ID: 1167338025

View in Genome Browser
Species Human (GRCh38)
Location 19:48898483-48898505
Sequence TCTCCCGGATCCCAGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167338025_1167338031 7 Left 1167338025 19:48898483-48898505 CCACCTGCCTGGGATCCGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1167338031 19:48898513-48898535 TCCTCACCAGGTGCCTGGAGAGG 0: 1
1: 0
2: 1
3: 42
4: 258
1167338025_1167338030 2 Left 1167338025 19:48898483-48898505 CCACCTGCCTGGGATCCGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1167338030 19:48898508-48898530 TGTTCTCCTCACCAGGTGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 221
1167338025_1167338029 -5 Left 1167338025 19:48898483-48898505 CCACCTGCCTGGGATCCGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1167338029 19:48898501-48898523 GGAGACTTGTTCTCCTCACCAGG 0: 1
1: 0
2: 3
3: 17
4: 183
1167338025_1167338035 28 Left 1167338025 19:48898483-48898505 CCACCTGCCTGGGATCCGGGAGA 0: 1
1: 0
2: 2
3: 27
4: 216
Right 1167338035 19:48898534-48898556 GGCTGCTCACATTGATGCCTCGG 0: 1
1: 0
2: 0
3: 12
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167338025 Original CRISPR TCTCCCGGATCCCAGGCAGG TGG (reversed) Intronic
900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG + Intergenic
900737439 1:4308044-4308066 TCTCCTGGTCCCCAGGCTGGCGG + Intergenic
901065100 1:6490657-6490679 TCTCCCCGGTCCCAGCCGGGCGG - Intronic
901642726 1:10701227-10701249 TCTCCAGGGACCCGGGCAGGAGG - Intronic
901740254 1:11337646-11337668 GCCCCTGGAACCCAGGCAGGAGG - Intergenic
902212487 1:14913863-14913885 CCTCCTGGAGCCCAGGCAGGTGG + Intronic
902381613 1:16055497-16055519 TGTCCAGGAGCCCAGGAAGGAGG - Exonic
902536540 1:17122125-17122147 TCTTCCGGATCCCAGGGGAGAGG - Intergenic
904680705 1:32227081-32227103 TCACCAGGACCCGAGGCAGGTGG - Intronic
905329781 1:37186400-37186422 TCTCCCTGGTATCAGGCAGGAGG - Intergenic
905390953 1:37634956-37634978 TCTTGCGGATCCCTGGAAGGGGG - Intergenic
906282759 1:44565563-44565585 TCTCCCTCAGCCCAGGCAAGGGG + Intronic
908050789 1:60227759-60227781 TCTCCCTCATTCCAGGCAGATGG - Intergenic
908816644 1:68042241-68042263 TCTCCCGAATCCCAGATGGGAGG - Intergenic
909698294 1:78491559-78491581 TCTCCCTCATCCCGGGCACGGGG - Intronic
910320215 1:85935649-85935671 TCTTCTGTATCCCAGGCAGTAGG + Intronic
912305193 1:108560087-108560109 TCTCCCGACTCCCAGACGGGCGG + Exonic
916886416 1:169072949-169072971 TCTCCCAGATTCCAGACAGCTGG + Intergenic
919983976 1:202659934-202659956 CCCCCTGGGTCCCAGGCAGGAGG + Intronic
920091347 1:203455311-203455333 TCTACAGGATCCTGGGCAGGCGG - Intergenic
920687146 1:208117982-208118004 TTGCCTGGATCTCAGGCAGGTGG - Intronic
922280098 1:224114765-224114787 TCTCCCCAAACCCAGGCCGGGGG - Intronic
923040948 1:230319398-230319420 TCGCCCCAATCCCAGGCAAGTGG + Intergenic
1066474415 10:35731193-35731215 TCAGCAGGAACCCAGGCAGGAGG - Intergenic
1070853486 10:79586152-79586174 CCTCCCGGTTCCCATTCAGGGGG + Intergenic
1072537046 10:96371710-96371732 TCTCACGGGGCCCAGGCAGGTGG - Intronic
1072549085 10:96463605-96463627 TTGCCAGGCTCCCAGGCAGGGGG + Intronic
1075248169 10:120843219-120843241 TCTCACGCTTCCCAGGCAGCTGG + Intergenic
1075407014 10:122201696-122201718 TCTCACAGACCCCAGGCTGGTGG + Intronic
1076378960 10:130012041-130012063 GCTCCAGGAGCCCAGGCTGGCGG - Intergenic
1076726088 10:132413960-132413982 TCTGAGGGCTCCCAGGCAGGTGG + Intronic
1078646105 11:13142525-13142547 TCCCTCGGATCCCAGGGCGGTGG - Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081966601 11:47173818-47173840 GCTGGCGCATCCCAGGCAGGGGG + Exonic
1083430166 11:62610187-62610209 CCTCCCGGATCCCTGAGAGGCGG - Intronic
1083809742 11:65096849-65096871 TGTCAGGAATCCCAGGCAGGGGG - Intronic
1083843114 11:65315653-65315675 TCCCCCGGGCTCCAGGCAGGCGG - Intronic
1084052085 11:66606512-66606534 TCTCTTCAATCCCAGGCAGGAGG - Intergenic
1084475059 11:69384237-69384259 TCTGCGGGCTCCCAGGCTGGTGG - Intergenic
1084532768 11:69738558-69738580 GCTCCCAGCTCCCAGGCAGCTGG + Intergenic
1085047811 11:73363525-73363547 TCCCCTGGAGCCAAGGCAGGAGG + Intronic
1086322387 11:85664527-85664549 TCTCCTGGACCCCAGGCAACCGG - Exonic
1087349415 11:97012469-97012491 TCTCCAGGATCCCAGAGAGAAGG - Intergenic
1087914627 11:103795765-103795787 TCTCCGGGAGCCCAGGAAGGAGG - Intergenic
1089567835 11:119381443-119381465 CCTCCCGGATCCCCGACAGGTGG + Intronic
1091300807 11:134506529-134506551 TCCCCCCGATTCCAGGAAGGAGG - Intergenic
1093134687 12:15436854-15436876 TCTCTCCCATCACAGGCAGGAGG + Intronic
1094493699 12:30976701-30976723 TCTCCTGGGTCCCTGGGAGGAGG - Intronic
1095416930 12:41987475-41987497 TCTCCTCCATCCCAAGCAGGGGG + Intergenic
1097690306 12:62728691-62728713 TCTCCCTGAGCCCAGGAAGGTGG - Intronic
1099501123 12:83415362-83415384 TCTCCCTGATCTCTGGGAGGCGG + Intergenic
1100456482 12:94756521-94756543 TCTCCAGGAACCCAGGCCTGTGG + Intergenic
1102239305 12:111314031-111314053 CCTCCCGGGGACCAGGCAGGAGG - Intronic
1102519114 12:113468072-113468094 GCTCCCGGCTCCCAGGCCAGCGG + Intronic
1103091963 12:118103973-118103995 CCTCCCGCCTCCCAGCCAGGCGG + Intronic
1103990413 12:124795334-124795356 TCTCCCTGGTCCCAGTCAAGAGG + Intronic
1105255709 13:18743022-18743044 GCTGGAGGATCCCAGGCAGGTGG - Intergenic
1105447794 13:20472782-20472804 TCTCCCAGGTCCCAGACAGCTGG + Intronic
1112324728 13:98436247-98436269 TCACCTGCATCTCAGGCAGGGGG - Intronic
1113100673 13:106714223-106714245 TCTCTCTGATCTCAGGAAGGAGG - Intergenic
1113486188 13:110654011-110654033 TCTCCCAGAGCCCAGGCCGGAGG + Intronic
1113718514 13:112533270-112533292 TCCACCGACTCCCAGGCAGGAGG + Intronic
1114005523 14:18309089-18309111 TCTTCAGCCTCCCAGGCAGGTGG + Intergenic
1114959962 14:27873736-27873758 TCTCTCAGCTCCCAGGCTGGAGG + Intergenic
1118318686 14:64740976-64740998 TTCCCCGGATCCCATGAAGGAGG + Intronic
1118470164 14:66067854-66067876 TCTCCCAGGTCACAGGCTGGGGG + Intergenic
1118905604 14:70021112-70021134 TCTCATGGCTCCCTGGCAGGAGG + Intronic
1119140700 14:72264962-72264984 TCTCCCTGATGCCTGCCAGGAGG + Intronic
1119485069 14:74981614-74981636 TCTCCCGGACCACAGCCTGGAGG - Intergenic
1121199578 14:92106309-92106331 CCTCCCGGCTCCCAGGGCGGGGG + Intronic
1121259546 14:92556113-92556135 TCTCCCAGAACACAGGCATGGGG + Intronic
1122245047 14:100396531-100396553 TCTCGCAGACCCAAGGCAGGTGG + Intronic
1124249221 15:28096453-28096475 GTTCCCGGATCCCAGGGAGGGGG + Intronic
1125893270 15:43281694-43281716 CTTCCTGGATCCCAGGCATGTGG - Intronic
1126100025 15:45113287-45113309 TCCCCAGGATCCCTGGGAGGTGG - Intronic
1126940345 15:53759579-53759601 GCTGCCGGGTCCCAGGCTGGTGG - Intronic
1127555505 15:60083404-60083426 TCTCCCTGCTCCCAGGAAGGGGG - Intergenic
1128251239 15:66165682-66165704 TCTCCTGTCTCCCAGGCAGGTGG + Intronic
1128549202 15:68586865-68586887 CCTCCTGGCTCTCAGGCAGGAGG + Intronic
1131269665 15:90939349-90939371 TCTGCCAGCTCCCTGGCAGGAGG + Intronic
1131513701 15:93063917-93063939 ACTCACGGAGCTCAGGCAGGAGG + Intronic
1131552223 15:93366874-93366896 TCTCTGGCCTCCCAGGCAGGTGG + Intergenic
1131689424 15:94810472-94810494 TCTCCAGGATCCAAGACAGCAGG + Intergenic
1132481013 16:166106-166128 TCTCCGGGAGCTCAGGGAGGTGG + Intronic
1132853043 16:2033376-2033398 GCTCCCGGAGCCCGGGCAGGTGG - Intronic
1132925050 16:2424874-2424896 TCTCCCTGATCCCTGGGATGAGG + Intergenic
1134588793 16:15435070-15435092 TCTCCCACAGCCCAGGGAGGAGG + Intronic
1135868903 16:26130791-26130813 TCTCCCTACTCCCTGGCAGGTGG + Intronic
1138439553 16:57025948-57025970 TCACCCGGCAGCCAGGCAGGAGG - Exonic
1139968924 16:70761701-70761723 TGACCCAGATCCCAGGCAGCAGG - Intronic
1140735499 16:77894473-77894495 ACGCCCGGAACCCAGCCAGGAGG + Intronic
1141518803 16:84563942-84563964 TGGCCCTGATCCCGGGCAGGAGG - Intergenic
1141689718 16:85589211-85589233 TCTCCCATGCCCCAGGCAGGAGG - Intergenic
1141797786 16:86286609-86286631 TCTCCGGGATCCCAGGCCAGCGG + Intergenic
1142496555 17:309422-309444 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496575 17:309477-309499 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496600 17:309537-309559 TATCCCGGACCCCCAGCAGGGGG - Intronic
1142496683 17:309769-309791 CATCCCGGACCCCTGGCAGGGGG - Intronic
1142621065 17:1166027-1166049 TCTCCCAGAGCCCACGCAGATGG + Intronic
1144833759 17:18145895-18145917 TCTCCCGGGCACCATGCAGGTGG - Exonic
1146022313 17:29290409-29290431 ACTTTAGGATCCCAGGCAGGTGG + Intronic
1146183146 17:30709712-30709734 TCTCCCGGAGCCGGGGCTGGGGG - Intergenic
1148286649 17:46399195-46399217 TCTAAGGGATGCCAGGCAGGAGG + Intergenic
1148308815 17:46616785-46616807 TCTAAGGGATGCCAGGCAGGAGG + Intronic
1151305752 17:73261846-73261868 GCTGCTGGAACCCAGGCAGGTGG + Exonic
1151546315 17:74795462-74795484 TCTCCCCCAGCCCAGCCAGGCGG + Intronic
1152159523 17:78658705-78658727 TCTCCACGATCCCCGTCAGGAGG - Intergenic
1152159534 17:78658767-78658789 TCTCCATGATCCCCGTCAGGAGG - Intergenic
1152209699 17:78996508-78996530 TCTCCCTGAACCCCAGCAGGGGG - Intronic
1155049162 18:22131523-22131545 TCTCCTGGATTCCAGGAAGTGGG - Intergenic
1156084293 18:33380225-33380247 TCTCCCTCATCACAGGCCGGGGG - Intronic
1158656501 18:59340101-59340123 TCTCCCTGGTCCCAGGCACAAGG + Intronic
1159723031 18:71917218-71917240 TCTCCCCTATACCAAGCAGGGGG + Intergenic
1160235986 18:77087473-77087495 TAGACCGGATCCCAGGGAGGAGG + Intronic
1161118471 19:2512425-2512447 TCTCCCGGACCCCAGGGAGGTGG - Exonic
1162975648 19:14206062-14206084 TCTCCCGGAGCCGGGGCTGGGGG + Exonic
1163109830 19:15152905-15152927 TCCCACGGAGCTCAGGCAGGTGG + Intergenic
1163675948 19:18655375-18655397 TCTCCCCGGTCCCAGGTGGGTGG - Intronic
1164537461 19:29096790-29096812 ACTCCAGGGACCCAGGCAGGCGG + Intergenic
1165938358 19:39403087-39403109 TCTCCCGGGTCTGAGGGAGGAGG + Intergenic
1166654655 19:44601781-44601803 TCTCCACCATCACAGGCAGGTGG + Intergenic
1167338025 19:48898483-48898505 TCTCCCGGATCCCAGGCAGGTGG - Intronic
1167781604 19:51602038-51602060 ACTCCTGGATCTCAGGGAGGAGG + Intergenic
1168056607 19:53868183-53868205 ACTCCCGGGTCCGAGGCAGGAGG + Intronic
1168107784 19:54174699-54174721 TCTCCTGGATCTGAGGGAGGAGG - Intronic
1168107796 19:54174736-54174758 TCTCCTGGATCTGAGGGAGGAGG - Intronic
1168280371 19:55302414-55302436 ACTCCTGGATCCGAGGGAGGAGG + Intronic
925152060 2:1621676-1621698 GATGCAGGATCCCAGGCAGGCGG + Intergenic
925240714 2:2324443-2324465 TCTACCGGCGCCCAGGCAAGGGG + Intronic
925316960 2:2933918-2933940 TCTGCCGAATCCCACGCAGGAGG - Intergenic
925616567 2:5749295-5749317 TCTCCTGGAGCACAGGAAGGAGG - Intergenic
925634419 2:5928894-5928916 ACTCCCTGATCTCAGACAGGTGG + Intergenic
925751242 2:7091756-7091778 TCTCGGGGAGCCCAGGCTGGAGG - Intergenic
927602529 2:24456747-24456769 TCTGGCCGATCCCAGGCAGCTGG + Intergenic
929794794 2:45050646-45050668 TCTCCCGGCTACAATGCAGGGGG + Intergenic
932434250 2:71693979-71694001 TCTCCCGGATCCTGGACAGCAGG - Intergenic
935637968 2:105264637-105264659 ACTTCCGGAGCACAGGCAGGTGG - Exonic
938447312 2:131389015-131389037 TCCACCGCATCCCGGGCAGGAGG - Intergenic
938599394 2:132821721-132821743 TCACCCAGCTCCCAGGCAGTTGG - Intronic
940776873 2:157893998-157894020 TCTACATGATCCCAGGCAGCAGG + Intronic
941812392 2:169767977-169767999 GCTCCTGGATGCCTGGCAGGTGG - Intronic
945314720 2:208359803-208359825 CCTGCAGGAACCCAGGCAGGGGG - Intronic
946056778 2:216909800-216909822 TCTGCTGGCTCCCAGGGAGGTGG + Intergenic
946908969 2:224442317-224442339 TCGCCCGGACCCCGGGCCGGCGG + Intergenic
947992473 2:234497672-234497694 CCCCCTGGAACCCAGGCAGGAGG - Intergenic
948746627 2:240100270-240100292 TCTCCCTGTTCTCAGGCAGGGGG - Intergenic
948915948 2:241035141-241035163 CCTCCCCCAGCCCAGGCAGGAGG - Intronic
1169357458 20:4919565-4919587 CCTCCCACACCCCAGGCAGGTGG + Intronic
1171337068 20:24394273-24394295 GCTTCCTGATCCCAGGGAGGAGG - Intergenic
1172391294 20:34567169-34567191 CTTCCTGGATCCCAGGCAGGTGG - Intronic
1172701078 20:36854120-36854142 TCTCCAGGATGCCAGGCAGGGGG - Intronic
1173469303 20:43310271-43310293 CATCCTGGATCCCAGGCTGGAGG - Intergenic
1173564137 20:44027360-44027382 GCTCAGGGATCCCAGGCAGGTGG - Intronic
1175442843 20:59003132-59003154 ACTCCAGAAGCCCAGGCAGGAGG - Intronic
1175739213 20:61408867-61408889 TCTCCAGGATCCCAGCCAGATGG + Intronic
1176163674 20:63661780-63661802 TCTCACGTATCAAAGGCAGGTGG - Intronic
1179178909 21:39028829-39028851 TCTCCCTGACCCAGGGCAGGCGG - Intergenic
1179525575 21:41973968-41973990 TCTCCAGGGTCCCCAGCAGGAGG + Intergenic
1180163200 21:46007092-46007114 TCACCAGGATTCCAGGCAGGAGG + Intergenic
1180430032 22:15239875-15239897 TCTTCAGCCTCCCAGGCAGGTGG + Intergenic
1182410895 22:30185132-30185154 TATCCCAGAGCCCAGGCAGAGGG - Intergenic
1183667803 22:39255257-39255279 CCTCCCCCATCCCAGGCTGGTGG - Intergenic
1184606937 22:45579623-45579645 ACTCCAGGAGCCCAGCCAGGTGG - Intronic
1185027908 22:48426037-48426059 TCTCCAGGAACACAGGAAGGGGG + Intergenic
1185400662 22:50613881-50613903 TCGCCTGGCTCCCAGGCAGGAGG + Intronic
949787522 3:7758332-7758354 CCTCCCAGAACCCAGGAAGGGGG + Intergenic
950342237 3:12257737-12257759 TCTCCAGGCTCCCAGGCAGCAGG + Intergenic
950475855 3:13214442-13214464 TGTCCCAGATTCAAGGCAGGGGG - Intergenic
950889670 3:16392404-16392426 TGTGCTGGATCCCAGACAGGAGG + Intronic
953196302 3:40737605-40737627 TCTCCCAGATCCAAGGAATGAGG + Intergenic
953519069 3:43623663-43623685 TCTTCCAGGTTCCAGGCAGGAGG + Intronic
953534611 3:43768104-43768126 TCTGCCGTATGCCAGGCACGAGG - Intergenic
954224124 3:49171804-49171826 ACTCCTGGACCCCTGGCAGGAGG - Intronic
954661433 3:52228945-52228967 TTTCCTGGAGCCCAGGAAGGAGG + Exonic
954697807 3:52436862-52436884 TCCCCCAGTTCCCAGGCTGGAGG + Intronic
954706043 3:52481004-52481026 TCTCCAGGAGCCCGGGCAGGCGG - Intronic
956629908 3:71305990-71306012 TCTCAGGGCTCCCAGGCTGGCGG + Intronic
956750424 3:72340276-72340298 TCCCCCAGAGCCCGGGCAGGTGG + Intergenic
959925202 3:111913300-111913322 TCTCCTGGAACACAGGGAGGAGG - Exonic
964183278 3:153913298-153913320 GCTCCAGGATCCCTGGCAAGGGG + Intergenic
966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG + Exonic
966913427 3:184571680-184571702 TCTCCAGGGACCCAGGGAGGAGG - Intronic
968348193 3:198029540-198029562 TATCTGGGATCACAGGCAGGCGG - Intronic
968704674 4:2072354-2072376 CCTCCCAGACCCCAAGCAGGGGG + Intronic
969588065 4:8106089-8106111 TTTGCTGGATCCCAGGCACGCGG - Intronic
972652066 4:41027827-41027849 TCTCTTGGATTCCTGGCAGGTGG + Intronic
982695338 4:158592539-158592561 GCTCCCGTAGCCCAGGCTGGAGG - Intronic
982784931 4:159525665-159525687 ATTCCAGGATTCCAGGCAGGTGG + Intergenic
986291057 5:6399032-6399054 TCACCCAGAACCCAGGCTGGAGG - Intergenic
987040168 5:14055025-14055047 CCTCCTGGAGCCCAGGCAGAAGG + Intergenic
997299107 5:132789407-132789429 TCCCCTGGATCCCTGGCAGGGGG - Intronic
999430306 5:151520154-151520176 TATCCCGAATGCCAGGCAGCTGG + Intronic
1001419175 5:171573897-171573919 TCTCCCTGCTCCCTGGCAGGGGG - Intergenic
1001568776 5:172716954-172716976 TTTCCCGGATGCCCGGAAGGTGG + Intergenic
1002071206 5:176679851-176679873 TCTGCCAGCTACCAGGCAGGAGG + Intergenic
1003117986 6:3295911-3295933 TTTCCAGAGTCCCAGGCAGGAGG - Intronic
1005724598 6:28636013-28636035 TGTCCCGCAGCCCAGGCCGGGGG - Intergenic
1006517824 6:34554595-34554617 TCTCGGAGCTCCCAGGCAGGTGG - Intronic
1012883134 6:104815474-104815496 TCTCCCGCCTCCCAGGTAGCTGG + Intronic
1015217143 6:130763200-130763222 TCTGCCAGACCCCTGGCAGGTGG - Intergenic
1015567947 6:134593221-134593243 CCTCCCGGGACCCTGGCAGGAGG - Intergenic
1015576311 6:134675282-134675304 TCTGCCTGATGCCTGGCAGGGGG - Intergenic
1016306180 6:142686126-142686148 TCTCCCTGATACCAGCCATGAGG - Intergenic
1019292546 7:257736-257758 TCTCCAGCACCCCAGGCAGTGGG - Intronic
1019292584 7:257844-257866 TCTCCAGCACCCCAGGCAGTGGG - Intronic
1019292626 7:257989-258011 TCTCCAGCACCCCAGGCAGTGGG - Intronic
1019292648 7:258061-258083 TCTCCAGCACCCCAGGCAGTGGG - Intronic
1019292714 7:258278-258300 TCTCCAGCACCCCAGGCAGTGGG - Intronic
1019292748 7:258386-258408 TCTCCAGCATCCCGGGCAGTGGG - Intronic
1019292762 7:258422-258444 TCTCCAGCACCCCAGGCAGTGGG - Intronic
1019292774 7:258458-258480 TCTCCAGCACCCCAGGCAGTGGG - Intronic
1019775601 7:2910284-2910306 TCTCCTGGATCAGCGGCAGGTGG - Intronic
1019989848 7:4683216-4683238 GCTCCAGGAGCCCAGGCCGGTGG - Intronic
1022741811 7:33129300-33129322 GCCCCCGGAGCCCAGGCAGGAGG + Intronic
1026009789 7:66628229-66628251 GCTCCCGGCTCCCTGGGAGGCGG - Intergenic
1026947628 7:74326486-74326508 TCTCCTGGATCCCCAGCATGAGG - Intronic
1033534445 7:142298981-142299003 TCACCCGGGGCACAGGCAGGGGG - Intergenic
1033649196 7:143327940-143327962 TCACCGGGATGCTAGGCAGGTGG - Intronic
1035850960 8:2919009-2919031 TCTCCAGGGGCCCAGGGAGGGGG + Intergenic
1036497503 8:9282847-9282869 TCTCAGTGAGCCCAGGCAGGAGG - Intergenic
1037542202 8:19883040-19883062 TCTCCTGGTTCCCAGGCCTGTGG - Intergenic
1038354378 8:26813568-26813590 TGGCCTGGATCCCAGGCTGGTGG + Intronic
1038414113 8:27380738-27380760 TCTCCCAGTTCCCAGGCTGCAGG - Intronic
1038426981 8:27469939-27469961 TCTCCAGGAGCCCTGGGAGGTGG + Exonic
1038467225 8:27775021-27775043 TTTCCCTGATCCCAGGGAAGGGG + Intronic
1038687561 8:29732394-29732416 TCTCCAAGATCATAGGCAGGTGG - Intergenic
1047494045 8:125397054-125397076 TCTCCCTGCTCCCAGGAAGGAGG - Intergenic
1048889358 8:138933968-138933990 TGTCTCAGATTCCAGGCAGGAGG + Intergenic
1049217161 8:141413461-141413483 GCTCCAGGATTCCAGACAGGAGG - Intronic
1049423828 8:142528480-142528502 GCTCTCGGAAACCAGGCAGGAGG - Intronic
1049615201 8:143572887-143572909 CCTCCAGCAGCCCAGGCAGGAGG - Exonic
1050184417 9:2957763-2957785 TCCCCTGAATTCCAGGCAGGAGG - Intergenic
1052984338 9:34475310-34475332 TCTCCTGGGCCCCAGGAAGGAGG + Intronic
1055461800 9:76526774-76526796 ACTCTGGGATCCAAGGCAGGTGG + Intergenic
1060509138 9:124219317-124219339 GCTGCAGGATCCCAGGCAAGTGG + Intergenic
1060790498 9:126482636-126482658 TCTGCTGGGTCGCAGGCAGGCGG + Intronic
1061367187 9:130178219-130178241 TCTTCCGCATCCAGGGCAGGTGG + Intronic
1061586670 9:131573959-131573981 CCTCTCAGATCTCAGGCAGGGGG + Intergenic
1062099735 9:134721818-134721840 TCTGCAGGACCCCAGGCAGATGG - Intronic
1062423822 9:136497021-136497043 TGTCGGGCATCCCAGGCAGGTGG + Exonic
1186475388 X:9853195-9853217 TCTCCCGGAGTCCTGGCAGGTGG - Intronic
1190885816 X:54530199-54530221 ACTTCCGGATCCCAGGCCGGCGG - Exonic
1196882070 X:120207627-120207649 TCACCCCAATCCCAGGCAAGAGG - Intergenic
1200151532 X:153953740-153953762 TCTCCCTGATCGCTGGCAGCAGG + Exonic
1200306076 X:155027110-155027132 CCTTCCGGAGCCCAGGAAGGCGG - Intronic
1200837299 Y:7745169-7745191 TGTGCTGGATCCCAGACAGGAGG + Intergenic