ID: 1167337510

View in Genome Browser
Species Human (GRCh38)
Location 19:48896062-48896084
Sequence AAACCCGGGATTGCGGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167337510_1167337522 -7 Left 1167337510 19:48896062-48896084 CCCGTCTCCGCAATCCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1167337522 19:48896078-48896100 CGGGTTTGGGGTGGGGGTCCCGG 0: 1
1: 0
2: 4
3: 85
4: 685
1167337510_1167337523 3 Left 1167337510 19:48896062-48896084 CCCGTCTCCGCAATCCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167337510 Original CRISPR AAACCCGGGATTGCGGAGAC GGG (reversed) Intronic
902214814 1:14927849-14927871 AAACCCGCGGTTGAGGGGACTGG + Intronic
905974915 1:42167904-42167926 GAGCCGGGGCTTGCGGAGACCGG + Intergenic
920140609 1:203809419-203809441 CAACCTGGGATTTCGGAGATGGG - Intronic
1069900000 10:71701751-71701773 AAACCCTGGATTTTGGAGACTGG - Intronic
1076674770 10:132142208-132142230 AAACCAGGGATTGGGGATCCCGG + Intronic
1097604522 12:61736088-61736110 AAGCCAGGGATTGCTGAGAAGGG - Intronic
1099368651 12:81801748-81801770 ATACGCGGTATGGCGGAGACTGG - Intergenic
1099641995 12:85301679-85301701 AAAACAGGGTTTGTGGAGACTGG - Exonic
1109094725 13:58098196-58098218 ACTCCCTGGATTGAGGAGACAGG - Intergenic
1110707160 13:78608955-78608977 AAACCCGAGAGTGCGGAGCTGGG + Intergenic
1114670848 14:24410158-24410180 AAACCAGGGGTTGCGGCGAGTGG + Exonic
1122706305 14:103624273-103624295 CAACCAGGGCTTGCTGAGACAGG + Intronic
1137597274 16:49733175-49733197 AAACGAGGAATTTCGGAGACGGG - Intronic
1144037098 17:11376866-11376888 AAATCCGGGATTCTGGAGCCGGG + Intronic
1148791869 17:50177861-50177883 AAACCAGGAGTTGCGCAGACCGG + Intergenic
1156845371 18:41659525-41659547 ACAATGGGGATTGCGGAGACAGG + Intergenic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1167045416 19:47046307-47046329 AAAGCCAGGGTTGAGGAGACAGG + Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
1168380249 19:55914129-55914151 AAACCCAGGAATGGGGAGAATGG - Intronic
925043233 2:750463-750485 GAACCTGGGATGGTGGAGACTGG - Intergenic
936469631 2:112787333-112787355 AAAACGGGGGTTGCGGAGAAGGG + Intergenic
1172793930 20:37524310-37524332 AAACCCAGTATTGGGGAGAGAGG - Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1179245501 21:39630712-39630734 AAAGCTGGGATTGCTGAGAGTGG + Intronic
1180165440 21:46023308-46023330 TCACCCTGGATTGCGGACACTGG - Intergenic
964438258 3:156675555-156675577 ACACCCGGAATTGCAGAGCCGGG + Intronic
968076847 3:195820660-195820682 CAGCCCGGGAATGCGGAGAATGG - Intergenic
976972685 4:91126867-91126889 AAACCTGGGATTGAAGATACAGG + Intronic
978334779 4:107654767-107654789 AAACTCTGGATTGCGAAGAATGG + Exonic
981575691 4:146202736-146202758 AAACCCAGGATGGAGGAGACAGG - Intergenic
984041993 4:174746479-174746501 ATACCAGGGACTGGGGAGACCGG + Intronic
985114597 4:186578291-186578313 AAAGTGGGGATTGCGGCGACAGG + Intergenic
991290240 5:65026724-65026746 AAACATGGCATTGAGGAGACAGG + Intergenic
994534880 5:101017227-101017249 CAACCCAGGATTGAGAAGACTGG - Intergenic
995752434 5:115467512-115467534 ACACATGGGATTGAGGAGACAGG + Intergenic
996423784 5:123290866-123290888 AGCCATGGGATTGCGGAGACTGG - Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1001447102 5:171794126-171794148 GGACCTGGGATTGTGGAGACTGG + Intronic
1003442031 6:6151788-6151810 AAACCTTGGGTTGGGGAGACCGG - Intronic
1019928822 7:4210166-4210188 AGACCCGGGGTTGGGGAGATGGG + Intronic
1021871174 7:25007655-25007677 AACCCCAGGATTGCGAAGCCTGG - Intergenic
1022681154 7:32547580-32547602 GAACCAGGGAGTGGGGAGACAGG - Intronic
1023909102 7:44541246-44541268 AGACCTGGGATGGCGGAGGCCGG - Exonic
1025757113 7:64355210-64355232 AAACCTGGAATTGCTGACACAGG + Intergenic
1047929671 8:129714067-129714089 AAACCCGGGATGCTGCAGACAGG + Intergenic
1047968239 8:130063418-130063440 AAAGCCAGGAGTGCGGAGAGAGG - Intronic
1062169382 9:135126528-135126550 AAACCTGGGACTGCCGAGCCTGG + Intergenic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic