ID: 1167326926

View in Genome Browser
Species Human (GRCh38)
Location 19:48832441-48832463
Sequence CCCAGGGCTGTGCCCTCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 419}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167326926_1167326943 29 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326943 19:48832493-48832515 AGTTTCAGCACAGGCCTGGGGGG 0: 1
1: 0
2: 0
3: 35
4: 269
1167326926_1167326940 26 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326940 19:48832490-48832512 CACAGTTTCAGCACAGGCCTGGG 0: 1
1: 0
2: 4
3: 18
4: 245
1167326926_1167326941 27 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326941 19:48832491-48832513 ACAGTTTCAGCACAGGCCTGGGG 0: 1
1: 0
2: 2
3: 21
4: 251
1167326926_1167326930 -10 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326930 19:48832454-48832476 CAGCCCTGGGGACACACAGGAGG 0: 2
1: 0
2: 9
3: 54
4: 455
1167326926_1167326937 20 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326937 19:48832484-48832506 CAGGGCCACAGTTTCAGCACAGG 0: 1
1: 0
2: 1
3: 25
4: 283
1167326926_1167326931 -9 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326931 19:48832455-48832477 AGCCCTGGGGACACACAGGAGGG 0: 1
1: 0
2: 4
3: 71
4: 438
1167326926_1167326935 1 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326935 19:48832465-48832487 ACACACAGGAGGGATGGAACAGG 0: 1
1: 0
2: 1
3: 14
4: 258
1167326926_1167326934 -5 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326934 19:48832459-48832481 CTGGGGACACACAGGAGGGATGG 0: 1
1: 3
2: 11
3: 68
4: 607
1167326926_1167326936 2 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326936 19:48832466-48832488 CACACAGGAGGGATGGAACAGGG 0: 1
1: 0
2: 0
3: 22
4: 354
1167326926_1167326942 28 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326942 19:48832492-48832514 CAGTTTCAGCACAGGCCTGGGGG 0: 1
1: 0
2: 2
3: 59
4: 724
1167326926_1167326939 25 Left 1167326926 19:48832441-48832463 CCAAGTGAGGGCACAGCCCTGGG 0: 1
1: 0
2: 5
3: 42
4: 419
Right 1167326939 19:48832489-48832511 CCACAGTTTCAGCACAGGCCTGG 0: 1
1: 0
2: 2
3: 25
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167326926 Original CRISPR CCCAGGGCTGTGCCCTCACT TGG (reversed) Intronic
900175998 1:1291620-1291642 GCCAGGGCTGTGCGATCTCTTGG + Exonic
900188372 1:1343267-1343289 CCCAGGGCTTCCCCCACACTGGG + Intronic
900195064 1:1371826-1371848 CCCAGGGCTGTGCCTGAGCTGGG + Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
900520193 1:3101670-3101692 CCAAGTTCTGTTCCCTCACTTGG - Intronic
900946829 1:5835500-5835522 CCCAGGCCTGTGCCCAGCCTGGG + Intergenic
900987753 1:6083057-6083079 CCCAGGGCTGTGCGCTCCCCAGG - Intronic
901001109 1:6149174-6149196 CCCACCCCTGTGCCCTCATTTGG - Intronic
901229084 1:7631976-7631998 CACAGGGCTGTGGTGTCACTAGG - Intronic
901234968 1:7662863-7662885 CCCAGGGGTGGCTCCTCACTGGG + Intronic
901447655 1:9318129-9318151 CCCAGGGCCCCACCCTCACTGGG - Intronic
901492020 1:9601535-9601557 CCTAGGGCTGTGCACCCAATGGG - Intronic
901649299 1:10734297-10734319 CCCATGGCCGTGCCCTCCCTTGG + Intronic
901840352 1:11950285-11950307 CTCCTGTCTGTGCCCTCACTGGG + Intronic
901922892 1:12548859-12548881 CCCAGGGCTGTCACCTCTCGGGG - Intergenic
902341392 1:15785756-15785778 TCCATGGCTGTGCCCCAACTGGG - Intronic
902402445 1:16165631-16165653 ACCAGGCCTGGGCCCTCACAAGG + Intergenic
902798559 1:18815261-18815283 TCCAGGGTTCTCCCCTCACTGGG - Intergenic
903031568 1:20467560-20467582 CCCAGGGCTGGGGGCTGACTGGG - Intergenic
903181129 1:21605485-21605507 CCCAGGGCTGCGCACACAGTAGG + Intronic
903340460 1:22651152-22651174 CCAAGGGCTGGGCACTCACCTGG + Intergenic
903361946 1:22782469-22782491 CCCAGGCCTGTGCTCTCAATAGG + Intronic
903461675 1:23525017-23525039 CCCAGGGAGGTGCCCACAGTGGG + Intronic
904047223 1:27615958-27615980 TCCTGGCCTGTGACCTCACTTGG - Intronic
904309060 1:29613824-29613846 CCCTGGGCTCTGGCCTCACTGGG - Intergenic
904314021 1:29648487-29648509 CACAGTGCTGAGACCTCACTTGG + Intergenic
904316499 1:29669594-29669616 CCCAGGGCTGTTCCCACACTAGG - Intergenic
904383298 1:30125601-30125623 CCCAGGGCTGCCTCCACACTGGG + Intergenic
905386112 1:37605492-37605514 CCCAGGGCAGTGCTCACATTGGG + Intergenic
905522121 1:38608340-38608362 ACCAGGGCTGTGCTCACGCTGGG + Intergenic
905771959 1:40644107-40644129 CCTAGGGCTTAGCCCTCTCTAGG - Intronic
905936499 1:41828196-41828218 CCCAGGGCTGTGACCTTGCAAGG - Intronic
907046522 1:51303221-51303243 CCCAGGCCCCTGCCCTCTCTGGG - Intronic
908121444 1:60989956-60989978 CCCAGGGCTGTGCTCAAGCTGGG - Intronic
908727933 1:67196983-67197005 CGCATACCTGTGCCCTCACTGGG - Intronic
912804395 1:112743998-112744020 CCCAGGGCTGGCCCCTCACTCGG - Intergenic
915275748 1:154787225-154787247 CCTAGGCCTCTGCCCTCAGTGGG - Intronic
915362996 1:155297011-155297033 TCCAGGGCTGCACCCTCTCTTGG + Intronic
919114883 1:193268774-193268796 CCCAGGCCTCTGCTCTCCCTTGG - Intergenic
920337473 1:205254824-205254846 CCCAGGGCTCTCAGCTCACTCGG + Intronic
920849818 1:209621164-209621186 GCCAGGGCTCTGGCCTCAGTGGG - Intronic
922474767 1:225899282-225899304 CCCAGGGCTGGGCCCTCAGTGGG + Intronic
922730430 1:227946520-227946542 CCCAGGGCCGTACCCACAGTTGG + Intronic
1062829215 10:594179-594201 CCGAGGTCTGTGCTCTCCCTGGG - Intronic
1063012875 10:2042514-2042536 GACAGGGCTGTGTCCTCACATGG + Intergenic
1064453395 10:15464539-15464561 CCTAGGGCTGTGTCATCTCTTGG + Intergenic
1065590716 10:27258935-27258957 CCCGGGTTTGTGCCCTCCCTCGG - Intergenic
1067497530 10:46773817-46773839 CCCAGAGCTGTTCCCTCTCAGGG - Intergenic
1067532054 10:47081129-47081151 CCCAGTGCCCTGCCCTCGCTTGG + Intergenic
1067597121 10:47566598-47566620 CCCAGAGCTGTTCCCTCTCAGGG + Intergenic
1067830355 10:49608272-49608294 GCCAGGCCTGTGCCCACATTGGG + Intergenic
1069705860 10:70458741-70458763 CCCAGGGCTCTGCCCTCAGCGGG + Intergenic
1070369798 10:75771453-75771475 GCAAGGGCAGTGCCCTCTCTCGG - Intronic
1071328610 10:84540364-84540386 CCCACGGCTTTGCTCTCCCTTGG - Intergenic
1071909306 10:90212665-90212687 CCCAAGGATGTGCCCTCTTTGGG - Intergenic
1072037261 10:91574949-91574971 CCCAAGGCTGAGCCCTGCCTGGG + Intergenic
1072265939 10:93728094-93728116 TCCAGGACTGTGCCCACCCTTGG + Intergenic
1072360718 10:94656441-94656463 CCCAGTTCTGTGCCCTTGCTGGG + Intergenic
1073085092 10:100883254-100883276 CCCACAGCTCTGCCCTCACTGGG + Intergenic
1073102051 10:101011647-101011669 CCCAGGGCTGTGCCCCTCCCTGG + Intronic
1073300826 10:102470192-102470214 CCCATGGCTCTTCCCTTACTGGG + Intronic
1073445883 10:103580057-103580079 CCCAGGGCTGGGCACACAGTAGG + Intronic
1074579474 10:114704984-114705006 CCCATGGCTGTGCCTTGACATGG + Intergenic
1075007429 10:118840951-118840973 CCCTGGGGTGAGCCCACACTTGG - Intergenic
1075655097 10:124156102-124156124 ACCAGAGCTGTGCCCTCGCAGGG - Intergenic
1076527766 10:131123186-131123208 CCCAGGCCCCTGCCCTCACCAGG + Intronic
1076653094 10:132003588-132003610 CCCAGGGCTGTGGTCTTCCTTGG + Intergenic
1076691196 10:132224630-132224652 CTCAGAGCTGTGCCTGCACTTGG - Intronic
1076830801 10:132993247-132993269 CCCATGGCCGTGGCCTCACAGGG + Intergenic
1076882263 10:133245298-133245320 CTGAGGGCTATGCCCTCCCTGGG - Intergenic
1077268012 11:1661534-1661556 CACAGGGCTGAGCCCTGGCTGGG - Intergenic
1077272907 11:1690198-1690220 CACAGGGCTGAGCCCTGGCTGGG + Intergenic
1077402382 11:2365656-2365678 ACCAGGGCTATGCTCTCACCCGG + Intergenic
1077481329 11:2816003-2816025 CCCAGGACTGTGTGCACACTTGG - Intronic
1077582630 11:3426612-3426634 CCCAGGACTGTGACCTTATTAGG + Intergenic
1078019871 11:7648042-7648064 TCCAGAGCTGTGGCCTCATTAGG - Intronic
1079520598 11:21321845-21321867 GGCAGGGCTCTGCCCTCACAGGG + Intronic
1081834815 11:46144756-46144778 TCCAGGGCTGTGCCCCCAATGGG - Intergenic
1083307401 11:61768555-61768577 CCCAGGGCTGTGTCCACAACAGG + Intronic
1084174635 11:67416862-67416884 CCCAGGGCTGGGCACACAGTAGG + Intronic
1084231553 11:67757213-67757235 CCGAGGGCAGAGCCCTCGCTAGG - Intergenic
1084463346 11:69308354-69308376 CCCAGGCCTTTGCCCTGGCTGGG + Intronic
1084473906 11:69378096-69378118 CCCAGGGCTGGGACCTGCCTGGG + Intergenic
1084474019 11:69378556-69378578 CCCAGGGCTCTGCACTCAGTAGG - Intergenic
1084753060 11:71216689-71216711 CCTGGGGCTGTGACCTCACTTGG - Intronic
1084954581 11:72684577-72684599 ACCAGGGGGCTGCCCTCACTGGG - Intergenic
1087220662 11:95543138-95543160 GCCAGTGCTTTGCCCTCACAGGG - Intergenic
1090029612 11:123195548-123195570 CCTAGAGCTCTGCTCTCACTTGG + Intergenic
1090986690 11:131773214-131773236 GCCAAGGCTGTGTCCTCACATGG + Intronic
1091224043 11:133947028-133947050 CCCAGGGCTGTCCCCACGTTGGG + Intronic
1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG + Intergenic
1091879522 12:3965629-3965651 CTCATGGCTGTGCCTTCTCTAGG - Intergenic
1091995298 12:4988358-4988380 CCCAGGGGCATGGCCTCACTGGG + Intergenic
1092057187 12:5517119-5517141 CTCTGGGCTGTGGCCTCTCTGGG - Intronic
1096194702 12:49642445-49642467 CCCAGGGCTGTGACGTGACTGGG - Exonic
1096474682 12:51901093-51901115 TCCAGGTCTGTGCCCAGACTGGG + Intergenic
1096714431 12:53482752-53482774 CCAGGGGCTGAGCCCTCACTTGG + Exonic
1098181563 12:67852625-67852647 CCCAGGGCTGTTTGTTCACTAGG - Intergenic
1098226423 12:68329822-68329844 CCCAGGACTCTGCCTTCCCTGGG + Intronic
1101693077 12:107098619-107098641 TACAGAGCTGTGCCTTCACTTGG + Intergenic
1101725719 12:107386652-107386674 GTCAGGGCTGTGGGCTCACTAGG - Intronic
1101919297 12:108919426-108919448 CCCACACCTGTGCCCACACTTGG + Intronic
1102259822 12:111437134-111437156 CCCAGGGCTGGGCCCCTACTGGG - Intronic
1102515260 12:113441931-113441953 CCCAGAGCTGGGCCCACACAGGG + Intergenic
1102600934 12:114029872-114029894 TCCAGGGCTTTGACTTCACTGGG - Intergenic
1102612591 12:114125627-114125649 ACCAGGGCTTTGTCTTCACTGGG - Intergenic
1104238372 12:126961575-126961597 CCCAGGGCAGAGCCCTCATCAGG + Intergenic
1104547267 12:129723596-129723618 TCCATGGCTCTGTCCTCACTGGG + Intronic
1104583028 12:130024510-130024532 CCCAGGGCCGTGCCCTCCAAGGG - Intergenic
1104931793 12:132343485-132343507 CCCAGGGCAGAGGCCTCACAAGG + Intergenic
1105250844 13:18697704-18697726 CACAGGGCTGGGCCCACCCTGGG + Intergenic
1105429893 13:20326860-20326882 CCCAGGGCTGGGCATTCACGGGG - Intergenic
1107522993 13:41201710-41201732 CCCAAGGCAGCCCCCTCACTAGG - Intergenic
1107893981 13:44940253-44940275 CTCAGGTCTGTGACGTCACTAGG + Exonic
1112441987 13:99431289-99431311 CCCACGGATGTGCCCTCTTTGGG - Intergenic
1113299516 13:109002216-109002238 CCCAGGGCTCTGCCTTCAGCTGG + Intronic
1113768347 13:112894332-112894354 CCCAGGGCTGCGCCGACACTGGG - Intergenic
1113770702 13:112906649-112906671 CCCAGGCCTCTGCTCTCACCTGG - Intronic
1113940672 13:114017161-114017183 CCCAGTGCAGTGCCCTCTGTTGG + Intronic
1113971540 13:114195101-114195123 CCCAGGGCTGTGGGGCCACTGGG - Intergenic
1114007789 14:18332967-18332989 CCCAGGGCTCTGCTCTTCCTCGG - Intergenic
1114996875 14:28365156-28365178 CCAAGGGCAGAGCCCTCACTGGG - Intergenic
1116756840 14:48958562-48958584 CCTGTGGCTGTGCCCTCACATGG - Intergenic
1118892480 14:69921703-69921725 GCCTGGGCTGGGCCCTAACTTGG + Intronic
1119712200 14:76830343-76830365 CCCACAGCTGTGTCCTCATTAGG - Intronic
1119719154 14:76879597-76879619 CTCTGGGCTGTGCACTCACTGGG - Intergenic
1121110526 14:91309734-91309756 CCGAGGGCTGTGACCTCACGCGG - Intronic
1121613596 14:95298053-95298075 TCCAGGGCCTTGCCCGCACTGGG + Intronic
1122122897 14:99563919-99563941 CCCTGGGCTGTTCCCAAACTTGG + Intronic
1122651786 14:103230443-103230465 GCCAGGTCTGTGCCCACAATGGG + Intergenic
1122817144 14:104319385-104319407 CCCAGTTCTGTGCCCACACCAGG - Intergenic
1122906202 14:104802705-104802727 CCCCAGGCTGTGCCCTGCCTAGG + Exonic
1122909605 14:104820937-104820959 CCCAGTGCTGTGCTCTGCCTGGG - Intergenic
1123044239 14:105503568-105503590 ACCAGGGCTGTGCTCTCACCAGG + Intergenic
1123123823 14:105930377-105930399 CCCTGGGCTGTGTCCTCCCCTGG + Intronic
1123123840 14:105930425-105930447 CCCTGGGCTGTGTCCTCCCCTGG + Intronic
1123196020 14:106617453-106617475 CCCAGGGCTGAGCACACACAGGG + Intergenic
1123217912 14:106829905-106829927 CCCAGGGCTGAGCACACAGTGGG + Intergenic
1124614283 15:31230423-31230445 CCCATGGCTGTGCCCGCCATAGG - Intergenic
1124822684 15:33063144-33063166 TCCAGGTCTGTGCCCTTTCTGGG + Intronic
1126734616 15:51718328-51718350 CTCATGGCTGTGCCCTAACAGGG + Intronic
1127382680 15:58443458-58443480 CACAGGGCTGTGCCTTCTATGGG - Intronic
1128765011 15:70246092-70246114 CCCAGGGCCCAGCCCTCACAGGG + Intergenic
1128796025 15:70467212-70467234 CCTGGGCCTCTGCCCTCACTTGG - Intergenic
1129231431 15:74199204-74199226 CCCAGGGCTCTGCACTCCCCTGG - Intronic
1129766325 15:78171306-78171328 GCCAGTGCTGTGCCCTGACCTGG + Exonic
1130084309 15:80764506-80764528 ACCCTGTCTGTGCCCTCACTAGG + Intergenic
1132147410 15:99436956-99436978 CCCAGGGCAGTGTCCCCACTTGG - Intergenic
1132236713 15:100227562-100227584 TCCAGCGATGTGCCATCACTGGG - Intronic
1132248738 15:100317569-100317591 CACAGGGCTGTGCTCTCGCAGGG + Intronic
1132663361 16:1071187-1071209 CGCAGGGCTGAGCTCCCACTGGG + Intergenic
1132743964 16:1429070-1429092 CCCTGGGCTGTGGGCTCCCTGGG + Intergenic
1132743990 16:1429149-1429171 CGCTGGGCTGTGGGCTCACTGGG + Intergenic
1132765994 16:1534439-1534461 CCCAGGGCTCGGCCCTCCCCGGG - Exonic
1132873129 16:2124379-2124401 CCCTGGGCTCTGCCCACAGTTGG + Intronic
1133193807 16:4154064-4154086 CCCAGGCCTGTGCCAACGCTTGG + Intergenic
1133232967 16:4374965-4374987 ACCAGGGCTGGGCCCTCACACGG - Intronic
1133730924 16:8577947-8577969 GACAGGGCTTGGCCCTCACTGGG - Intronic
1134138204 16:11694397-11694419 CCCAGGGCTGTAATCCCACTGGG + Intronic
1134211256 16:12279501-12279523 CCCAGTGCTCTGCCCTTCCTTGG + Intronic
1134552218 16:15143560-15143582 CCCTGGGCTCTGCCCACAGTTGG + Intergenic
1134801198 16:17086207-17086229 CACAGGGCTCTTCCCACACTAGG + Intergenic
1135290945 16:21237552-21237574 CCTATGGCTGTGTCCTCACATGG + Intronic
1135401965 16:22172164-22172186 CCCAGGGCTGCACCTTCCCTGGG - Intronic
1136236136 16:28914653-28914675 CCCCTGGCCGTGCCCTCACCTGG + Exonic
1139346138 16:66305129-66305151 GCCAGGGCTCTGCCCTGGCTGGG + Intergenic
1140469050 16:75204643-75204665 CCCAAGGCCTGGCCCTCACTGGG + Intronic
1141461387 16:84180426-84180448 CTCAGGGCTCTGCACTCACCTGG - Intronic
1141678661 16:85531210-85531232 CTCAGAGCTGTGCCCACAGTGGG - Intergenic
1141720418 16:85752380-85752402 CCCAGGGATGTGCCCTCAGCAGG - Intergenic
1141842810 16:86584974-86584996 CACAGGGCTCAGCCTTCACTGGG + Intergenic
1141967196 16:87453448-87453470 CCCAGGGCTGGGCACTGACGGGG - Intronic
1141974229 16:87504234-87504256 CCCAGGGATGGCTCCTCACTAGG + Intergenic
1142177142 16:88650587-88650609 CCCAGGCCGGAGCCCCCACTCGG + Intronic
1142561064 17:809246-809268 CTCAGGGCTGCGCCCTCTCTAGG - Intronic
1142972629 17:3623148-3623170 CTCAGGGCTGTGCTTACACTGGG + Intronic
1143329075 17:6120735-6120757 CTCAGGCCCGTGGCCTCACTGGG + Exonic
1143383272 17:6509510-6509532 CCCTGGGCTCTCCCCTTACTGGG + Intronic
1143586806 17:7854551-7854573 CCCAGGGCCAGGGCCTCACTGGG + Exonic
1143921164 17:10332050-10332072 CCCAGGGCTGTGGGGTTACTAGG + Intronic
1144064378 17:11611470-11611492 CTCAGGCTTTTGCCCTCACTGGG + Intronic
1144757932 17:17691549-17691571 GCCTGGGCTGTGCCCTCAGCTGG - Intronic
1144849173 17:18235465-18235487 CCCAGAGCTGGCCCATCACTGGG + Exonic
1144960455 17:19041550-19041572 CCCAGGGCCTTGTCCTCTCTCGG + Intronic
1144974705 17:19132974-19132996 CCCAGGGCCTTGTCCTCTCTCGG - Intronic
1145248099 17:21283129-21283151 CCTAGGGCTTGGCACTCACTAGG - Intergenic
1145397403 17:22506587-22506609 CCCCAGGCTCTGCCATCACTCGG - Intergenic
1145826172 17:27878756-27878778 CCCAGGGCTTTGACTTCCCTAGG + Exonic
1146603048 17:34235130-34235152 CACAGGGCTGTGCACACAGTAGG + Intergenic
1147367816 17:39970851-39970873 CGCAGGGATCTGCCCTCACTGGG - Intronic
1147832448 17:43306357-43306379 CCAAGGACTGTGTCCTCAGTAGG + Intergenic
1148458335 17:47822883-47822905 CCCAGGGATGTTCAATCACTGGG - Intergenic
1148756076 17:49973601-49973623 CCCAGGACTGTGCCTGCACCTGG + Intronic
1148874433 17:50678237-50678259 CCCAGGGCAGGGCCACCACTGGG + Intronic
1149169341 17:53791669-53791691 ACCAGGGCTGTGCGCTCGGTGGG + Intergenic
1150347108 17:64412544-64412566 CCCAGGGCTGTGCCACACCTGGG + Intronic
1151369042 17:73635910-73635932 ACCCTGGCTGTGTCCTCACTAGG - Intronic
1151534393 17:74730515-74730537 CCCAGGGCTCTCCCCAGACTGGG + Intronic
1151551832 17:74826781-74826803 TCCAGGTGTGTGCCCTCTCTGGG - Intronic
1151623545 17:75262057-75262079 CCCAGGGCAATGCTCTCTCTAGG - Intronic
1151781606 17:76250302-76250324 CCCTGGGCTCTGCCTTCACCTGG - Intergenic
1152153606 17:78618354-78618376 CCCAGGGCTGAGCGGTCACTTGG - Intergenic
1152202092 17:78953020-78953042 CCGAAGGCTGTGCCTTCGCTGGG - Intergenic
1152855509 17:82663100-82663122 CCCGGGGCCATGCCCTCGCTGGG - Intronic
1152862496 17:82704136-82704158 ACGTGGGCTGTGCCCTCACATGG - Intergenic
1154438005 18:14361222-14361244 CACAGGGCTGGGCCCACCCTGGG - Intergenic
1157578708 18:48760848-48760870 GCCAGGGCTGTGCCCACAGGGGG + Intronic
1157989544 18:52478223-52478245 CCTATGGTTGTGCCCTCAATAGG + Intronic
1158518253 18:58148557-58148579 CCCCTTGCTGTGCCCTCACATGG + Intronic
1160539178 18:79611079-79611101 CCCAGAGCCGTGCCCTGATTAGG + Intergenic
1160583745 18:79901545-79901567 CCCACGGAGGGGCCCTCACTGGG + Intergenic
1161658383 19:5530101-5530123 GCCTGGGGTGTGGCCTCACTGGG - Intergenic
1162033354 19:7926564-7926586 CCCAGGGCTGGACCCTGAGTTGG - Intergenic
1162381729 19:10335383-10335405 CCCAGGACTGTGCCTTCCCCAGG + Intronic
1162454722 19:10776433-10776455 GCCACAGCTGTGCCCTCCCTGGG - Intronic
1162585008 19:11553172-11553194 CCCTGGGCTGGGCCCTGACAGGG - Exonic
1162968376 19:14166309-14166331 CCCAGGGCTGGGCCCCCAGCTGG + Intronic
1163186961 19:15645579-15645601 CTCAGTGCTGAGCCCCCACTGGG - Intronic
1163338111 19:16686833-16686855 CTCAGGGCTGTGTCTTCCCTGGG + Intronic
1163476065 19:17526896-17526918 GCCAGGGCTGTATCCTCTCTGGG + Intronic
1163584623 19:18157075-18157097 CCCGGGGCTTTGGCCTCCCTGGG - Intronic
1163785441 19:19272793-19272815 CCCAGGGATGCGCCCTGCCTAGG - Intronic
1163987956 19:20970719-20970741 GCCAGGGCTCTGCCCACAGTAGG + Intergenic
1164089370 19:21934456-21934478 CCCTGGGCCCTGCCCTCAGTGGG + Intronic
1164193655 19:22934256-22934278 CCCTGGGCCCTGCCCTCAGTGGG + Intergenic
1164673181 19:30084714-30084736 CCCAGGGCTGTGGGCTTCCTTGG + Intergenic
1164789178 19:30961522-30961544 CCCAGGGCTCTACCCACACTGGG - Intergenic
1164789648 19:30965161-30965183 CCCAGGGTTGTACCCTCTGTTGG - Intergenic
1164815947 19:31203630-31203652 CCCAGAGCTGTTTCTTCACTGGG - Intergenic
1164869476 19:31631373-31631395 CCAGGGGCTGTGCCTTCACCAGG - Intergenic
1165047748 19:33119114-33119136 CAAAGGGCTCTGCACTCACTGGG - Exonic
1165351539 19:35278568-35278590 CCCAGGGCTGTGGTCTCGGTGGG + Intronic
1165786775 19:38466395-38466417 GCCAGGGGTGAGCACTCACTGGG - Exonic
1166366904 19:42282424-42282446 CCCAGTCCTGTGCCTTTACTGGG + Intronic
1166504951 19:43365237-43365259 CCCCGGGCTCTGCCTACACTGGG + Intergenic
1166505589 19:43369677-43369699 CCCCGGGCTCTGCCTACACTGGG - Intergenic
1166941664 19:46370619-46370641 CCCATGGCTGTGCTGTCACCAGG + Intronic
1167154312 19:47729095-47729117 TCCAGGGCTCAGTCCTCACTGGG + Intronic
1167326926 19:48832441-48832463 CCCAGGGCTGTGCCCTCACTTGG - Intronic
1167443747 19:49525387-49525409 CCCAGTTCTGTGTCCTGACTGGG + Intronic
1167464107 19:49641083-49641105 CCCAAGCCAGTGCCCTCGCTCGG - Intergenic
1168103928 19:54155460-54155482 TCCAGGGCAGGGCCCTCACCTGG - Exonic
1168670100 19:58234444-58234466 GCCAGGGTTGTGCCCTTGCTGGG + Intronic
1168689197 19:58366735-58366757 CCCAGGGCTCTGCCCTCTCCAGG + Intergenic
925049236 2:798237-798259 CCGAGGGTGGAGCCCTCACTGGG + Intergenic
925099580 2:1233917-1233939 CCAAGCGCTCTGCCTTCACTTGG + Intronic
925265569 2:2564148-2564170 CCCAGGGCAATGCTCTCACCTGG + Intergenic
925621445 2:5797351-5797373 GCCAGGGCAGTGCCCCCACTTGG - Intergenic
925668559 2:6288326-6288348 CTCAGGGCTCTGCACTGACTTGG - Intergenic
925920106 2:8632514-8632536 CCCAGTGCTGTGAGCCCACTGGG - Intergenic
925973330 2:9123239-9123261 CCCTGGGCTTGGCTCTCACTAGG - Intergenic
925990623 2:9251382-9251404 CCCAGGTCTGGGCCCCCACAGGG - Intronic
927158417 2:20235878-20235900 CCCAGGGCAGGGCCCTGCCTTGG - Intergenic
927460336 2:23293140-23293162 CCCAGAGCTGAGCCCTCAGCTGG - Intergenic
929968653 2:46554370-46554392 CCTAGGGCTGTGCGCCCAGTAGG + Intronic
930112331 2:47689209-47689231 CCCATGGCTGTGTTCTCTCTCGG + Intergenic
932897380 2:75654208-75654230 CCAAGCACTGTGCCCTCACATGG + Intronic
933797216 2:85929228-85929250 GCCAGGGCTGTGCGCACACACGG - Intergenic
934708445 2:96500593-96500615 CTGAGGGCTGCGCGCTCACTGGG - Exonic
937914147 2:127090671-127090693 CCCACAGCTGTGCCCTGGCTGGG - Intronic
938639592 2:133265785-133265807 CCCAGGCCTCTGACCTCGCTGGG + Intronic
938717405 2:134033484-134033506 CCCAAGGCTGTGCTCTCAGGAGG - Intergenic
940668677 2:156640195-156640217 CCCAGGGCTGCTCCTTCACCAGG - Intergenic
942091065 2:172491847-172491869 CCAAGGGATGGGCCATCACTGGG - Intronic
943838977 2:192552879-192552901 CCAAGGGTGGAGCCCTCACTAGG + Intergenic
946178927 2:217938352-217938374 CCCAGGCCTCTGCCCTCTCTGGG - Intronic
947435474 2:230068566-230068588 CGCTGGGCTGCGGCCTCACTCGG + Exonic
947984428 2:234436720-234436742 CCCAGGTCAGTGCACACACTTGG + Intergenic
948461914 2:238133966-238133988 CCCTGGGCAGTGACCGCACTGGG - Intergenic
948574977 2:238944014-238944036 CCTAGGGCTCTGCCCTTGCTTGG + Intergenic
948894573 2:240922217-240922239 CCCAGAGCTATGCCCCCACTGGG + Intronic
948958059 2:241309820-241309842 CCCAGGCCTCTCTCCTCACTTGG + Intronic
1170123146 20:12933527-12933549 CTCAGAGCTGTGCCCTCTTTTGG - Intergenic
1170469378 20:16653261-16653283 TGAAGGGCTGTGGCCTCACTTGG - Intergenic
1170567182 20:17613920-17613942 ACCAGGGCTTTGGCGTCACTCGG + Exonic
1171954417 20:31449491-31449513 CCCAGACCTGTGCAATCACTGGG + Intronic
1172604744 20:36206912-36206934 CCCAGGCCTGCGCCCTTCCTCGG + Intronic
1172965233 20:38829712-38829734 CCCAGGCCAGTGCCCTGTCTTGG + Intronic
1172965489 20:38831363-38831385 CCCAGGCCAGTGCCCTGTCTTGG + Intronic
1173291508 20:41719065-41719087 CCTCTGGCTGTGCCCTCACATGG + Intergenic
1173918396 20:46726205-46726227 CCCTGAGCTCTGCCCTCCCTGGG + Exonic
1174174460 20:48636160-48636182 CCCAGGGCAGTTTCCCCACTAGG - Intronic
1175182718 20:57159959-57159981 CCAAGGGCTCCCCCCTCACTCGG - Intergenic
1176237764 20:64062210-64062232 CCCAGGATTGTGCCCTCTCCAGG + Intronic
1176457673 21:6928247-6928269 CACAGGGCTGGGCCCACCCTGGG + Intergenic
1176835845 21:13793331-13793353 CACAGGGCTGGGCCCACCCTGGG + Intergenic
1177020012 21:15842640-15842662 CCCATGGCAGAGCCATCACTGGG - Intronic
1178719736 21:34997943-34997965 ACCAGGACTGGGCTCTCACTTGG + Intronic
1179898662 21:44377604-44377626 CCCACCTCTGTCCCCTCACTCGG + Intronic
1179906783 21:44426809-44426831 CCCCGGGCTGGGCTCTGACTGGG - Intronic
1180051863 21:45335233-45335255 CCCAGGCCTGTGCCCCCTCCCGG + Intergenic
1180233395 21:46441843-46441865 CCCTAGGCAGTGCCCTCACAGGG - Intronic
1180432295 22:15263777-15263799 CCCAGGGCTCTGCTCTTCCTCGG - Intergenic
1180883361 22:19222383-19222405 CTCCTGGCTGTGCCCTCACAGGG - Intronic
1181038806 22:20182335-20182357 CCCATGCCTGTGCCCACCCTGGG - Intergenic
1181045484 22:20212195-20212217 TGCGGGGCTGGGCCCTCACTGGG - Intergenic
1181392601 22:22594619-22594641 CCCAGGGCTCAGCCCCCAGTGGG + Intergenic
1181409067 22:22705341-22705363 CTCAGAGCTGTGCCCTCACTGGG + Intergenic
1181410313 22:22713725-22713747 CTCAGAGCTGTGCCCTCACTGGG + Intergenic
1181417868 22:22773101-22773123 CTCAGAGCTGTGCCCACAATGGG + Intronic
1181670022 22:24421636-24421658 CCCAGGGCGGTGTCCCCACCTGG + Intronic
1181865732 22:25853445-25853467 CACAGGGCTGTCCCTTCTCTGGG + Intronic
1182063693 22:27415837-27415859 ACAAGGGCTGAGCCCTAACTTGG + Intergenic
1182287689 22:29258030-29258052 TCCATGGCAGTGCCCTCAGTGGG + Intronic
1182878699 22:33714688-33714710 CTCAGGCCTGTGGCCTCCCTTGG + Intronic
1183165754 22:36146056-36146078 CTCAGGGCTGTGTCCTCACATGG - Intronic
1183172073 22:36195829-36195851 CTCAGGGCTGTGTCCTCACATGG - Intronic
1183373592 22:37449423-37449445 CCCCCGCCTGTGCCCCCACTGGG - Intergenic
1183579518 22:38715589-38715611 CACTGGGCTGTGAGCTCACTAGG + Intronic
1184173532 22:42773021-42773043 CCCAGGGCCCTGCCCTCAGAAGG + Intergenic
1184746447 22:46458818-46458840 TCCTGGGCTCTGCTCTCACTCGG - Intronic
1184790247 22:46695713-46695735 CTCAGGGCTTGGCCCCCACTGGG + Intronic
1184825318 22:46946620-46946642 CCCACGGCTGTGCGGGCACTGGG + Intronic
1185100413 22:48837684-48837706 CCCAGGGCTGTGCCTTTTCTTGG + Intronic
950040556 3:9916861-9916883 TCCAGGGCTGTGTCCTCCTTAGG + Intergenic
950459641 3:13113544-13113566 CCCAGGGCAGTGCCCACCCCAGG - Intergenic
950536507 3:13582059-13582081 CCCAGAGCTGTGTTCTCAATGGG + Intronic
950550398 3:13662645-13662667 CCCACGGCTGTGCCCACGCTAGG + Intergenic
950795744 3:15509642-15509664 CCCAGGGCTGGGCCCTTCCCAGG + Intronic
952616078 3:35276003-35276025 CTCAGGGCTGTCCCATGACTAGG - Intergenic
953604956 3:44406034-44406056 CCCAGGGTTGTCCCCTCAACAGG - Intronic
953842654 3:46401620-46401642 GCCAAGGCTGTGCCCTCCGTGGG - Intergenic
954335094 3:49911714-49911736 CCCTCGGTTGTGCCCTCCCTGGG + Exonic
954372057 3:50174174-50174196 GCCAGGCCTGCCCCCTCACTGGG - Intronic
954639720 3:52090766-52090788 CCCAGGGATGGGCGCTCAGTAGG - Intronic
954795264 3:53158162-53158184 CCCAGGGCTGTTCCTTCTGTGGG - Intronic
955003968 3:54952293-54952315 CCCAGGGCTCTGATCTCTCTGGG + Intronic
955209033 3:56923945-56923967 TCCAGGGCAGAGCCCTAACTGGG - Intronic
955571868 3:60315830-60315852 CGCAGGGCAGTGCACTCATTTGG + Intronic
956717767 3:72093278-72093300 CCCAGGGCTGGGCACTTAGTAGG + Intergenic
958844494 3:99249846-99249868 CTCAGAGCTGTGGCCTCCCTTGG + Intergenic
958978750 3:100696764-100696786 CCCAGGGTGGAGCCCTCACCAGG - Intergenic
958990991 3:100844719-100844741 CCTAGGCCTGTGCCCTCAAATGG - Intronic
960638725 3:119808286-119808308 CCCAGCACTGTGCCCCCACAAGG - Intronic
961360403 3:126363707-126363729 CCCGAGGGTGAGCCCTCACTAGG + Intergenic
961999656 3:131282525-131282547 ACCAGGGCTGTGCTCTGACCTGG - Intronic
962239868 3:133743359-133743381 CCCAGGGCTTTGCCAGCACAGGG - Intergenic
964289798 3:155165098-155165120 CCCAGGGCTTTGCACTTAATAGG + Intronic
964491599 3:157242005-157242027 CCTAGGGCTCTGCCCTAACCTGG - Intergenic
964759009 3:160115604-160115626 CCCAGTGCTGTGCTGGCACTAGG + Intergenic
965531017 3:169769623-169769645 CCCAGGACTCTGGCCTCACCCGG - Exonic
966440860 3:179942626-179942648 CCCAGGACTCTGCCTTCACTGGG + Intronic
967201665 3:187077383-187077405 CCCAGGGCTCTGCACTCTCAAGG + Exonic
967980240 3:195061186-195061208 CCCAAGGCTATGCCCTCACCCGG + Intergenic
968278218 3:197456850-197456872 CCCGGTGCTCTGCCCTCTCTGGG + Intergenic
968446763 4:656031-656053 CCCACAGCCTTGCCCTCACTGGG + Intronic
968447857 4:661419-661441 CACAGCTCTGTGCCCTCCCTGGG + Intronic
968592697 4:1466723-1466745 TCCAGTGCTGTGGCCTCCCTGGG - Intergenic
968659308 4:1792672-1792694 CCCAGGCCTGTGTCCTCCTTGGG + Intergenic
968832344 4:2939476-2939498 GCCAGGGCTGTGGGCTCAGTGGG - Intronic
968958594 4:3731211-3731233 CCCAGGGCTGGGAGCTCACAAGG + Intergenic
968966080 4:3769664-3769686 CCCAGGGCTGACCCCTCCCCAGG - Intergenic
969338058 4:6523133-6523155 CCAAGGACTGTGCCCTCAGAGGG + Intronic
984921506 4:184768272-184768294 CCCAGGACTGAGCACTGACTTGG - Intronic
985488117 5:163153-163175 CCCAGGGCTGTGTGCTCTGTGGG + Exonic
985673119 5:1216494-1216516 CCCTGGGCTGTGTCCTGACCTGG + Intronic
988467413 5:31503535-31503557 CCCAAGGTTGTGCCCTTCCTGGG + Intronic
990704860 5:58516269-58516291 CCCAGTTCTGTGCCCTTGCTGGG - Intergenic
992041222 5:72835490-72835512 CGAAGGGATGTGCCCTCACATGG + Intronic
992077118 5:73202057-73202079 CCCAGGGCTCTGCCCTCCGCCGG + Intergenic
992291476 5:75283944-75283966 CCCAGTGCTGTGCTGACACTGGG + Intergenic
992535906 5:77703362-77703384 CAGAGGGTTTTGCCCTCACTTGG - Intronic
992837613 5:80655625-80655647 CCCAAGGGTGACCCCTCACTTGG + Intronic
993075941 5:83231404-83231426 CCCAGTGCTGTGCACACAGTAGG + Intronic
997228852 5:132228465-132228487 CCCAGGGCCGAGCTCTCAGTGGG + Intronic
997235312 5:132269107-132269129 CCCAGGGTTATCCCCTAACTGGG - Intronic
998360453 5:141581607-141581629 CACAGGACTGTGGGCTCACTAGG + Intronic
998391633 5:141790587-141790609 CCTAGGGCTCTGCCTTCACATGG - Intergenic
998480747 5:142460631-142460653 CTCAGGGCTCTGCCCCCAGTGGG + Intergenic
999192420 5:149758128-149758150 CCATGAGCTGTGCCCTCACATGG - Intronic
999451407 5:151681024-151681046 CCCAGGGCTGGCCTCTTACTTGG + Intronic
999858418 5:155619863-155619885 CTCAGAGCTGTGTCCTCCCTGGG - Intergenic
1001086852 5:168706863-168706885 CCCAGGTCTCTGCCCCCAGTGGG - Intronic
1002453083 5:179330747-179330769 TCACGGGCTGTGTCCTCACTGGG - Intronic
1002467168 5:179413367-179413389 GACATGGCTGGGCCCTCACTCGG - Intergenic
1003119528 6:3308290-3308312 TCCAGGGCTAAGCCCTCCCTGGG + Intronic
1003271629 6:4612972-4612994 ACAAGGGCTGTGCCTGCACTTGG + Intergenic
1004288665 6:14346555-14346577 CCCAGCCCTGTGCCCTGCCTGGG - Intergenic
1004359827 6:14961240-14961262 CCCAGGGCTCTACCATCACGGGG + Intergenic
1005999698 6:30955548-30955570 TCCGGGGCTGGGCCCTCATTAGG + Intergenic
1006183680 6:32168641-32168663 CCCAGGGTCGTGCACTCTCTGGG - Exonic
1007239265 6:40413488-40413510 CCCAGGCCTGTGCTGTCTCTAGG + Intronic
1007243552 6:40443881-40443903 CCCATGGCTATGCCCTGACTGGG - Intronic
1007341264 6:41192756-41192778 CCCAGAGCTCTGCCCTCAGGAGG + Intronic
1007474148 6:42107711-42107733 CACAGGGCTGCTCCCTCTCTTGG - Intronic
1007665906 6:43512857-43512879 CCCAGGGCTATGGCCTCTTTGGG - Exonic
1007709247 6:43811394-43811416 CCCAGGGCTCAGCCTTTACTAGG + Intergenic
1007725076 6:43911243-43911265 CCCGGGGCTGTGCACACAGTAGG + Intergenic
1009622232 6:66092478-66092500 CTCAGGTCTGTGACGTCACTAGG + Intergenic
1011777512 6:90748285-90748307 CCCAGGGCTCTGTCCTCCCAAGG - Intergenic
1011850610 6:91623525-91623547 CTCATGGCTGTGCCTTCACTTGG + Intergenic
1013806504 6:114001960-114001982 CCCAGGGCTCTTCCTTCAGTAGG - Intronic
1015368463 6:132424566-132424588 CCCAGTTCTGTGCCCTTGCTGGG + Intergenic
1015587495 6:134790347-134790369 CCCAGTTCTGTGCCCTTGCTGGG - Intergenic
1017113454 6:150954073-150954095 CCTATGGCTGTTCCCTGACTCGG - Intronic
1018426639 6:163688880-163688902 CTCATTGCTGTTCCCTCACTTGG + Intergenic
1018908568 6:168089063-168089085 CCCAGGGCTGGCCCCACACCAGG + Intergenic
1018961620 6:168453234-168453256 CCCAGGGCTGTGCCCCAAGAGGG + Intronic
1019375874 7:691671-691693 CCCAGTGCTGTGACCTCACACGG + Intronic
1019633506 7:2063271-2063293 CCCAGGACTCTGCCCACTCTTGG - Intronic
1020126732 7:5536962-5536984 CTCCTGGCTGTGCCCTTACTGGG - Intronic
1021569884 7:22053899-22053921 CCCAGGGCTGGGCTTGCACTTGG + Intergenic
1023167238 7:37354973-37354995 CTCTGGGCTGTGCCTCCACTGGG + Intronic
1023939192 7:44759333-44759355 CCCAGGGCTGGGCGCAAACTGGG - Exonic
1026739517 7:72969867-72969889 CCCACGTCTGGGCCCTCACCTGG - Intergenic
1026970228 7:74463197-74463219 CCCAGAGATGTGACATCACTCGG - Intronic
1027220371 7:76210175-76210197 CCAAGGGCTGTGCCATCAGCTGG - Intronic
1028669598 7:93386426-93386448 CCCATGGCTGTACCCCCACTGGG - Intergenic
1029282025 7:99441502-99441524 GGAAGGGCTGTGGCCTCACTAGG - Intronic
1029520447 7:101057962-101057984 TCATGGGCTGAGCCCTCACTTGG + Intronic
1033029075 7:137807524-137807546 CCCAGGGATGTGCAGTGACTTGG - Intronic
1033318151 7:140315652-140315674 CCCAGGCCTGGACCCACACTAGG + Intronic
1033589221 7:142796548-142796570 CCCAGGGCTGTGCGAACACCGGG + Intergenic
1034276555 7:149826377-149826399 CCCAGGGCAGCTCCCTCCCTGGG + Intergenic
1034489276 7:151384730-151384752 CACATGGCTTTGGCCTCACTTGG - Intronic
1035173571 7:157034205-157034227 CCCAGGGCTTTGGGCTGACTCGG + Intergenic
1035719365 8:1780096-1780118 CCCAGGGCTCTGCTCTCATTGGG - Intronic
1036790311 8:11713420-11713442 CCCAGGACTCTGCCCTGCCTGGG + Intronic
1037121307 8:15290486-15290508 CCCAGGACAGTGCCCTCCTTGGG - Intergenic
1037818902 8:22126209-22126231 CCCAGGCCTCTGCCCTGGCTGGG - Intronic
1039102090 8:33951641-33951663 CACTGGGCTGTGCCCACCCTTGG - Intergenic
1039382571 8:37099878-37099900 CCCAGAGCTGAGCCCTGGCTTGG + Intergenic
1039636989 8:39178540-39178562 CCCAGTTCTGTGCCCTTGCTGGG + Intronic
1039885191 8:41650351-41650373 CCCAGGGCTGGGCCCCCAGCTGG - Intronic
1040008691 8:42642840-42642862 CCCAGGGCTCTGCTCTCTCATGG + Intergenic
1041078585 8:54191791-54191813 CACTGGGTTATGCCCTCACTGGG - Intergenic
1044001907 8:86893288-86893310 CCTAGGGCAGTACCTTCACTAGG + Intronic
1044765059 8:95562802-95562824 CCCATGGCTGTGCAATCCCTGGG + Intergenic
1044784397 8:95779194-95779216 CCCTGGGCTCCGCCCTCAGTGGG + Intergenic
1045577816 8:103444965-103444987 CCCAGGGCTGCTCCCTGCCTTGG - Intergenic
1047216069 8:122876900-122876922 CCCAAGCCTCTGCCCTCAATGGG + Intronic
1048263805 8:132967668-132967690 CTCAGGCCTCTGCCCTAACTAGG + Intronic
1048393888 8:133994523-133994545 TCCAAGGCTGAGCCCTCAATAGG - Intergenic
1049183829 8:141238349-141238371 CCCTGAGCTGTGCGCTCACAGGG - Intronic
1049404647 8:142446986-142447008 CCCAGTGCTGGGCCCACCCTGGG + Intergenic
1049438674 8:142599313-142599335 GACAGGGCTGTGCCCTGAGTGGG + Intergenic
1052932626 9:34068142-34068164 CCCAGGGCTGCACCTTCAGTAGG + Intergenic
1053222650 9:36325073-36325095 CCCATGGGTGTGCCTTCTCTAGG - Intergenic
1053365226 9:37518069-37518091 CCCAGGGTTGTGCCCTGTGTGGG + Intronic
1056659114 9:88531971-88531993 CACAGGGCCCTGCACTCACTTGG - Intergenic
1056752831 9:89364341-89364363 CCCAAGGCTCTGCCATCACCAGG + Intronic
1057274639 9:93669850-93669872 CCCAGGGCAGTGGCCCCACCAGG - Intronic
1057624672 9:96666741-96666763 TCCAGGGCTGTGCTCTCAGAAGG - Intergenic
1059812849 9:117875518-117875540 CCCAGGGCTGTGTTCTATCTAGG + Intergenic
1059910807 9:119041766-119041788 CACAGGGCTCTGCACTCACAAGG - Intergenic
1060066959 9:120510712-120510734 CCCAAGTCTATGCCCTAACTGGG - Intronic
1060103790 9:120861264-120861286 CTGAGGGCTGGGCCCTCCCTAGG + Intronic
1060186232 9:121565804-121565826 ACCAAGGCTGTGCACTCTCTGGG + Intergenic
1060215851 9:121737859-121737881 CCCAGGACTGAGTCCTCAGTGGG + Intronic
1061815522 9:133192253-133192275 CCAATGGCTTTCCCCTCACTGGG + Intergenic
1061869988 9:133515399-133515421 ACCAGGGCTGTGCCCACGCTGGG - Intronic
1061937647 9:133867111-133867133 CCCATGGCCGTGTCCTCACTCGG - Intronic
1062006447 9:134240662-134240684 CCCACGGCTGTGGCCTCATTAGG - Intergenic
1062716532 9:138013287-138013309 CCCATGGCTGGGCCCTCCCCAGG + Intronic
1185462957 X:340736-340758 CCCTGGGCCATGCCCTCACGGGG + Intronic
1186033385 X:5393781-5393803 CTCTTGGCTGTGTCCTCACTTGG - Intergenic
1186913272 X:14192832-14192854 CCCAGTTCTGTGCCCTTGCTGGG + Intergenic
1189004689 X:36983559-36983581 CACATGGCTTTGCCCTCAGTAGG - Intergenic
1189655593 X:43241219-43241241 CTCAAAGCTGTGCCTTCACTAGG - Intergenic
1190113298 X:47609247-47609269 CTCATGGCTGTGTCCCCACTGGG + Intronic
1190217252 X:48488168-48488190 GACAGGGCTGTGCCCTCCCCTGG - Intergenic
1193164207 X:78263369-78263391 CCCAGTTCTGTGCCCTTGCTGGG + Intergenic
1195329693 X:103786803-103786825 CCCAAGGCTGGGTCCTCTCTAGG + Intronic
1196886428 X:120250774-120250796 CCCCGCGCTGTGCCCTCTGTCGG + Exonic
1199612822 X:149632080-149632102 CCCAGGGCTCAGTCGTCACTGGG - Intergenic
1199903643 X:152203095-152203117 TCCAGGTCTGTGTCCTCTCTGGG - Intronic
1200215784 X:154367721-154367743 CACAGGCCTGTGTCCTGACTGGG - Exonic