ID: 1167337523

View in Genome Browser
Species Human (GRCh38)
Location 19:48896088-48896110
Sequence GTGGGGGTCCCGGCTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 173}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167337505_1167337523 11 Left 1167337505 19:48896054-48896076 CCCTAGACCCCGTCTCCGCAATC 0: 1
1: 0
2: 0
3: 3
4: 37
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337501_1167337523 19 Left 1167337501 19:48896046-48896068 CCCCGGACCCCTAGACCCCGTCT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337506_1167337523 10 Left 1167337506 19:48896055-48896077 CCTAGACCCCGTCTCCGCAATCC 0: 1
1: 0
2: 0
3: 12
4: 240
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337500_1167337523 22 Left 1167337500 19:48896043-48896065 CCGCCCCGGACCCCTAGACCCCG 0: 1
1: 1
2: 1
3: 22
4: 215
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337515_1167337523 -4 Left 1167337515 19:48896069-48896091 CCGCAATCCCGGGTTTGGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337503_1167337523 17 Left 1167337503 19:48896048-48896070 CCGGACCCCTAGACCCCGTCTCC 0: 1
1: 0
2: 1
3: 14
4: 226
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337511_1167337523 2 Left 1167337511 19:48896063-48896085 CCGTCTCCGCAATCCCGGGTTTG 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337509_1167337523 4 Left 1167337509 19:48896061-48896083 CCCCGTCTCCGCAATCCCGGGTT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337498_1167337523 24 Left 1167337498 19:48896041-48896063 CCCCGCCCCGGACCCCTAGACCC 0: 1
1: 0
2: 1
3: 25
4: 287
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337497_1167337523 29 Left 1167337497 19:48896036-48896058 CCGCGCCCCGCCCCGGACCCCTA 0: 1
1: 0
2: 2
3: 77
4: 758
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337499_1167337523 23 Left 1167337499 19:48896042-48896064 CCCGCCCCGGACCCCTAGACCCC 0: 1
1: 2
2: 1
3: 27
4: 393
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337510_1167337523 3 Left 1167337510 19:48896062-48896084 CCCGTCTCCGCAATCCCGGGTTT 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337502_1167337523 18 Left 1167337502 19:48896047-48896069 CCCGGACCCCTAGACCCCGTCTC 0: 1
1: 0
2: 1
3: 15
4: 181
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173
1167337504_1167337523 12 Left 1167337504 19:48896053-48896075 CCCCTAGACCCCGTCTCCGCAAT 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167337523 Original CRISPR GTGGGGGTCCCGGCTTTCCC AGG Intronic
900116546 1:1031605-1031627 GTGGGGGGCCTGGCTGCCCCAGG - Intronic
900149488 1:1171875-1171897 GAAGGGGCCCCGGCTGTCCCTGG - Intergenic
900242142 1:1622156-1622178 GTGGGGGACACGGCAGTCCCAGG - Intronic
901005199 1:6168351-6168373 CTGGGGGTCCCAGCTTCCCCAGG - Intronic
902672424 1:17983980-17984002 GTGGGGGTCTGGCCTTACCCAGG - Intergenic
903130584 1:21277104-21277126 GGGGTGGTCACTGCTTTCCCAGG + Intronic
903193465 1:21669107-21669129 GTGGGGGACCCGGGTCTCCAGGG - Intronic
903339457 1:22644544-22644566 GTGTGGGCCCCAGCTTCCCCAGG - Intronic
903744130 1:25575223-25575245 GCTGGAGTCCTGGCTTTCCCAGG - Intergenic
904495785 1:30885899-30885921 GGAGGGGGCCTGGCTTTCCCAGG - Intronic
906448393 1:45922762-45922784 GTGGGGCTCCCACTTTTCCCTGG + Intronic
915922413 1:159986601-159986623 GTGGGGGTAGGGGGTTTCCCTGG - Intergenic
916005321 1:160654258-160654280 GTGGGGATCCCTGCCTTCCTGGG + Intergenic
917800249 1:178563280-178563302 GTGGGGGTACCTGCATCCCCAGG + Intergenic
922160669 1:223077495-223077517 GTGGGGTTCCTTCCTTTCCCAGG - Intergenic
924567331 1:245209822-245209844 GTGGGTGGCCATGCTTTCCCTGG + Intronic
1062796519 10:348610-348632 GTGGAGGCCCCGACATTCCCAGG + Intronic
1064308257 10:14187902-14187924 GTGGGGTTCCCAGTTTTCCCGGG + Intronic
1065228659 10:23574176-23574198 GTGGAAGTCCAGGGTTTCCCTGG - Intergenic
1066309073 10:34177819-34177841 GTGGGGGTCCTCGCTTTCCTTGG + Intronic
1068060794 10:52064751-52064773 GTGGGGGTCCCTCCTGTCCCCGG + Intronic
1070569670 10:77631538-77631560 GTGGGCGTCCCGGCTCACACTGG - Intronic
1071119808 10:82264389-82264411 GTGGGGGTCGCAGTTTCCCCCGG - Intronic
1071166835 10:82816759-82816781 GTGGGGCTCCCAGCTGTTCCAGG + Intronic
1072726365 10:97816513-97816535 GTGGGGGCCCCAGCTGTGCCTGG - Intergenic
1074270033 10:111944812-111944834 GTGGGGGTCCCTTCTGTCCCTGG - Intergenic
1074592071 10:114822318-114822340 GCGGGGGTCCCGTCGGTCCCTGG + Intronic
1076739765 10:132477452-132477474 GTGGGGGCCCCGCCTGGCCCAGG - Intergenic
1076880779 10:133238169-133238191 GGGGGGGTCCCTTCCTTCCCAGG + Intronic
1077034711 11:489044-489066 GTGGGTGCCCCGGCTCTGCCTGG + Intronic
1077311410 11:1890512-1890534 GTGGGGGTCCAGGGGTTCCCTGG + Exonic
1077476216 11:2791705-2791727 GTGGGGGGCCCGGGCCTCCCGGG + Intronic
1077503621 11:2920229-2920251 GTGGGGGTCCAGCCCCTCCCAGG - Intronic
1078495315 11:11811401-11811423 GCGAGGGACCCGGCCTTCCCTGG + Intergenic
1083213910 11:61206679-61206701 GTGGGTGTCCAGGGTTCCCCAGG - Intronic
1083216794 11:61225508-61225530 GTGGGTGTCCAGGGTTCCCCAGG - Intronic
1083219676 11:61244334-61244356 GTGGGTGTCCAGGGTTCCCCAGG - Intronic
1084459334 11:69287423-69287445 GTGGGGGACTAGGCTCTCCCAGG - Intergenic
1084533860 11:69745629-69745651 CTGGGGGCCCTGGCTGTCCCTGG + Intergenic
1089242824 11:117097421-117097443 GTGGGGGTGGGGGCTGTCCCAGG - Intronic
1091796930 12:3302949-3302971 GTGGGGGTCCCCATGTTCCCGGG - Intergenic
1093164435 12:15789173-15789195 CTCGGGGCCACGGCTTTCCCCGG + Exonic
1094651387 12:32379936-32379958 GTGGGTGACCCGGCTTTTCATGG - Intronic
1094870269 12:34595753-34595775 TTGGGGATCCTGGGTTTCCCTGG + Intergenic
1099162500 12:79260588-79260610 GTGAGGGTCCTGCCTTTCCCAGG + Intronic
1102156419 12:110733158-110733180 GTGGGGATCCCATCTTTCACCGG - Intronic
1103930138 12:124445630-124445652 GTGGGGCTCCCAGCTTCCCCTGG - Intronic
1104976667 12:132555263-132555285 AGGGGGGTCACGGCTTTCTCTGG + Intronic
1106027881 13:25972602-25972624 GGGGGGGTTCCTGCTTCCCCAGG - Intronic
1106758047 13:32841603-32841625 GTGGGAGACACGGCTTCCCCTGG - Intergenic
1107513491 13:41107544-41107566 GTGGGGCTCCCGCTTGTCCCTGG - Intergenic
1107841011 13:44458520-44458542 GTGGGGCTCCCGCCTGTTCCTGG - Intronic
1113794866 13:113051028-113051050 GTGGGGGACCCAGCTCTTCCCGG + Intronic
1118209222 14:63751036-63751058 GTGGGGGGCCCGCCTCTGCCCGG - Intergenic
1119517377 14:75258895-75258917 GGGGGTGTCCTGGCTTTCCAGGG + Intronic
1122079091 14:99254501-99254523 GTGAGGGTCCTGCCTTTTCCAGG - Intronic
1122144498 14:99681499-99681521 GTGGGGCTCCAGGCTGTGCCTGG + Intergenic
1124249591 15:28098009-28098031 GGGGAGGTCCTGGCTGTCCCTGG - Intronic
1127415052 15:58749630-58749652 GGGGAGGTCCCGGCTTCCCGTGG - Exonic
1128264481 15:66254510-66254532 GTGGGGGTCTCGACCTTGCCTGG - Intergenic
1128889316 15:71316713-71316735 TTGGGGGCCCAGCCTTTCCCAGG - Intronic
1132553003 16:560915-560937 GTGGGGCGCCCTGCGTTCCCGGG + Intronic
1132978905 16:2724895-2724917 GTGGGGAGCCCTGCCTTCCCAGG + Intergenic
1133162538 16:3921490-3921512 GTGGAGGTCCCGGCTGTTGCAGG + Intergenic
1133298382 16:4766856-4766878 CTGGGGGTCCCAGCTCTCCCAGG - Intronic
1133403675 16:5506697-5506719 GTGTGGGTTACGGCTTCCCCAGG + Intergenic
1135586972 16:23678981-23679003 CCGGGGACCCCGGCTTTCCCAGG - Exonic
1135929968 16:26728062-26728084 GAGGGAGGCCCCGCTTTCCCTGG + Intergenic
1136628854 16:31477618-31477640 CTGGAGGACCCGGCTTTTCCGGG - Exonic
1136996722 16:35195729-35195751 GTGGGGTTCCCGGGTCTCCATGG - Intergenic
1137568455 16:49549195-49549217 GTGGGGCTCTTGGCTTTGCCTGG + Intronic
1138352919 16:56355917-56355939 GGGGGGGGCCAGGCTTCCCCAGG + Intronic
1138450571 16:57091729-57091751 CTGGGGGGCGGGGCTTTCCCGGG - Intergenic
1140134730 16:72195830-72195852 CTGGGGGTCCTGCCTTTCCTTGG + Intergenic
1140967143 16:79977860-79977882 GTGGGGGTCTCTGCTGTGCCTGG - Intergenic
1141116797 16:81315625-81315647 GTGCGGGTCCCGGCCGGCCCAGG - Intronic
1142036934 16:87868239-87868261 GTGCGGGTCCCAGGTTTCTCTGG - Intronic
1142697051 17:1639584-1639606 GTGAAGGGCCCGCCTTTCCCTGG + Intronic
1146723513 17:35139793-35139815 GTGGGGGTGCAGTCTTTGCCTGG - Intronic
1151370496 17:73644007-73644029 GTGGGGGTCCCTCCTTACCTTGG + Exonic
1151487096 17:74407818-74407840 GTAGGGGTCCTGGCTTTGGCTGG - Intergenic
1151547466 17:74801957-74801979 GTGGGGGTTCACGCTGTCCCTGG - Intronic
1151826023 17:76524857-76524879 GTGCGGGCCCCGCCTTTCCAGGG - Intergenic
1152146747 17:78572999-78573021 GTGCGGGACCCAGTTTTCCCAGG - Intronic
1153480747 18:5543857-5543879 GAGGGGGTCTCGGCTTTACGAGG - Intronic
1158934841 18:62354806-62354828 GTGGGGATCCCAGGTTTCCACGG - Intronic
1160860226 19:1234500-1234522 GTGGGGGTCCGGGAGTCCCCGGG + Intronic
1160870226 19:1274583-1274605 GCGGGGGACCCGGCGCTCCCGGG - Intronic
1160930095 19:1566458-1566480 CTGGGGGTCCCTGCCTCCCCGGG - Intronic
1161574552 19:5048453-5048475 GTGGCGCTCCCGCCCTTCCCGGG + Intronic
1162566682 19:11448636-11448658 GTGGGGGCCCCTGCATTCCTGGG - Intronic
1163477273 19:17533702-17533724 GTAAGGGTCCCGGGGTTCCCAGG + Intronic
1163604494 19:18266569-18266591 TTGGGGGTCTCTGCTTTCACAGG + Exonic
1163765385 19:19160790-19160812 GGAGGGGTCCTGGCTTTCCAAGG - Intronic
1167337523 19:48896088-48896110 GTGGGGGTCCCGGCTTTCCCAGG + Intronic
925832217 2:7907143-7907165 ATGGGGGTCCCAGAGTTCCCTGG + Intergenic
927600226 2:24434488-24434510 GTGGGGTTCCCAGCTGTCCCTGG + Intergenic
927934575 2:27069073-27069095 GGAGGGGTCCCGGATTCCCCAGG + Intronic
933573530 2:84040771-84040793 GTGGGGGTCAGGGCTTCTCCGGG + Intergenic
934696673 2:96405113-96405135 GTGGGGCTCCCGCTTGTCCCTGG + Intergenic
937259638 2:120577172-120577194 CTGGGGGTCCCGGGGGTCCCTGG - Intergenic
947525823 2:230876182-230876204 GCTGGGGTCCAGGCTGTCCCAGG + Intronic
948167375 2:235873581-235873603 TGGGGAGTCCGGGCTTTCCCAGG + Intronic
948719909 2:239893017-239893039 GTGAGGGTCCCGGCTCCCCAAGG - Intronic
948750992 2:240132992-240133014 GTTGGGGTGCAGGCTTTCCCAGG - Intronic
948930685 2:241129872-241129894 GTGGGGGTCTCGGGTCTCCACGG - Intronic
1172834881 20:37866890-37866912 GTGCTGGTCCCTGCTTTTCCTGG - Intronic
1175401255 20:58701213-58701235 GTGCAGGGCCCGGCTCTCCCGGG + Intronic
1177262429 21:18748539-18748561 GTGGGGGTCCTGTCTTCTCCTGG + Intergenic
1180081685 21:45490211-45490233 GTGGGGGTCCCTGCATTCCTGGG + Intronic
1180135602 21:45859979-45860001 GTGGGGGCACCGGCCATCCCTGG - Intronic
1180801444 22:18633932-18633954 CTGGGGCTCCCGGCCATCCCGGG + Intergenic
1180852678 22:19029472-19029494 CTGGGGCTCCCGGCCATCCCGGG + Intergenic
1181175114 22:21030907-21030929 GTCGGGGTCCAGGCTGTGCCAGG + Exonic
1181220277 22:21361329-21361351 CTGGGGCTCCCGGCCATCCCGGG - Intergenic
1182692981 22:32176450-32176472 GTTGGGGCCCCAGCTTTGCCTGG - Intergenic
1183282123 22:36937623-36937645 GTGGGGGCTCCGGCTGGCCCAGG - Exonic
1183450994 22:37895017-37895039 GTGGGCACCACGGCTTTCCCTGG - Intergenic
1184669980 22:46007356-46007378 GTGGGGGTGCCGCCTTTTCATGG + Intergenic
953871158 3:46628781-46628803 GAGGGGGTCCCGGGTCTTCCTGG - Intergenic
954133414 3:48571126-48571148 GTCGGGGTCCCGGGCTCCCCTGG - Exonic
954142914 3:48619599-48619621 GTGAGGGTCCCTTCTTTTCCAGG + Intergenic
955951612 3:64248421-64248443 GTGGGTGTCCCGGCATCCACAGG - Intronic
965615338 3:170586349-170586371 CTGCTGGTCCCTGCTTTCCCAGG - Intronic
967968851 3:194984797-194984819 GCGTGGTTCCAGGCTTTCCCTGG - Intergenic
968879281 4:3290946-3290968 CTGGGGGCCCTGGCTTTCACGGG + Intergenic
969581373 4:8067507-8067529 GTGAGGGTGCCGGCTGCCCCTGG - Intronic
969588062 4:8106079-8106101 GTGGGGGTCCCCGCGTGCCTGGG + Intronic
969701471 4:8770125-8770147 GTGGGGGCCCCCGCTGGCCCAGG + Intergenic
969719484 4:8885388-8885410 GAGGGGGTCCCGGCTTGACTGGG - Intergenic
970290223 4:14563734-14563756 GTGGGGGTCCCAGCTAACCTGGG - Intergenic
974958937 4:68675209-68675231 GTGGGTGTCGGGGTTTTCCCAGG - Intergenic
979785739 4:124712957-124712979 GTGGGGGCCCCGCCTTTCTCAGG + Intergenic
989120714 5:38002031-38002053 GTAGGATTCCAGGCTTTCCCTGG - Intergenic
991729365 5:69569313-69569335 GTTGGGGTCCTGGCTTTGTCTGG + Intronic
991805800 5:70424451-70424473 GTTGGGGTCCTGGCTTTGTCTGG + Intergenic
991865587 5:71058570-71058592 GTTGGGGTCCTGGCTTTGTCTGG - Intronic
992802746 5:80308670-80308692 GTGGGGCGACCAGCTTTCCCCGG - Intergenic
992939597 5:81750314-81750336 TTGGGCGTCCGGGCTTTCCTGGG - Intronic
998957510 5:147453241-147453263 GCGGGGCTCGCGGCTCTCCCAGG - Intronic
1000210750 5:159104481-159104503 GCGCAGGTCCCGGCTTTCCCAGG - Intergenic
1005499413 6:26417087-26417109 GTCTGGGTCCTGGTTTTCCCAGG + Intergenic
1006071059 6:31498268-31498290 GTGGGGTTCCTGGCGGTCCCCGG + Intronic
1017005760 6:150027241-150027263 GTGGGGGGCCCAGCGATCCCTGG + Intergenic
1019278605 7:188787-188809 CTGGGGGGCCCGTCTGTCCCAGG + Intergenic
1019471484 7:1223819-1223841 GAAGGGGTCGAGGCTTTCCCTGG - Intergenic
1020568131 7:9822842-9822864 GTGGGGCTCCCGCTTGTCCCCGG + Intergenic
1026370301 7:69691746-69691768 GTGGGGCTCCTGTCTTTTCCTGG + Intronic
1026874484 7:73871530-73871552 TTGGGGGTCCTGCCTGTCCCTGG + Intergenic
1026899464 7:74028741-74028763 GGGGGGATCCCGGCTTCCCAGGG - Intronic
1029730077 7:102433352-102433374 GTGGGGGTCCCCGCCTCACCTGG - Intronic
1030151485 7:106410408-106410430 ATGGCTGTCCCAGCTTTCCCTGG - Intergenic
1034309227 7:150072161-150072183 CTGTGGGTCCCTGCTTTCCTGGG - Intergenic
1034797630 7:154028475-154028497 CTGTGGGTCCCTGCTTTCCTGGG + Intronic
1034988911 7:155535172-155535194 GTGGGGCTCCTGCCTTTGCCTGG + Intergenic
1035251993 7:157603786-157603808 GTGTGGGTCCCGGCTCACGCTGG - Intronic
1035444596 7:158931868-158931890 GGGGCGCTCCCTGCTTTCCCAGG + Intronic
1035452350 7:158985631-158985653 GTGAGGAGCCCAGCTTTCCCTGG - Intergenic
1035549959 8:514698-514720 GTGGGGATGCAGCCTTTCCCTGG + Intronic
1035677796 8:1467423-1467445 GTGGGGGTCCTGGGTCTCTCTGG - Intergenic
1038583712 8:28771386-28771408 GTGGGAGCCACGGCTTTACCTGG + Intronic
1040316179 8:46262075-46262097 GGGAGGCTCCCAGCTTTCCCTGG - Intergenic
1040468885 8:47719728-47719750 GTGGGGGCCCTGGCTTCCCTGGG - Intronic
1040592197 8:48803827-48803849 GCGGGGGACCAGGCTTTTCCAGG + Intergenic
1041830207 8:62144719-62144741 CCGGGGACCCCGGCTTTCCCAGG + Intergenic
1046770019 8:118109621-118109643 GCGGGGGTACCTACTTTCCCAGG - Intronic
1048861036 8:138724623-138724645 CAGGAGGTCCAGGCTTTCCCGGG + Exonic
1049332715 8:142063710-142063732 GTGTGGCTCCTGGCCTTCCCGGG + Intergenic
1049363837 8:142226935-142226957 GTGGTGGTCCTGGCTGTCACTGG - Intronic
1049363886 8:142227145-142227167 GTGGAGGTCCTGGCTGTCACTGG - Intronic
1049363924 8:142227323-142227345 ATGGGGGTCCTGGCTATCACTGG - Intronic
1049363936 8:142227359-142227381 ATGGGGGTCCTGGCTGTCACTGG - Intronic
1049532559 8:143161805-143161827 GTGGGGGTCCAGGTCTGCCCAGG - Intergenic
1049706370 8:144045012-144045034 GTGGGGGCCCCTGCGTGCCCTGG + Intronic
1055301447 9:74887337-74887359 CCGGGGGTCGCGGCTTTCCGAGG - Intronic
1056752421 9:89362308-89362330 GTGGGGGACCAGGCCTTCTCCGG + Intronic
1057346887 9:94259382-94259404 GAGGTGGTCCCCGCTTTCGCGGG + Intronic
1059417077 9:114168842-114168864 GTGGGGGCCTGGGCATTCCCGGG - Exonic
1062004412 9:134232041-134232063 CTGGGGGTTCCGGCTTCCCCGGG + Intergenic
1062015248 9:134287987-134288009 ATGGGGGTCCCTGCCTGCCCGGG - Intergenic
1062108173 9:134767005-134767027 CTGGGGGGCCAGGCTCTCCCTGG - Exonic
1062357167 9:136170481-136170503 ATGGGGGACCCGGCTGTGCCCGG + Intergenic
1185656054 X:1686628-1686650 CTGGTGGTCCCTGCTGTCCCAGG - Intergenic
1187460847 X:19485575-19485597 TTGGGGGCCCAGGCTTCCCCAGG - Intronic
1189107812 X:38255686-38255708 ATCGGGGTCCAGGCATTCCCAGG - Intronic
1189365825 X:40387719-40387741 ATCGGGGTCCAGGCATTCCCAGG - Intergenic
1191861122 X:65667487-65667509 GTGGGGGGCCCGGCTGGGCCCGG - Intronic
1192559893 X:72120975-72120997 GTGGGGGTCCTGGCTGGCCAGGG - Intergenic
1192941744 X:75920180-75920202 GTGGCAGTTCCAGCTTTCCCTGG + Intergenic