ID: 1167334784 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:48878070-48878092 |
Sequence | GAGCCTGAACACTGGCTGAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167334784_1167334788 | 6 | Left | 1167334784 | 19:48878070-48878092 | CCCCTCAGCCAGTGTTCAGGCTC | No data | ||
Right | 1167334788 | 19:48878099-48878121 | CAGTCATGAAAATGAATTCAAGG | No data | ||||
1167334784_1167334789 | 15 | Left | 1167334784 | 19:48878070-48878092 | CCCCTCAGCCAGTGTTCAGGCTC | No data | ||
Right | 1167334789 | 19:48878108-48878130 | AAATGAATTCAAGGACGAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167334784 | Original CRISPR | GAGCCTGAACACTGGCTGAG GGG (reversed) | Intergenic | ||