCTTGAAGG + Intronic
1077198569 11:1293715-1293737 CAGAGCTGGCTGGGCCTTGGAGG - Intronic
1077413954 11:2415854-2415876 CAGCTCGGGCAGTGCCATGATGG + Intronic
1077649366 11:3956078-3956100 CAGATCATTCTGGGCCTTGCAGG + Intronic
1077900825 11:6486984-6487006 TGGATCATGCAGGGCCTTGTAGG - Intronic
1078134419 11:8640433-8640455 GAGAACAGGCAGGGCCAGGAGGG + Exonic
1078729127 11:13959984-13960006 CAGATCAAGCAGAGCCTTGGAGG + Intergenic
1079004823 11:16784130-16784152 CAGATCACTTAGGGCCTTGACGG - Intronic
1079619970 11:22542025-22542047 CAGATCATGCAATGCCTTGTGGG + Intergenic
1080068706 11:28052333-28052355 CAGATCACATAGGGCCTTGTAGG - Intronic
1080317361 11:30965433-30965455 AGGATCAGAGAGGGCCTTGAAGG + Intronic
1080368931 11:31611455-31611477 CAGATTAGGTAAGGCCTTGTAGG - Intronic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080580369 11:33637445-33637467 CAGATCATGCAGGGTCTTAAAGG - Intronic
1080742687 11:35080858-35080880 CAGGTCAGGGAGGGCCGTGAGGG - Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082742583 11:56927046-56927068 CAGATCAGGCCTGGCCTTGTTGG - Intergenic
1082758854 11:57106476-57106498 CAAATCACGTAGGGCCTTGTAGG + Intergenic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1083338976 11:61946296-61946318 CAGCTGAGGCAGGGCCTAGAAGG + Intergenic
1084942061 11:72618213-72618235 CAGAGCAGGCAGTGCCTGGATGG - Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085021535 11:73213254-73213276 CAGGTCACACAGGGCCCTGAAGG + Intergenic
1085151082 11:74253376-74253398 CAGATTTGCCAGGGCCTTGGTGG + Intronic
1085336182 11:75698241-75698263 AAGGTTATGCAGGGCCTTGAAGG - Intergenic
1085702493 11:78757407-78757429 CACACCAGGCTGGGCCTTGCAGG + Intronic
1085770297 11:79319596-79319618 CAGATCAGGCTGCGCGTTGCTGG - Intronic
1085807438 11:79649245-79649267 CAGATCAGACATGGCCTGGGTGG - Intergenic
1086513715 11:87588567-87588589 TAGACCATGCAGGGCCTTCATGG + Intergenic
1087017846 11:93571930-93571952 CACATCAGGCAGGACCTTAAAGG + Intergenic
1087670863 11:101105155-101105177 CAGATGCTGTAGGGCCTTGAAGG + Intronic
1087779875 11:102290770-102290792 CAGGACAAGCAGAGCCTTGAAGG - Intergenic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1088750706 11:112839941-112839963 CAGATCAGGCAGGCCCGAGGAGG + Intergenic
1089505526 11:118959478-118959500 GGGATCAGGCCTGGCCTTGAAGG - Intergenic
1090772631 11:129934650-129934672 CAGATCAGGTAGGGCCTTATGGG - Intronic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091449217 12:562226-562248 CAGAACAGGCAGGGTGATGAAGG + Exonic
1091700150 12:2653827-2653849 CACATAGGGCAGGGCCTGGAAGG - Exonic
1091704277 12:2683461-2683483 CAGATGAGACAGGGCTTTGAGGG - Intronic
1091761248 12:3088705-3088727 GGGATCAGGCTGGGCCTTGAGGG + Intronic
1091985417 12:4907318-4907340 CAGATCATGCAGGGCCTCTAAGG - Intergenic
1092343254 12:7694175-7694197 CAGAACAGGCAGGGCATGGTGGG + Intronic
1092391985 12:8088720-8088742 CAGATCACGCAGGGCCTTGTGGG - Intronic
1092870644 12:12802775-12802797 AAGATCAGGCTGGGCCATGGTGG + Intronic
1092955421 12:13545011-13545033 CAAGTCAGGTAGGGCCTTGTAGG - Exonic
1092995243 12:13943496-13943518 CAGTTCACGTAGGGCTTTGAAGG - Intronic
1093474502 12:19539687-19539709 TAGATCACGCAGGGCCTTAGAGG + Intronic
1094173140 12:27515321-27515343 CAGATCACTTAGGGTCTTGAAGG - Intergenic
1095700504 12:45186220-45186242 CAGATCATGTAGGGCCTTACAGG + Intergenic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1095926404 12:47583850-47583872 CAGACCATGTAGGGCCTTGGGGG + Intergenic
1096256982 12:50069032-50069054 CAGGTCACTCAGGGCCTTAAAGG - Intronic
1096684068 12:53276389-53276411 CAGATCACACAGGGCCTTATAGG + Intronic
1096971964 12:55673925-55673947 CAGATCACACAGGGCCTTATGGG + Intergenic
1097159035 12:57032753-57032775 CAGATCATGATGGGCCTTGTAGG + Intronic
1098384853 12:69907948-69907970 CAGAGCAGGGAGGGCCTTGCAGG - Intronic
1099203363 12:79700875-79700897 CAGATCATACAGGGTCTTAAAGG - Intergenic
1099210901 12:79787267-79787289 CAGATCATGCAGTGCCTTATAGG - Intronic
1099330876 12:81285176-81285198 CAGATCAGGCATATCATTGAAGG + Intronic
1101735402 12:107459537-107459559 CTGATCAGAGATGGCCTTGAAGG + Intronic
1102188942 12:110971325-110971347 CAAATCAGGCAGGGCTTAGCTGG + Intergenic
1102478489 12:113204275-113204297 CAGATCACACAGGGCCTTTGAGG - Intronic
1102510903 12:113414753-113414775 CACATCACGCAGAGCCTTGGAGG - Intronic
1102596584 12:113997385-113997407 CAGATCATGCAGGGACATGCAGG + Intergenic
1102612770 12:114127309-114127331 CAGACTAGGAAGGGCCTTAAAGG - Intergenic
1103172597 12:118834282-118834304 CAGATCATGCAGGGACATGTTGG + Intergenic
1103252086 12:119508681-119508703 CAGAGCACGCAGGGCCTTTGTGG + Intronic
1103387847 12:120547753-120547775 CAGATCATGTGGGGCTTTGAAGG + Intronic
1103743322 12:123105970-123105992 CAGGACAGGCAGGGCCAGGAAGG - Intronic
1103813545 12:123634818-123634840 CAGGTCATGCAGGGCCTTATTGG + Intronic
1103898448 12:124289962-124289984 CAGCTCAGACAGGGCCTGTAAGG + Intronic
1104072345 12:125356703-125356725 CAGACCACGCAGGGCCTTGTAGG - Intronic
1104280474 12:127372125-127372147 CAGACCGGGAAGGGCCCTGAAGG - Intergenic
1104749066 12:131227042-131227064 CAGCTCAGGCAGGTCCTAGAAGG + Intergenic
1104934971 12:132359726-132359748 CAGATGTGGCAGGGGCTTCATGG - Intergenic
1106041704 13:26099831-26099853 CAGATCAAGCAAGTCCTTGCTGG + Intergenic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106518938 13:30479930-30479952 CAGATTAGGGAGGGCCCTGAGGG - Intronic
1107175219 13:37391953-37391975 CAGATCATGTAGGGCTTTGCAGG + Intergenic
1107975423 13:45683828-45683850 GAGGTCATGTAGGGCCTTGAGGG - Intergenic
1108126939 13:47254853-47254875 CAGATCATGTTGGGCCTTGAAGG + Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1108501393 13:51072715-51072737 CAGATCAGTCAGGGCCATCTTGG + Intergenic
1108703707 13:52965977-52965999 CAGGTCAGGCAGGGCCTCATAGG - Intergenic
1110145740 13:72188207-72188229 CAGACCATGCAGGGTCTTAAAGG - Intergenic
1110177470 13:72574125-72574147 CAGATGGGGCAGGGGCTTGCGGG + Intergenic
1110391942 13:74984256-74984278 AAGATCATAGAGGGCCTTGAGGG - Intergenic
1111073422 13:83200127-83200149 CAGTTCACACAGGGCCTTGAAGG - Intergenic
1111698974 13:91661843-91661865 CAGATCATTCAGGGCCCTGTGGG + Intronic
1113028808 13:105971303-105971325 CAGATCAAGTAGGGCCTTCCAGG - Intergenic
1113288345 13:108878515-108878537 CAGATCACACACGGACTTGAAGG - Intronic
1113578904 13:111414287-111414309 TAGATGAGGCAGGGACTTGGGGG + Intergenic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1115732666 14:36287994-36288016 CAGATCATGTAGGGCCCTGTAGG + Intergenic
1115964928 14:38877373-38877395 CTGAGCAGGCATGGCCTTCAGGG - Intergenic
1116901523 14:50366457-50366479 CAGATCCTACAGGGCCTTGCAGG + Intronic
1117050132 14:51851538-51851560 TTGATCAGGCAGGGTCTTGATGG - Intronic
1117803624 14:59468288-59468310 CAAATCATGCAGTGCCTTGTAGG - Intronic
1117937138 14:60919245-60919267 CAGATCACTCAGGGTCTTGTGGG + Intronic
1118221238 14:63856195-63856217 CAGATCATGCAGGGCCTTTCTGG + Intronic
1118866754 14:69710475-69710497 CAGCTCAGGCATGGCCTGCAAGG - Intronic
1119215926 14:72869010-72869032 CTGGTCATGAAGGGCCTTGATGG - Intronic
1119516041 14:75249172-75249194 CAGAGGAGGCAGGTCTTTGAGGG + Intronic
1119557558 14:75565421-75565443 CAAATCTTGCAGGGCCTTGTGGG - Intergenic
1119718298 14:76874172-76874194 CAGGTCAGGTGGGGGCTTGAAGG + Intergenic
1119718926 14:76878135-76878157 CAGGTCAGGTGGGGCCTTGAGGG + Intergenic
1119959062 14:78834134-78834156 AGGATCAGGCAGGGTCTTGCTGG + Intronic
1120013670 14:79445814-79445836 CAGATCATGGAGGGCCTTTGGGG + Intronic
1120991312 14:90379928-90379950 CAGATTATGGAGGGCCCTGAAGG + Intergenic
1121240614 14:92427407-92427429 CAGACCGTGCAGGGCCTTGAAGG + Intronic
1121486672 14:94321678-94321700 CAGATGAGGCAGGGAGATGAGGG - Intronic
1121691931 14:95884255-95884277 CAGATCGTGCAGGGCCCTGAGGG - Intergenic
1121805929 14:96822832-96822854 GAGATCAAGTAGGGCCTTGAAGG - Intronic
1122552727 14:102558765-102558787 CTCAACAGGCAGGGCCCTGAGGG - Intergenic
1123030858 14:105450428-105450450 CAGAACAGCCTGGGCCTAGAGGG - Intronic
1202929762 14_KI270725v1_random:26905-26927 CAGAACAGGCAGGCCCATGGTGG - Intergenic
1123412947 15:20074210-20074232 CAGGACACGCAGGGCCTGGATGG - Intergenic
1123422542 15:20144339-20144361 CAGAACAGGCAGGCCCATGGTGG + Intergenic
1123522289 15:21081323-21081345 CAGGACACGCAGGGCCTGGATGG - Intergenic
1123531770 15:21150879-21150901 CAGAACAGGCAGGCCCATGGTGG + Intergenic
1124892228 15:33743960-33743982 CAGATCAGGCAGTGCCTACCAGG - Intronic
1125102745 15:35933822-35933844 CAGATCATCCAGGGCCTTGTTGG + Intergenic
1125306356 15:38320392-38320414 CAGCTCATGCAGGGCCTAGTAGG + Intronic
1125841612 15:42806502-42806524 CAGATAATGCAGGGCCTTGTAGG - Intronic
1125896733 15:43308781-43308803 CAGATCATGCAGAGCTTTGGGGG - Intergenic
1126150335 15:45518034-45518056 GAGATCAGGCAGGCCCTGGTAGG - Intronic
1126559227 15:50025333-50025355 CAGACCCTGCAGGGCCTTCAAGG - Intronic
1126564941 15:50085103-50085125 AAGATTAGGCAGGGCCCTGAAGG - Intronic
1127440549 15:59002714-59002736 CAGATCAGGTAGAGCCTGTAGGG - Intronic
1127826464 15:62708407-62708429 CAGAGCAGGAAGGGCTTTGATGG + Intronic
1128280928 15:66393652-66393674 CTGGTCAGGTAGGGCCTTGTAGG - Intronic
1128562747 15:68679288-68679310 CAGAGCTGGAAGGGCCCTGATGG + Intronic
1129624534 15:77182792-77182814 CAGATCATGCAAGGCCTTTTAGG + Intronic
1130318449 15:82817360-82817382 CAGACCATGCAGGGGCTTGTGGG + Intronic
1130358684 15:83159852-83159874 CAGATTATTTAGGGCCTTGAAGG + Intronic
1130665596 15:85866771-85866793 CAGACCATGCAGGGCTGTGAAGG - Intergenic
1131585593 15:93689604-93689626 CAGTTTATGCAGGGCTTTGAAGG + Intergenic
1131623843 15:94097060-94097082 CAGAACATTCAGGGCCTTGTAGG + Intergenic
1131757944 15:95586309-95586331 CAGGTCAGGCAGGTCTTTTAGGG + Intergenic
1132321619 15:100929744-100929766 CAGGGCAGGCAGGGCCTTGCAGG + Intronic
1132345048 15:101102998-101103020 CAGACCAGACAGGGCCTTGCAGG - Intergenic
1132769643 16:1554172-1554194 CAGCTCAGGCAGGGCGGAGATGG - Intronic
1133287295 16:4696623-4696645 CATACCAGGCAGGGCCCTGGGGG - Exonic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1134135731 16:11675174-11675196 CAGAACAGGCAGGTCCTTTGGGG - Intronic
1134666411 16:16022150-16022172 CAGGTCAGGCAGGGCGTGGGTGG + Intronic
1135589891 16:23697354-23697376 GGGCTCAGGCAGGGCCTTGCTGG + Intronic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136596421 16:31253254-31253276 CAGGTCATGCAGGTCCTTGTAGG + Intergenic
1136718747 16:32303519-32303541 CAGAACAGGCAGGCCCATGGTGG + Intergenic
1136837118 16:33509783-33509805 CAGAACAGGCAGGCCCATGGTGG + Intergenic
1137269449 16:46893857-46893879 CTGAGCTGGCAGGGCCCTGAGGG + Intronic
1137340011 16:47592339-47592361 CAGATCGGGAAGGGCCTTGCAGG - Intronic
1137358118 16:47786427-47786449 CAGATCATGTGGGGCCTTGCAGG - Intergenic
1137989207 16:53135240-53135262 CAGATTATACAGGGCCTTGTGGG + Intronic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1139310890 16:66027149-66027171 CAGGTCAGGCAGAGCATTCAGGG + Intergenic
1139505568 16:67396583-67396605 CAGATCTGTCAGGGCCCTGCAGG - Intronic
1139510992 16:67428530-67428552 CAGATAAAGCAGGGCCTGGCAGG - Intergenic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139608211 16:68035310-68035332 CAGATCATGTAGAGCCTTGTAGG - Intronic
1139656316 16:68389183-68389205 CAGAGCAGGGAGGGCCTGGGGGG + Intronic
1139739250 16:69021172-69021194 TAGATCATGAAGGGCCTTGCAGG - Intronic
1139957912 16:70701874-70701896 CAGAGCAGGCAGAGCCTCTAGGG - Intronic
1140476792 16:75242978-75243000 CAGGACACGCAGGGCCTGGACGG - Exonic
1140590256 16:76343444-76343466 AAGATCAGTCAGGGTTTTGAGGG - Intronic
1203007684 16_KI270728v1_random:214252-214274 CAGAACAGGCAGGCCCATGGTGG - Intergenic
1203147295 16_KI270728v1_random:1810062-1810084 CAGAACAGGCAGGCCCATGGTGG + Intergenic
1142501702 17:336713-336735 CAGATCATGGACGGCCTTGAGGG - Intronic
1143117288 17:4588231-4588253 CAGATCAGGCAGCACCCAGAAGG + Intronic
1143971815 17:10801389-10801411 CAGATCTGGCAGGGCCTCGAGGG - Intergenic
1144444606 17:15315301-15315323 CAGATCATGCAGGGCCCTAATGG + Intronic
1144761661 17:17710737-17710759 CAAATGAGGCAGGGCCTTGTGGG - Intronic
1145222115 17:21097891-21097913 CAGATCAGGAAGAGCCTTGTGGG + Intergenic
1145813185 17:27777124-27777146 CAGATCAGGCCTGTGCTTGACGG - Intronic
1145842042 17:28003400-28003422 CAGATCATGTAGGGCCCTAAAGG + Intergenic
1145973507 17:28970840-28970862 CAAGTTGGGCAGGGCCTTGAGGG - Intronic
1146241602 17:31233918-31233940 CAGATCAGGTAGAGCCTTGTAGG - Intronic
1146791803 17:35755074-35755096 TAGATCATGCAGGGCCTTGTAGG + Intronic
1146937209 17:36819323-36819345 CAGAGCAGGCAGGGCCTCCGAGG + Intergenic
1147449911 17:40497757-40497779 CAGATCCCGTAGGGCCTTGCAGG + Intronic
1147620507 17:41863605-41863627 CAGATCCCGTAGGGCCTTGATGG - Intronic
1148724519 17:49779176-49779198 CAGACCAGGCAGGACACTGAAGG + Intronic
1149627736 17:58091530-58091552 AAGCTCAGGCAGGTCCATGACGG - Exonic
1151295743 17:73184982-73185004 CAGGCCACGCAGGGACTTGAAGG + Intergenic
1152100220 17:78297078-78297100 CAGATCGGCCAGTGCTTTGATGG + Intergenic
1152145107 17:78563747-78563769 CGGAACAGGCAGGGGCTGGAAGG + Intronic
1152248768 17:79200591-79200613 CTGTTCAGGGAGGGCCTTGGTGG + Intronic
1152264798 17:79288031-79288053 CAGAGCAGGCAGGGCCTCGTGGG - Intronic
1152418038 17:80175720-80175742 CTGAACAGGCAGGGCCTGGCTGG + Intronic
1152588777 17:81200864-81200886 CGGAACAGGCAGGGCTATGAGGG + Intronic
1152687734 17:81702911-81702933 CAGAACAGGCAGAGCCTCCAAGG - Intronic
1153200602 18:2643684-2643706 AAGATCATGCAGGGCCTTGGAGG - Intergenic
1153340095 18:3964614-3964636 CTGATGAGGAAGAGCCTTGAAGG + Intronic
1153381574 18:4445857-4445879 GAGATTTGGCTGGGCCTTGAAGG + Intronic
1153464539 18:5374625-5374647 CAGATGATGCAGAGCTTTGAAGG - Intergenic
1154175799 18:12086837-12086859 CAGAACAGGCAGGGACATGGTGG - Intergenic
1154415633 18:14173992-14174014 CAGAACAGGCAGGGCCATGGTGG + Intergenic
1154955977 18:21255127-21255149 CAGATTATGAAGAGCCTTGAAGG - Intronic
1155337522 18:24780036-24780058 CAGATCACACAGGACCTTGTAGG - Intergenic
1155442937 18:25880976-25880998 CAGATCATGTAGGGTCTAGAGGG + Intergenic
1156809684 18:41232408-41232430 CAGATTATGTAGGGCCTTGTGGG - Intergenic
1157335868 18:46736952-46736974 CAGCTCAGGCTGGGCTTTGCTGG - Intronic
1158051324 18:53224392-53224414 CAGATCTGGCGGGGCTTTGTAGG + Intronic
1158623911 18:59055729-59055751 CAGGTCAGGCTGTGCCTGGATGG + Intergenic
1159579177 18:70216163-70216185 CAGGACAGGCTGGCCCTTGAAGG + Intergenic
1160132953 18:76245989-76246011 GAGATCAGGAGGGGCCTTCAGGG - Intergenic
1160452730 18:78977090-78977112 AAGATCCGGCAGAGCCTTGGAGG - Intergenic
1160940496 19:1618473-1618495 CAGGTCATGCGGGGCCTTGTGGG - Intronic
1161266991 19:3368714-3368736 CAGACCAGGCTGGGCCTTGGGGG - Intronic
1161286468 19:3471056-3471078 CAGGTCATTCAGGGCCTTGTGGG + Intergenic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161644489 19:5444680-5444702 TAGGTCATGCAGGGCCTTGTGGG - Intergenic
1162148624 19:8629428-8629450 CAGGTCATGAAGGGCCTTGTGGG + Intergenic
1162378147 19:10316953-10316975 CCGGACAGGCCGGGCCTTGAAGG + Exonic
1162544698 19:11321693-11321715 CAGATCATGCAGGGCCCCGGGGG + Intronic
1162679417 19:12328993-12329015 CAGAAAAGGCAGTGCTTTGAGGG + Intronic
1162829965 19:13278260-13278282 CAGATCGTGCAGGGGCTTGAGGG - Intronic
1162837869 19:13333163-13333185 CAGATCAAGCAGGGGCTTATAGG - Intronic
1163000130 19:14362063-14362085 CAGATCCTGCAGGGCCCTGTGGG + Intergenic
1163017802 19:14467481-14467503 CAGATCTTGCAGGGCCTCGGAGG + Intronic
1165322674 19:35095980-35096002 CAGATCCTGTAGGGCCTTGTGGG + Intergenic
1165475905 19:36030699-36030721 CAGATCTGGAAGGGCCTTCAAGG - Intronic
1165649172 19:37470557-37470579 CAGATTATGCAGGGCCCTGCAGG - Intronic
1165736976 19:38183150-38183172 CAGACCATGGAGGGTCTTGAGGG + Intronic
1166082390 19:40452162-40452184 CATATCAGGTGGGGCCTTGAGGG - Intronic
1166341151 19:42138001-42138023 CAGATCGCACAGGGCCTTGCAGG + Intronic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167487994 19:49774357-49774379 CAACTCAGGCAGGGTCTTGGTGG + Intronic
1167490637 19:49790999-49791021 CAGACCCTGCAGGGCCTTGTTGG - Intronic
1167564535 19:50248176-50248198 CAGATCATGCAGGGTCTTAGGGG + Intronic
1167611195 19:50508438-50508460 CAGACCACGCAGGGCCTTGTGGG - Intronic
1167690567 19:50982132-50982154 CACAGGAGGCAGGGCCTGGAGGG + Intronic
1202692362 1_KI270712v1_random:101090-101112 CAGAACAGGCAGGCCCATGGTGG + Intergenic
925093044 2:1170439-1170461 GTAATCAGGAAGGGCCTTGAAGG + Intronic
926146006 2:10397513-10397535 CAGAGCAGGCAGGGGCCTGGGGG - Intronic
926146044 2:10397657-10397679 TAGCTCAGGCAGGGCCAGGAAGG - Intronic
926311684 2:11680075-11680097 TAGATCAGGCAGGCCCCCGATGG + Intronic
926363612 2:12113175-12113197 CAGATCGTGCTGGGCCTTGTGGG + Intergenic
927026168 2:19071325-19071347 CAGTTCAGGCAGGCCATTTATGG + Intergenic
927238303 2:20898392-20898414 CATATCCTGCAGGGCCTTGCAGG - Intergenic
928405387 2:31010710-31010732 CTGATCAGGCAGGGCCTTGGGGG - Intronic
928440788 2:31290228-31290250 CAGGTCATGCAGGGCCTTAAAGG - Intergenic
929040211 2:37737234-37737256 CTGATAGGGCAGGGTCTTGAAGG + Intronic
929642355 2:43594631-43594653 CAGATTATTTAGGGCCTTGAAGG - Intronic
929893908 2:45941518-45941540 CAGAGAAAGCAGGGCCGTGAAGG + Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930099493 2:47591889-47591911 CAGAAAAAGCAGAGCCTTGAGGG - Intergenic
930277971 2:49335852-49335874 CAGATCATGCATGGCCATGCAGG + Intergenic
930604510 2:53479551-53479573 CAAGTCAGGCAGTGCCTTAAGGG - Intergenic
930656541 2:54012881-54012903 CAGAGCACTCAGGGCCTTGTAGG - Intronic
930886598 2:56333458-56333480 CAGATCACACAGGGCCCTGATGG + Intronic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
931648195 2:64444430-64444452 CAGCTCCTACAGGGCCTTGAAGG + Intergenic
932103607 2:68923515-68923537 CAGATGGGACAGGGCCTTGCAGG - Intergenic
932612484 2:73210165-73210187 CAGATCACCCAGGACCTGGAAGG - Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933599653 2:84316624-84316646 CACTTCAAGCAAGGCCTTGAAGG + Intergenic
933954035 2:87352881-87352903 CAGAACAGGCAGGCCCATGGTGG - Intergenic
934238238 2:90249124-90249146 CAGAACAGGCAGGCCCATGGTGG - Intergenic
934274959 2:91567609-91567631 CAGAACAGGCAGGCCCATGGTGG + Intergenic
934322357 2:91981651-91981673 CAGAACAGGCAGGCCCATGGTGG - Intergenic
934460658 2:94212463-94212485 CAGAACAGGCAGGCCCATGGTGG - Intergenic
937205048 2:120231026-120231048 CCGGTCAGCCAGGGCCTTGAAGG - Intergenic
937259204 2:120574711-120574733 CAGAGCTGGCAGGGGCTTGTAGG - Intergenic
938051887 2:128181065-128181087 CTGATCAGGTAGGCCCTTAAAGG + Exonic
938722555 2:134079446-134079468 CAGATCGGGCTGGGGCCTGAAGG - Intergenic
938810393 2:134847285-134847307 CTCATCAGACAGGGCCATGAAGG + Intronic
939829390 2:147054009-147054031 CAGGTCACACAGGGACTTGAAGG - Intergenic
940415683 2:153417298-153417320 CAGATGATGTAGGGCCTTGCAGG + Intergenic
940579815 2:155564270-155564292 CAAATTAAGTAGGGCCTTGAAGG + Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
941043992 2:160652296-160652318 CAGAGCATGCAGGGCCTTCTAGG - Intergenic
941721972 2:168821869-168821891 CAGATCATGCAGAGCTTTGCAGG + Intronic
941801916 2:169669325-169669347 CAGATCATACAGAGCCTTGGAGG + Intronic
942111349 2:172685391-172685413 CAGAACATGCAGAGCCTTGAAGG - Intergenic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
943626824 2:190210620-190210642 CAGAGCATACAGAGCCTTGAAGG - Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944395529 2:199262213-199262235 CAGATCATGTAGGGCCTTGCAGG + Intergenic
944825926 2:203483104-203483126 CAGATCAGGCAAGGCTTTATAGG + Intronic
945679785 2:212899895-212899917 CAGATCATTCAGGGCCTTATGGG + Intergenic
946333979 2:219025532-219025554 CAGGTCAGGCAGGGCTTCTAAGG + Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
947659636 2:231856912-231856934 CAAAGCACGCAGGTCCTTGAGGG + Intergenic
948202820 2:236142203-236142225 CAGATCACGTAGGACCTTGCAGG - Intergenic
948429680 2:237911651-237911673 CATCTCAGGCAGGGCCGTGCGGG + Exonic
948486330 2:238283604-238283626 CAGATCACGGAGTGCCTTGCGGG + Intronic
949030468 2:241794514-241794536 CTGATCAGGCAGGGCCATCAGGG - Intronic
1168874888 20:1164612-1164634 GAAATCAGGCAGGGCCCTGGAGG - Intronic
1168958152 20:1849054-1849076 CAGATCACACAGGGCCTTGAAGG - Intergenic
1168961021 20:1869963-1869985 AAGATAGGGCAGGGCCTTGGGGG + Intergenic
1169075478 20:2757403-2757425 CAGTTCAGGCAGGCCTGTGATGG + Intronic
1170301539 20:14889730-14889752 CAGATTATGTAGGGCCTTGGAGG + Intronic
1171152030 20:22835697-22835719 CAGATCCTGCAGGGCCTTGCAGG + Intergenic
1171328806 20:24319074-24319096 CAGATGAGGCAGGTCCAGGATGG + Intergenic
1172270824 20:33654872-33654894 CAGACAAGGCAGAGGCTTGAGGG + Intergenic
1172399550 20:34638076-34638098 CAGACCAGGCAGGGCCATGTGGG - Intronic
1172441986 20:34972208-34972230 CAGATCATTCAGAGCCTTGAAGG - Intergenic
1172836866 20:37878717-37878739 CGGATCTTACAGGGCCTTGAGGG + Intergenic
1172940849 20:38653441-38653463 CAGATGGTGCAAGGCCTTGATGG + Intergenic
1173007356 20:39150605-39150627 CAGATCAGGCAGGGGCCTAATGG + Intergenic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1173706046 20:45111034-45111056 CAGACCAGGCATGGCCTTATTGG - Intronic
1173833034 20:46104955-46104977 CAGATCTCGCAGGGCCTTGAAGG - Intergenic
1173916722 20:46713546-46713568 CAGATCCTGCAGAGTCTTGAAGG + Intronic
1173946359 20:46953933-46953955 CAGCTCACACAGGGCCTTGTAGG - Intronic
1174115299 20:48222837-48222859 CAGATCCTGCAGGCCCTTGTGGG + Intergenic
1174187885 20:48719941-48719963 CAGGTCAGGTATGGCCTTGTGGG - Intronic
1174199675 20:48798484-48798506 CAGAGCATGCAGGGCCTTCCAGG - Intronic
1174201341 20:48808690-48808712 CAGATTGCACAGGGCCTTGAGGG - Intronic
1174276751 20:49409621-49409643 CAGATCGGGCAGAGCTTTGAAGG + Intronic
1174276880 20:49410289-49410311 CTAATCAGGCAGAGCTTTGAAGG + Intronic
1174277371 20:49413752-49413774 CAGATCAGACAGGGTCTTGAAGG - Intronic
1174413823 20:50353734-50353756 CAGACCAGGCAGGGCCTTGCGGG + Intergenic
1174562158 20:51439137-51439159 CAGGTTGTGCAGGGCCTTGAGGG - Intronic
1175016112 20:55792289-55792311 CAGATCAGATACAGCCTTGAAGG + Intergenic
1175024665 20:55889156-55889178 CAGATTGTGCAGGGCCTTGTGGG + Intergenic
1175082585 20:56433433-56433455 AAAATCACACAGGGCCTTGATGG + Intronic
1175986193 20:62765229-62765251 CAGACCAGGGAGAGGCTTGAAGG - Intergenic
1176053983 20:63134877-63134899 CAGGGGAGGCAGGGCCTAGAGGG + Intergenic
1176074941 20:63244180-63244202 CAGGAGAGGCAGGGCCTTGGTGG - Intronic
1176591784 21:8655504-8655526 CAGAACAGGCAGGCCCATGGTGG - Intergenic
1176857695 21:13985284-13985306 CAGAACAGGCAGGGCCATGGTGG - Intergenic
1176866904 21:14058915-14058937 CAGAACAGGCAGGGCCATGGTGG + Intergenic
1176901283 21:14445244-14445266 CAGAACAGGCAGGGCATGGTGGG - Intergenic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1178097778 21:29234413-29234435 CAGATCACACATGGGCTTGAAGG + Intronic
1178142655 21:29701522-29701544 CAGATCACAGAGGGCCTTAAGGG + Intronic
1180274631 22:10632616-10632638 CAGAACAGGCAGGCCCATGGTGG - Intergenic
1180549110 22:16527560-16527582 CAGAACAGGCAGGCCCATGGTGG - Intergenic
1181355588 22:22294292-22294314 CAGAACAGGCAGGCCCATGGTGG + Intergenic
1181477365 22:23177088-23177110 GAGGTGAGGCAGGGCCTTGTAGG - Intergenic
1181520689 22:23447952-23447974 CAGCCCAGGCAGGGCCTCGGGGG - Intergenic
1181830265 22:25555008-25555030 CAGACCCTGCAGGGCCTTGGAGG - Intergenic
1181888521 22:26040848-26040870 CAGATGATGTAGGGCCTTGTAGG + Intergenic
1182482010 22:30615230-30615252 CAGGACAGGCAGGGGCTTGAGGG - Intronic
1182516847 22:30863885-30863907 CAGACCAGGCAGGGCCCTGAGGG - Intronic
1182642481 22:31779522-31779544 CAGTTCATGCAGGGCCTTCAAGG + Intronic
1182745745 22:32604293-32604315 TGGATCAGGCAGAGCCTTGGAGG - Intronic
1183380278 22:37487230-37487252 CAGCTCACGCAGGGCCTTGTGGG - Intergenic
1183738190 22:39655345-39655367 CGCATCAGGCAGGGACTTGCAGG + Intronic
1183831991 22:40423124-40423146 CATTTCAGGCCAGGCCTTGAAGG + Intronic
1183992335 22:41606054-41606076 CAGATCAGGTAGGTCCTGGGAGG + Intronic
1184020702 22:41819429-41819451 CAGCTGAGGCAGGGCCTTCAGGG + Intronic
1184419325 22:44370391-44370413 CAGAGCCTGCAGGGCCTTGTGGG + Intergenic
1184637801 22:45848971-45848993 CAGATCATGCAGGGTCTTCAAGG + Intergenic
950076552 3:10191458-10191480 TAGACCATGCAGGGCCTTGTAGG - Intronic
950113884 3:10438188-10438210 CAGGTCTGGAAGGGCCTTCAAGG - Intronic
950201657 3:11048682-11048704 CAGATCAGACAGGGCCTTGCAGG - Intergenic
950628385 3:14265142-14265164 CAGTTCAGGCAGGGCTTAGAGGG - Intergenic
951277798 3:20710949-20710971 CAGATCATGCAAGGCCTTGTAGG + Intergenic
952077862 3:29720042-29720064 CAGATCACATAGGGCCTTGTGGG - Intronic
952598786 3:35053112-35053134 CAGATCAAGTAGAGTCTTGAGGG - Intergenic
952845297 3:37683080-37683102 CAGATCCCACAGGGCCTTGAGGG - Intronic
952849193 3:37713779-37713801 CAGAGCAGCCCGGGCCTTTAGGG - Intronic
953484586 3:43283273-43283295 CAGATCAGGAAGGGCTTGGTAGG + Intergenic
954334826 3:49910099-49910121 CAGGTGAGGGAGGGCCTTGAGGG - Exonic
954473081 3:50715783-50715805 AAGATCATGGAGGGCCTTAAAGG + Intronic
954818522 3:53303808-53303830 CAGATAAGGTAGGGCCTCGTGGG + Intronic
955365595 3:58307212-58307234 CAGGTGAGGCAGAGCCTTGCAGG + Intronic
955552711 3:60101251-60101273 CACATTATGCAGGGCCTTGCAGG - Intronic
955632687 3:60991346-60991368 CAGATCAGGTGGGGCCTTGCAGG + Intronic
955763053 3:62309992-62310014 CTGATCAAGCAGGGCCTTAGAGG + Intergenic
956391088 3:68773305-68773327 CACATCAGGCAAGGTCTGGAAGG + Intronic
958822506 3:98991728-98991750 CAGGTCAGGCAGGAGCTTCAAGG - Intergenic
959399637 3:105883914-105883936 CAGACCATGCAGGGCTTTGTAGG - Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960486954 3:118264949-118264971 CAGATCATGTAGGGCCTTTCAGG + Intergenic
960548342 3:118944311-118944333 CAGATTAAGCAGAGCCTTGAAGG - Intronic
961697012 3:128712412-128712434 CAGATAGTGCAGGGCCTTGAAGG + Intergenic
963219171 3:142788060-142788082 CAGACCATGCATGGCCTTGTAGG + Intronic
963407771 3:144889591-144889613 CAGATCATGAATTGCCTTGAAGG - Intergenic
963847016 3:150169913-150169935 CAGTTCAGGCAAAGCCTAGATGG + Intergenic
964042815 3:152283673-152283695 CAAATCAGTAAGGGCCTTAAAGG - Intronic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964435996 3:156654412-156654434 CAAATCATGCATGGCCTTGTGGG + Intergenic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964763722 3:160158380-160158402 TGGATCATGCAGGGCCTTGTAGG - Intergenic
965503084 3:169479486-169479508 CAGACCATGCAAGGCTTTGAAGG + Intronic
965676768 3:171205786-171205808 CAGATCATTCAGGGCTTTGCAGG - Intronic
965690112 3:171346851-171346873 CAGATCATCCTGGGCCTTGTAGG + Intronic
965697856 3:171428016-171428038 CAGGTTTGGCAGGGCCTTGTAGG + Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
966351327 3:179035229-179035251 CAGATCATGTAGGGCCTTATAGG - Intronic
967399369 3:189043457-189043479 CATATCATGCAGGCCCTTTATGG + Intronic
967702578 3:192610704-192610726 CAGATCTTGCAGGGCCTTGCAGG - Intronic
967861639 3:194156330-194156352 CAGTTCACACAGGGCCTTGAAGG + Intergenic
967861645 3:194156363-194156385 CAGTTCACACAGGGCCTTGAAGG + Intergenic
968271110 3:197404346-197404368 CAGATCGGGAAGGGCCTTATAGG + Intergenic
968292858 3:197552461-197552483 CAGAACATGGAGGGCCTTGTAGG - Intronic
968329127 3:197849556-197849578 CAAATCAAGCAGGGACTTAAGGG - Intronic
968816676 4:2825039-2825061 CAGAGCAGGCAGGGCAGTGAAGG + Intronic
969298115 4:6281370-6281392 CAGGCCAAGCAGGGCCCTGAGGG + Intronic
969312902 4:6364381-6364403 CAGCTCCTGCAGGGCCTTGGAGG + Intronic
969642083 4:8405011-8405033 CTGCTCAGGCAGGGCCTGGCAGG + Intronic
970275180 4:14391972-14391994 CAGAGCATGCTGGGCCTTGAAGG - Intergenic
970404820 4:15752790-15752812 CAGATCAGGTCAGGCCTTGCAGG + Intergenic
970498984 4:16657569-16657591 CAGATAATGTAGGGCCTTGTAGG - Intronic
971124797 4:23741736-23741758 AAGGTCAGGCAGTGCCTTCAGGG + Intergenic
971130557 4:23804617-23804639 CAGACCATACAGGGCCTTGTAGG - Intronic
971132664 4:23830357-23830379 CAGAACAGGGAAGTCCTTGAGGG - Intronic
971947981 4:33306087-33306109 CAGATCACACATGGACTTGAAGG - Intergenic
972612475 4:40668380-40668402 CAGATCAGGAAAGGCCTTTCTGG - Intergenic
973104819 4:46322381-46322403 GAGATCGTGCAGGGCCTTGGAGG - Intronic
973656030 4:53048718-53048740 CAGATGACCCAGGGCCTGGAGGG - Intronic
973656213 4:53050763-53050785 CAGATGACCCAGGGCCTGGAGGG - Intronic
974003843 4:56536202-56536224 CAGATCAAGTGGGGCCTTGTAGG - Intronic
974010092 4:56598733-56598755 CAGATCATGTAGGGCCTTGTAGG + Intronic
974125075 4:57686102-57686124 CAGATAGTGCAGGGCCTTGAAGG - Intergenic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976278008 4:83298125-83298147 CACATCAGGCTGGGCAATGAGGG + Intronic
976585301 4:86790760-86790782 CAGATAATTCAGGGCCTTCAAGG + Intronic
978103051 4:104866815-104866837 CAGATCATACAGGTCCTTGTAGG - Intergenic
980916245 4:139035749-139035771 CAGATCGGGTAGGGCCTTGCTGG - Intronic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
981721695 4:147808417-147808439 CAGATCATGCAGGGTCTTTCAGG + Intronic
982161155 4:152570807-152570829 CAGATCAAGCATGGCCTTATAGG + Intergenic
984102124 4:175499369-175499391 CAGACCAGGGAGGGCCTGAAGGG - Intergenic
985575254 5:670813-670835 GAGAATAGGCAGGGCCTGGAGGG - Intronic
986351674 5:6885788-6885810 CAAATCACACAGGGCCTTGGGGG + Intergenic
987504819 5:18754295-18754317 CAGGTCACACAGGGACTTGAAGG + Intergenic
987783860 5:22472977-22472999 CAGATCAAGTAGGGCCTCAAAGG - Intronic
987960924 5:24807412-24807434 CAGATAATTCAGGGCCTTGAGGG + Intergenic
988490365 5:31700558-31700580 CTTAGCAGGCAGGGCCTTGCAGG - Intronic
989100403 5:37817962-37817984 CAGGTCAGGTAGGGCCTTTAGGG - Intronic
989541905 5:42627902-42627924 CAGATCATACAGGGGCTCGAAGG + Intronic
990911267 5:60854780-60854802 CAGGTCAAGAAGGGCCTTGTAGG - Intergenic
991515149 5:67427034-67427056 CAGATCTTGTAGGGCCTTGAAGG - Intergenic
991633779 5:68682555-68682577 CAGATTAGGCAGGCTCTTGCAGG - Intergenic
992763148 5:79969652-79969674 CAGACCAGGTAGGAGCTTGAAGG - Intergenic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
994926555 5:106123145-106123167 CAGTGCATGCAGGGCCTTTAGGG + Intergenic
995095906 5:108235660-108235682 CAGATCATGCGGGGCCTTATAGG - Intronic
995132232 5:108642735-108642757 CAGATCATGCAGAGCCTTCCTGG - Intergenic
995523899 5:113035531-113035553 CAGGTCAAGCAGGGCCTTAGAGG - Intronic
995624190 5:114058718-114058740 CAGATCCTGCAGGGCTTTGCAGG + Intergenic
995640843 5:114255546-114255568 CAGATAAGGCAGGGCCTTGTAGG + Intergenic
995864849 5:116680050-116680072 CAGGTCAGGCAAGACCTTGCAGG - Intergenic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
996843350 5:127872583-127872605 AAGATCAAGCAGGGACTGGATGG - Intergenic
996907614 5:128619533-128619555 CAGATCAGGGAGGGCTTTAAAGG + Intronic
996966032 5:129307448-129307470 CAGCTCAGGCGGGGCCAAGATGG - Intergenic
997367508 5:133335385-133335407 CTGAACAGCCAGGGCCGTGAAGG - Intronic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997739070 5:136237962-136237984 CAGACTACCCAGGGCCTTGAGGG - Intronic
997857195 5:137383008-137383030 CAGACCAGGCAGGGCCCTCAGGG - Intronic
997958890 5:138303413-138303435 CAGATCGTGTAGGGCCTTGTAGG - Intronic
997988065 5:138520357-138520379 CCCATGTGGCAGGGCCTTGATGG - Intronic
998021283 5:138773413-138773435 CAGATGAGGCAGTGTCTTCAGGG + Intronic
998151183 5:139758452-139758474 CAGAAAGGGCAGGGCCTCGAAGG + Intergenic
998189916 5:140014873-140014895 CAGATCAAATAGGGCCTTGTGGG - Intronic
998190161 5:140016912-140016934 GAGATCACACAGGGCCTTGGAGG + Intronic
998269876 5:140696990-140697012 CAGAACAAGCAGGCCCTGGAGGG + Exonic
998449292 5:142221840-142221862 CAGATCACACAGGGCTTTGGAGG + Intergenic
998692627 5:144604021-144604043 CAGATCAAGTAGGACCTTGCAGG + Intergenic
998855390 5:146390079-146390101 CAGTCCACGCAGGGCCTTGTGGG - Intergenic
999202875 5:149828743-149828765 GAGATCTGGAAGGGCCCTGAGGG + Intronic
999216179 5:149937322-149937344 CAGATCCAGCAGGGCTTTGGAGG + Intronic
999254802 5:150204369-150204391 CAGATAAGACAAGGCCTAGAAGG + Intronic
999412721 5:151366441-151366463 CAGCTCATGGAGGGCCTAGAAGG + Intergenic
999559162 5:152781166-152781188 CAGATCATGTAGGGCCTTGCAGG - Intergenic
1000222161 5:159224528-159224550 CAGGTCAGGCTGGGCCCTGTGGG - Intergenic
1000348271 5:160332488-160332510 CAGATCACACAGGGCCCTGTAGG - Intronic
1000999136 5:167988703-167988725 CAGATCATGCAGAGAGTTGAAGG + Intronic
1001017359 5:168153624-168153646 CAGATAATGCAGGGCCTTTGAGG + Intronic
1001186808 5:169581941-169581963 CACTTCAAGCAGGGCCTTGAAGG - Intergenic
1001238671 5:170051266-170051288 CAGATCATGGATGGCCTTGCAGG - Intronic
1001264928 5:170267355-170267377 CAGCTCAGGCAGGGCCTCGCAGG - Intronic
1001313267 5:170626057-170626079 CAGACCCTGCAGGGCCTTGCAGG + Intronic
1001517127 5:172363771-172363793 CAGATCAGGCAGGGCCTTTGGGG + Intronic
1001539600 5:172528138-172528160 GATATCAGGCATGGGCTTGAGGG - Intergenic
1001566484 5:172702750-172702772 CAGGTCAGGCAAGGCCCTGCAGG - Intergenic
1001820091 5:174703628-174703650 CAGAGCAGGCAGGGCCAGCAAGG - Intergenic
1002693402 5:181066630-181066652 CAGGCCAGGGAGGGCCTTGAAGG - Intergenic
1002693698 5:181070283-181070305 CAGGTCAGGGCGGGCCTTGAAGG - Intergenic
1002915554 6:1525421-1525443 CAGTTCAGGCAGGCCCAGGAAGG - Intergenic
1003455600 6:6278791-6278813 CAGATCAAGCAGGGCTTTGTAGG + Intronic
1007077114 6:39075012-39075034 CAGAGCTGGCAGGGCCTTACAGG + Intronic
1007219930 6:40270389-40270411 GAGATCAGGCAGGGCCTTGCAGG - Intergenic
1007304048 6:40890686-40890708 CAGAGCAGGGAGGGGCTTCAGGG - Intergenic
1007388233 6:41533808-41533830 CAGATGAGGCCAGGCATTGAAGG + Intergenic
1007468652 6:42073690-42073712 CAGATTGGGTAGGGCCTTGTAGG + Intronic
1007528078 6:42514341-42514363 CAAATCATGCAGGGGCTTGCAGG + Intergenic
1007603217 6:43096752-43096774 CAGCTCAGGCAGGGCCCTACCGG - Intronic
1009027557 6:58018153-58018175 AGGGTCAGGCAGGGACTTGAAGG + Intergenic
1009296869 6:61961780-61961802 AAAATCATACAGGGCCTTGAAGG + Intronic
1010705962 6:79111128-79111150 CAGAGGAGCAAGGGCCTTGATGG + Intergenic
1010917368 6:81636726-81636748 TAGATTAGGCAGGGGCTTAAAGG + Intronic
1012397032 6:98810453-98810475 CAGATCATACAGGGCATTGTAGG - Intergenic
1012444248 6:99292057-99292079 CAGATGAGGAAGGGCATTCATGG + Intronic
1012556254 6:100516258-100516280 CAGTTCAGGAAGGGACTCGATGG + Exonic
1012649393 6:101734676-101734698 CAGATCCTACAGGGCCCTGAAGG + Intronic
1012783456 6:103592231-103592253 CAGATCATGTATGGCCTTGTAGG - Intergenic
1013439512 6:110148605-110148627 CAGATTAGGTAGGACCTTGAAGG + Intronic
1013702529 6:112790611-112790633 CAAACCATGAAGGGCCTTGAAGG - Intergenic
1014805788 6:125827849-125827871 CAGATCATGCAGGGCCTTCTTGG + Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015374277 6:132492084-132492106 CAGGTCAGGTAGGGCCTTGCAGG - Intronic
1015692154 6:135937336-135937358 CAGATCAGGAAGGGCCCTGCAGG - Intronic
1015809094 6:137143292-137143314 CAGATCATACAGCGCCTTGGAGG + Intergenic
1016329351 6:142940578-142940600 AAGGTAATGCAGGGCCTTGAAGG - Intronic
1017321980 6:153105077-153105099 CAGATCACACTGGGCCTTGAGGG + Intronic
1017457581 6:154615849-154615871 CAGCTCCGCCAGGGCCTTGCCGG - Intergenic
1017714736 6:157201020-157201042 CAGAACAGGCAGGGCCCTGGCGG + Exonic
1018735590 6:166685191-166685213 AAGCTCAGGCAGGACCCTGATGG + Intronic
1018735603 6:166685257-166685279 AAGCTCAGGCAGGACCCTGATGG + Intronic
1018735617 6:166685323-166685345 AAGCTCAGGCAGGACCCTGATGG + Intronic
1018852968 6:167654467-167654489 CAGATCCATCAGGGCCTTGGCGG - Intergenic
1019375364 7:688502-688524 CAGATCACGCAGGGCCTTGCTGG - Intronic
1019590549 7:1828295-1828317 CAGCCCAGGCAGGGCCTCGCGGG + Intronic
1019629660 7:2041694-2041716 CAGATGAGGAAGAGCTTTGAAGG + Intronic
1020147224 7:5653940-5653962 CAGACCAGGCAAGGCCTTGAAGG + Intronic
1020213397 7:6171426-6171448 CAGCTCTGGCAGGGGCTTGGGGG + Intronic
1020381895 7:7556709-7556731 CAGCTGAGGCAGAGCCTAGACGG + Intergenic
1022141832 7:27499594-27499616 CAGAGCAGGCAGGTCCAGGAGGG - Intergenic
1022491826 7:30826589-30826611 CAGATCATGGAGAGCCTTGCAGG + Intronic
1022500474 7:30879502-30879524 CAGGTCTGGCAGGGCATTGGGGG - Intronic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023066687 7:36384934-36384956 CAGATCATGCATGGCCTTGTAGG + Intronic
1023564529 7:41510475-41510497 TAGCTGATGCAGGGCCTTGAAGG - Intergenic
1024197951 7:47078439-47078461 CAGATCACGAAGGGCCCTGTTGG + Intergenic
1024684923 7:51734545-51734567 CAGAGCAGGCAGAGCCCTCATGG - Intergenic
1025256714 7:57388837-57388859 CAGACCAGGCAGGGCCTTGCAGG - Intergenic
1026118779 7:67518615-67518637 CAACTCAGGGAGGGCCTGGATGG - Intergenic
1026241768 7:68581716-68581738 CAGATCATGTAGGGTCTTGTAGG - Intergenic
1026323414 7:69287172-69287194 CAGATCAGGGAGAGCCCTGTGGG - Intergenic
1026450005 7:70520319-70520341 CAGATCAGGGAAGACCTTGTGGG - Intronic
1026936461 7:74259289-74259311 GAGGTCAGGAAGGGCTTTGATGG + Intergenic
1027345340 7:77253965-77253987 CTGATGAGGCAGGGCCATGTAGG + Intronic
1028433811 7:90778595-90778617 CAGATCACGAAGGGCCTTCTGGG - Intronic
1028981752 7:96974964-96974986 CAGATCCTGAAGGGCCTTGTAGG - Intergenic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1029468342 7:100740185-100740207 CAGATCACATAGAGCCTTGAAGG + Intronic
1029856724 7:103524950-103524972 GATATCAGGCAGGACCTTGTGGG - Intronic
1030354426 7:108526548-108526570 CAGCGCAGGCAGGGGCTTCAGGG - Intronic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1031608644 7:123798932-123798954 CAGATTAGATAGAGCCTTGAAGG + Intergenic
1034410324 7:150937842-150937864 CAGAGCAGACTGGGCCTTGTGGG - Intergenic
1034496249 7:151424608-151424630 CACATGTGGCAGGGCATTGAGGG + Intergenic
1036505280 8:9349238-9349260 CAGATCATGCAGGGTCTTATCGG - Intergenic
1036683816 8:10895055-10895077 CAAATCAGGGAGGGCCTCCAGGG - Intergenic
1037200632 8:16248601-16248623 GAGATCAGGAAGAGCCTAGAAGG + Intronic
1037316464 8:17604047-17604069 CAGACCATGGAGGGCCTTGTTGG + Intronic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1038575624 8:28701547-28701569 CGGATCAGGCGCGGCCTGGAAGG + Exonic
1038821129 8:30952738-30952760 CAGAGCATGCAGGGCCATGAAGG + Intergenic
1038893251 8:31751522-31751544 TAGATCAGGCAGTGCTTTGATGG + Intronic
1039969222 8:42307325-42307347 CAGATTATGAAGGGCCTTCAGGG + Intronic
1040444672 8:47481574-47481596 CAAAACAGGCAGTGCCCTGATGG - Intronic
1042096903 8:65226144-65226166 CAGATCACGCAGGGCCTTGTAGG + Intergenic
1042737306 8:72004047-72004069 CAGATCAGGCAGAATCCTGACGG + Intronic
1043207906 8:77470867-77470889 AAGATCAGGTAGGACCTTGAAGG + Intergenic
1043877610 8:85503785-85503807 CAGATCATGTAAGGCCTTGGGGG - Intergenic
1043988679 8:86724939-86724961 CAGACCAGGCAGGGCCTGAGAGG + Intronic
1044211063 8:89551923-89551945 CAGCTGAGACAGGGCCTTGTAGG + Intergenic
1044462363 8:92460279-92460301 CAGATCATGGCCGGCCTTGAGGG - Intergenic
1044934473 8:97279448-97279470 CAGATCATACAGGGCCTTGCAGG - Intergenic
1046290208 8:112149352-112149374 CAGATTAGGCAGAGTCTTGTAGG - Intergenic
1047285027 8:123480345-123480367 CAGATCATGCAGGGTCTTTGTGG + Intergenic
1047971867 8:130091502-130091524 CCGATCATGCAGGGCCCTGTGGG + Intronic
1048288073 8:133157955-133157977 CAGGTGAGGCAGGGACTTAAAGG - Intergenic
1049122628 8:140752963-140752985 CAGACCACACAGGGCCTTCAAGG + Intronic
1049154816 8:141060009-141060031 CAGAGCGGGCAGGGCCCTGCCGG - Intergenic
1049374156 8:142281135-142281157 CAGCTCAGTCAGGGCATGGAGGG + Intronic
1051401056 9:16683123-16683145 CAAATCAGGCACAGACTTGAAGG + Intronic
1051564829 9:18485759-18485781 CAGATCATGCAGGGTGTTGCAGG + Intronic
1052975362 9:34406082-34406104 CAGAGCAGGCAGGGCATTCAGGG + Intronic
1053099921 9:35363177-35363199 CAGATCATGGAGAGCCGTGACGG + Intronic
1054722119 9:68614670-68614692 CAGAGCAGGCAGTGCCCTCAAGG + Intergenic
1055660122 9:78494872-78494894 CAGATCATGCAAGGCTTTGTGGG + Intergenic
1056148073 9:83754715-83754737 CTGATCCTGGAGGGCCTTGAAGG + Intronic
1057248539 9:93480473-93480495 CAGAGCAGGCTGGGCCAGGATGG + Intronic
1057885072 9:98823698-98823720 CAGATCTGGAAGGGCCTTGGAGG + Intronic
1057894721 9:98899895-98899917 CAAATCAGGCTTGGCCTTGTAGG + Intergenic
1058007659 9:99935958-99935980 CAGATCATGGAGAGCCTTGCAGG + Intronic
1058349893 9:104009275-104009297 TAGAACAGGCAGTGCCTTCAAGG - Intergenic
1058532821 9:105924057-105924079 CAGATCCTGCAAGGCCTTGTGGG - Intergenic
1059189496 9:112310964-112310986 CATAGCATGCAGGGCCTTAACGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059385689 9:113962507-113962529 CAGCTCATGCAGAGCCTTGCAGG - Intronic
1059457743 9:114410438-114410460 CAGAGCAGGCAGGGAGTTGAGGG + Intronic
1059575613 9:115485187-115485209 AGGATCAAGCATGGCCTTGAAGG - Intergenic
1059592187 9:115673675-115673697 CAGATCATGCATGGCTTTGTAGG - Intergenic
1059621521 9:116011059-116011081 CAGATCAGACAGGGTGCTGAAGG + Intergenic
1060059521 9:120446625-120446647 CAGATCAGGCAGGCTCTCAAAGG - Intronic
1060418882 9:123453284-123453306 AAGATCAGGGAAGGCCTTGGAGG + Intronic
1060846667 9:126842771-126842793 CAGATCTGGAAGGGCCTTGGAGG - Intergenic
1060973358 9:127751557-127751579 CAGACTAGGCACTGCCTTGAGGG - Intronic
1061093494 9:128440444-128440466 CAGAGCAGGGATGGCCATGAAGG + Intergenic
1061342689 9:129995836-129995858 TAGATCACCCAAGGCCTTGAAGG + Intronic
1061421872 9:130477079-130477101 GAGTTCAGGCAGGGGCTTCAAGG + Intronic
1061771082 9:132922215-132922237 TAGATCAGGAAGAGCCTTCATGG - Intronic
1061822199 9:133234983-133235005 CAGATAAGCCAGGGCCTCGGAGG - Intergenic
1061832449 9:133304457-133304479 CAGATGAGCCAGGGCCTCGGAGG + Intergenic
1062026439 9:134342791-134342813 CAGAGCAGGAAGGGCCAGGAAGG - Intronic
1062237096 9:135515533-135515555 CAGATAAGCCAGGGCCTCGGAGG + Intergenic
1062513749 9:136921863-136921885 AAGGTCAGCCAGGGCCTCGAGGG - Intronic
1203621825 Un_KI270749v1:134323-134345 CAGAACAGGCAGGCCCATGGTGG - Intergenic
1186516551 X:10170619-10170641 CAGATCCGGCAAGGCTTGGATGG - Intronic
1186722695 X:12322577-12322599 CAGGTCATTCAGGGCCTTGTAGG + Intronic
1187202257 X:17146181-17146203 CAGATCGTACAGGGCCTTGTGGG - Intronic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1187277127 X:17826089-17826111 CAGATCAGATAGGGCTTTGTAGG - Intronic
1188179356 X:27034816-27034838 TTGATCACGCAGGGCTTTGAAGG + Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1188390345 X:29611741-29611763 CAGGTCAGACATGGACTTGAAGG + Intronic
1188458027 X:30389444-30389466 AAGATCATGCAAGGCCTTGCAGG + Intergenic
1188661365 X:32762743-32762765 CAGATCACACAGGGTCTTGCTGG + Intronic
1189019155 X:37316672-37316694 CAGATCAAGGAGGGCTTTGCAGG - Intergenic
1189105991 X:38235819-38235841 CAGATCAAACAGGGCCTTTTTGG - Intronic
1189537986 X:41956206-41956228 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1190311757 X:49122017-49122039 TAGACCAGGCAGGGCCTTGTAGG - Intronic
1190335093 X:49257434-49257456 GAGGCCAGGCCGGGCCTTGAGGG + Exonic
1190657440 X:52624525-52624547 CTGATCAGGCAGAGGGTTGAGGG - Intergenic
1190735989 X:53256307-53256329 GGGACCAGGCAGAGCCTTGAGGG - Intronic
1191641456 X:63432570-63432592 CAGATGAGGCAAGGTTTTGAGGG + Intergenic
1192143245 X:68662469-68662491 CAGATCACGAAGGGCCTTATAGG - Intronic
1192273832 X:69610180-69610202 CAGATCATGTAGGGCCTTGTAGG + Intergenic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1192498048 X:71629373-71629395 CAGATCATGGAAGGCCTTAATGG - Intergenic
1192555211 X:72083863-72083885 CAGATCGTGCAGGGCCTTCTAGG - Intergenic
1193593545 X:83419394-83419416 CATTGCAGGCAGAGCCTTGACGG + Intergenic
1193624707 X:83803842-83803864 TAGATCATGTAGGGCCTTGTAGG + Intergenic
1195677004 X:107514234-107514256 GAGATCACGCAGGGCCTTATGGG + Intergenic
1195700832 X:107704426-107704448 CAGATCACGCAGGCACTTGTAGG + Intergenic
1195879571 X:109578320-109578342 CACATTACGCAGGGCCTTGTAGG - Intergenic
1195898587 X:109773607-109773629 CAGATCACACAGGGCCTTGTAGG + Intergenic
1196003794 X:110813914-110813936 CAGATCATGTAGGGCTTTGAAGG + Intergenic
1196004040 X:110816648-110816670 CAGATCATGCTAGGCCTTGCAGG + Intergenic
1196141535 X:112268108-112268130 CAGATTAGGTAGGATCTTGAAGG - Intergenic
1196764657 X:119231952-119231974 CAGATCCTGTAGGGCCTTGTAGG + Intergenic
1196848785 X:119917956-119917978 CAGATCACACAGGGCCTTGTAGG - Intronic
1197467316 X:126820811-126820833 CAGATCAGTCAGCACATTGACGG - Exonic
1197712919 X:129684952-129684974 CAGATCAGGCAGGGCCTTCTAGG + Intergenic
1197741707 X:129900057-129900079 CAGATCATGTAGGGCCTTGTAGG - Intergenic
1197752617 X:129975902-129975924 TAGATCAGGGAGGGCCCTAAAGG + Intergenic
1197881749 X:131173841-131173863 CAGATCATGTAGGGCCTTTTAGG + Intergenic
1198320441 X:135514398-135514420 CAGATCATGCAGGGCCTAGTTGG - Intergenic
1198380840 X:136081973-136081995 CAGATCATGTAAGGCCTTGTAGG - Intergenic
1198426962 X:136530027-136530049 CGGGTCAGGGAGGGCCTTGTAGG + Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198778558 X:140208263-140208285 CAGATCAGGTAGGGGCTTGTGGG + Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1198791548 X:140352344-140352366 CAGATCACACAGGGCCTTGTAGG + Intergenic
1198802002 X:140457672-140457694 CAGGTCATGCAGGGCCCTGCAGG - Intergenic
1198809734 X:140523352-140523374 CAGATCAGGAAGATCCTTGCAGG - Intergenic
1200056398 X:153463643-153463665 CAGATCAGGCCAGGCCATGTGGG - Intronic
1202583784 Y:26405112-26405134 CAGAACAGGCAGGCCCATGGTGG + Intergenic