ID: 1167334784

View in Genome Browser
Species Human (GRCh38)
Location 19:48878070-48878092
Sequence GAGCCTGAACACTGGCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167334784_1167334788 6 Left 1167334784 19:48878070-48878092 CCCCTCAGCCAGTGTTCAGGCTC No data
Right 1167334788 19:48878099-48878121 CAGTCATGAAAATGAATTCAAGG No data
1167334784_1167334789 15 Left 1167334784 19:48878070-48878092 CCCCTCAGCCAGTGTTCAGGCTC No data
Right 1167334789 19:48878108-48878130 AAATGAATTCAAGGACGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167334784 Original CRISPR GAGCCTGAACACTGGCTGAG GGG (reversed) Intergenic