ID: 1167338025

View in Genome Browser
Species Human (GRCh38)
Location 19:48898483-48898505
Sequence TCTCCCGGATCCCAGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167338025_1167338035 28 Left 1167338025 19:48898483-48898505 CCACCTGCCTGGGATCCGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1167338035 19:48898534-48898556 GGCTGCTCACATTGATGCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 109
1167338025_1167338029 -5 Left 1167338025 19:48898483-48898505 CCACCTGCCTGGGATCCGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1167338029 19:48898501-48898523 GGAGACTTGTTCTCCTCACCAGG 0: 1
1: 0
2: 3
3: 17
4: 183
1167338025_1167338031 7 Left 1167338025 19:48898483-48898505 CCACCTGCCTGGGATCCGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1167338031 19:48898513-48898535 TCCTCACCAGGTGCCTGGAGAGG 0: 1
1: 0
2: 1
3: 42
4: 258
1167338025_1167338030 2 Left 1167338025 19:48898483-48898505 CCACCTGCCTGGGATCCGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1167338030 19:48898508-48898530 TGTTCTCCTCACCAGGTGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167338025 Original CRISPR TCTCCCGGATCCCAGGCAGG TGG (reversed) Intronic