ID: 1167332896

View in Genome Browser
Species Human (GRCh38)
Location 19:48867451-48867473
Sequence CTTAACAACCAGAGTCCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167332891_1167332896 -1 Left 1167332891 19:48867429-48867451 CCCGTTGCTAAGGATCTTTGTCC 0: 1
1: 0
2: 0
3: 13
4: 126
Right 1167332896 19:48867451-48867473 CTTAACAACCAGAGTCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1167332892_1167332896 -2 Left 1167332892 19:48867430-48867452 CCGTTGCTAAGGATCTTTGTCCT 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1167332896 19:48867451-48867473 CTTAACAACCAGAGTCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1167332890_1167332896 0 Left 1167332890 19:48867428-48867450 CCCCGTTGCTAAGGATCTTTGTC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1167332896 19:48867451-48867473 CTTAACAACCAGAGTCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 117
1167332888_1167332896 19 Left 1167332888 19:48867409-48867431 CCTTACTATGTCTGGCAGACCCC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1167332896 19:48867451-48867473 CTTAACAACCAGAGTCCTTGGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167332896 Original CRISPR CTTAACAACCAGAGTCCTTG GGG Intronic
903442741 1:23400752-23400774 CTTACCAAACTGAGCCCTTGTGG + Intronic
904528763 1:31154934-31154956 CGGAACAAAGAGAGTCCTTGGGG + Intergenic
908304757 1:62801223-62801245 CAAAAAAAACAGAGTCCTTGAGG + Intronic
908777272 1:67652481-67652503 CTTAACAACCAGATTGCTGGTGG + Intergenic
913514798 1:119595647-119595669 CCTAGCATCTAGAGTCCTTGGGG - Intergenic
1065668380 10:28087144-28087166 TTTAACAACCAGCTTTCTTGGGG - Intronic
1076323507 10:129601718-129601740 ATAAATAACCAAAGTCCTTGGGG + Intronic
1080739537 11:35050646-35050668 CTTGCTAACCAGAGACCTTGGGG - Intergenic
1081317771 11:41651190-41651212 CTTGAAATCCAGGGTCCTTGTGG + Intergenic
1081573379 11:44304782-44304804 CTTAGAAACCAGAGTCCTCCGGG + Intronic
1085699008 11:78729713-78729735 CTGAACACCCAGAGTCCATGGGG - Intronic
1085761463 11:79244845-79244867 TTAAACAACCAGAGACCTTCAGG + Intronic
1087542602 11:99540061-99540083 CACAACAAAGAGAGTCCTTGTGG - Intronic
1087566568 11:99867332-99867354 CATAAGAACCAGAGTGCATGAGG + Intronic
1089599159 11:119602914-119602936 CTTCACAACCACAGCCCTGGTGG + Intergenic
1090383577 11:126343670-126343692 CTTAAGGACCAGAGTCTATGGGG - Intronic
1090492591 11:127177852-127177874 CATATCAACCAGAGTCCCAGCGG + Intergenic
1095488444 12:42708227-42708249 CTTGAAAACCAGGGTCCTGGTGG - Intergenic
1096411367 12:51379265-51379287 AGTAGCACCCAGAGTCCTTGTGG - Intronic
1097615625 12:61880693-61880715 CTTCACAACCATAGCCCTGGTGG - Intronic
1099147601 12:79066289-79066311 CTTGATCCCCAGAGTCCTTGTGG + Intronic
1101518952 12:105463839-105463861 CTTAACATCCAGAGTAGCTGGGG + Intergenic
1107524286 13:41214475-41214497 CCTAGCAACTACAGTCCTTGTGG + Intergenic
1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG + Intergenic
1109128397 13:58547814-58547836 CCTAACATCCAGAATCCTTCTGG + Intergenic
1109588871 13:64448424-64448446 TTTAACAAACAGATTACTTGGGG + Intergenic
1110852014 13:80257132-80257154 CTTAACAACCAGCTTCCCTATGG - Intergenic
1111409993 13:87862843-87862865 TATAACCAGCAGAGTCCTTGTGG + Intergenic
1111733072 13:92101349-92101371 CTTAGCAACCCCATTCCTTGGGG + Intronic
1113404459 13:110025131-110025153 TTAAACAAACAGAGTCTTTGTGG + Intergenic
1114566784 14:23639058-23639080 TTTAAAACCCTGAGTCCTTGTGG - Intronic
1115867279 14:37761120-37761142 CTTGAAACCCAGGGTCCTTGTGG + Intronic
1118844044 14:69533059-69533081 CTTAATAACCAAATCCCTTGTGG + Intergenic
1121912586 14:97805059-97805081 CTCAACATCCTGAGTCCTTAAGG + Intergenic
1122110316 14:99495905-99495927 CTTAAGAAGCAGAGTCCTAATGG - Intronic
1125534104 15:40433302-40433324 TTTACCTACCAGAGTTCTTGAGG + Intronic
1128055673 15:64698187-64698209 CTTAGCAAGAAGAGTCCCTGTGG - Intronic
1129003130 15:72350476-72350498 CATAACAAGCAGAGTCCCTCTGG + Intronic
1129071195 15:72952927-72952949 CTTAAAACCCAGGGTCCTTGAGG - Intergenic
1129242838 15:74261774-74261796 CTGAACAATCTGAGTGCTTGAGG + Intronic
1130823228 15:87517250-87517272 ATTAACGACTAGAGTCCTTCAGG + Intergenic
1134309181 16:13060369-13060391 CTTATCAACCAGAGGACATGAGG + Intronic
1139654808 16:68381035-68381057 TTTAACAAACTGAGTCCTAGAGG + Intronic
1143868420 17:9940674-9940696 CTTGACAATCAGAGGCATTGGGG - Intronic
1143942748 17:10559618-10559640 CTTCAGAATCAGAGTCCTTAGGG - Intergenic
1148149600 17:45388812-45388834 CAGTACAAGCAGAGTCCTTGGGG - Intergenic
1151697371 17:75724439-75724461 CTCGCAAACCAGAGTCCTTGAGG + Intronic
1152016265 17:77752769-77752791 CGTAAAAACCAAAATCCTTGAGG - Intergenic
1153721542 18:7908455-7908477 CTTAACAAAGAGGGTCCTGGTGG - Intronic
1153885047 18:9457159-9457181 CTTAACATCCAGAGGCCAAGAGG - Intergenic
1157063501 18:44320857-44320879 CTTCACAACCACAGCCCTGGTGG + Intergenic
1159661269 18:71098226-71098248 CTTGAAACCCAGAGCCCTTGTGG + Intergenic
1165964761 19:39567093-39567115 CCTAACATCCAGATACCTTGAGG - Intergenic
1165979836 19:39711284-39711306 CCTAACATCCAGATACCTTGAGG + Intergenic
1165982416 19:39735790-39735812 CTGAACAAGGAGGGTCCTTGTGG + Intronic
1166641865 19:44500437-44500459 CTTAACCCCCAGCGGCCTTGCGG - Exonic
1167332896 19:48867451-48867473 CTTAACAACCAGAGTCCTTGGGG + Intronic
1167862681 19:52297778-52297800 CTTGACATCCAGTGTTCTTGCGG + Intronic
927141690 2:20135330-20135352 CTTCACTACCTGAGTCCTTAGGG + Intergenic
927670138 2:25062172-25062194 CTTCATCACCAGAGGCCTTGTGG + Intronic
929055610 2:37873857-37873879 CTTATCCACCAGATTCCATGAGG - Intergenic
929147713 2:38721383-38721405 CTTAACAAAGAGAGTTCATGAGG - Intronic
933177126 2:79187440-79187462 CTTAAAAATAAGCGTCCTTGTGG - Intronic
934030606 2:88042442-88042464 TTAAAAAACCAGAGTCCCTGAGG + Intronic
934125223 2:88881906-88881928 CTTAGAAACCAGTGTCCCTGTGG + Intergenic
936597891 2:113866675-113866697 TTTAACAACTAGAGTCGTTTTGG + Intergenic
936629779 2:114189640-114189662 CTTGACAACCACTGTCTTTGTGG + Intergenic
941657601 2:168160722-168160744 CTGAACAACTAGACTGCTTGGGG + Intronic
942651838 2:178177282-178177304 CTCAAGAAGCAAAGTCCTTGAGG + Intergenic
943207182 2:184915739-184915761 CTAAAGAACGAGAGGCCTTGGGG + Intronic
944825590 2:203480207-203480229 TTTACAAGCCAGAGTCCTTGGGG + Intronic
946335759 2:219035515-219035537 TTTCAGAACCAGATTCCTTGTGG + Exonic
946457421 2:219838863-219838885 CTCAACAACCAAAGTCTTTGTGG - Intergenic
946960531 2:224980239-224980261 CTTCTCAAACAGAGTCTTTGGGG + Intronic
948394143 2:237632210-237632232 CTCCACAACTGGAGTCCTTGGGG - Intronic
1169576522 20:6968446-6968468 CTTAACAACCTGAGTGCCTTGGG - Intergenic
1169735562 20:8833933-8833955 CTTTACAACCACATTTCTTGTGG + Intronic
1174079286 20:47959575-47959597 CTTAACAACCAAATGCCGTGTGG - Intergenic
1174138421 20:48396464-48396486 CTTAACAACCAGATGCCATGTGG + Intergenic
1178122432 21:29482695-29482717 CTTACCAACCAGACGCCTTCAGG + Intronic
1182533332 22:30980149-30980171 CTTAAGAATCAAAGTCCTTGTGG - Intergenic
951643852 3:24866049-24866071 CTTAAAATCCAGAATCCCTGTGG - Intergenic
951832116 3:26942645-26942667 CTTAAAACCCAGGGCCCTTGTGG - Intergenic
952250349 3:31647471-31647493 CTTACCAAGCAAAGTCCTGGAGG + Intergenic
960305250 3:116052542-116052564 CTTACCTACCAGAGACCTAGAGG - Intronic
964217023 3:154296789-154296811 CTTCACAGTCAGAGTCCATGGGG - Intronic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967456255 3:189689940-189689962 CTTAACAGGGAAAGTCCTTGGGG + Intronic
971954636 4:33400605-33400627 CTTCACAACCACAGCCCTGGTGG - Intergenic
976315331 4:83653677-83653699 CATCACTACCAGAGCCCTTGAGG - Intergenic
990803467 5:59631782-59631804 CTTGAAACCCAGAGCCCTTGTGG - Intronic
990897870 5:60718167-60718189 CTTAAGAACCATTGCCCTTGAGG + Intergenic
995344018 5:111091105-111091127 CTTAACATCCAAAGTGTTTGAGG + Intergenic
997082755 5:130759926-130759948 CCTAACAACCAGAGGATTTGTGG - Intergenic
997809574 5:136954149-136954171 CTTTAAAACCAGTGCCCTTGTGG + Intergenic
1001124378 5:169006388-169006410 CTTAACAACACGACTCCCTGTGG + Intronic
1003982662 6:11404068-11404090 ATTGACAACCAGAGGCCTTGTGG - Intergenic
1006189956 6:32201587-32201609 CTTAGCAACCAAAGCCCTAGAGG - Intronic
1007297595 6:40838241-40838263 CTTAAAAACCAACGTCCTAGGGG - Intergenic
1011493601 6:87917023-87917045 AATAAGAACCAGAGGCCTTGAGG - Intergenic
1013938223 6:115626313-115626335 CTTAGGAACTACAGTCCTTGAGG - Intergenic
1014387108 6:120816297-120816319 CTTGAAACCCAGAGCCCTTGTGG + Intergenic
1015277214 6:131396003-131396025 TTTAAAAATCAGAGTTCTTGTGG - Intergenic
1015539140 6:134297056-134297078 CTTCACAACCACAGCCCTGGTGG + Intronic
1018934054 6:168261637-168261659 CCCAATAACCAGAGTCCCTGTGG + Intergenic
1022036637 7:26541014-26541036 CTTACCAAACAGAGACCTTGGGG - Intergenic
1031967358 7:128036479-128036501 CTTAAAGAGCTGAGTCCTTGGGG - Intronic
1032957162 7:136984548-136984570 CTTGAAACCCAGAGCCCTTGTGG + Intronic
1035161359 7:156952462-156952484 CTTTTCAAGCAGAGTCTTTGTGG + Exonic
1035577728 8:718776-718798 CTGAAGACCCAGAGGCCTTGGGG - Intronic
1035978753 8:4343998-4344020 TTTCACAACCACAGTGCTTGTGG - Intronic
1044199002 8:89412677-89412699 CTTCACAACCACAGCCCTAGAGG + Intergenic
1045423761 8:102042672-102042694 ACTACCAACCAGACTCCTTGGGG + Intronic
1045628703 8:104088693-104088715 TCAAACAACCAGAGTTCTTGAGG + Intronic
1047678146 8:127225456-127225478 CCTAAAAACCAGAGACCTTTGGG + Intergenic
1048861813 8:138729320-138729342 CTTAACATGCAGAGTCTTTTAGG - Intronic
1049035420 8:140071652-140071674 CTTAACCCCCAGAGACCCTGTGG - Intronic
1051800268 9:20924894-20924916 CTTAAAATTCAGAGTCCTTTGGG + Intronic
1186932160 X:14405745-14405767 CTTAAGAACCAGGGCCCTTAGGG - Intergenic
1187101573 X:16198174-16198196 CTGAAAAACCAGATTCTTTGTGG + Intergenic
1189984618 X:46543388-46543410 CTTATCAAACAGAGCCCTAGAGG + Intronic
1192999651 X:76550529-76550551 CTTAAAACCCAGGGTCCTGGTGG + Intergenic
1194196622 X:90902710-90902732 CTGAACCAGCAGAGTCCCTGTGG - Intergenic
1198552001 X:137755241-137755263 CTCATCAAGCAGTGTCCTTGGGG + Intergenic
1199800915 X:151249837-151249859 CTACAAAACCAGAGTCCCTGAGG + Intergenic
1200542469 Y:4476911-4476933 CTGAACCAGCAGAGTCCCTGTGG - Intergenic