ID: 1167340021

View in Genome Browser
Species Human (GRCh38)
Location 19:48909912-48909934
Sequence AGGTCTTTACAGAGGGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 8, 3: 40, 4: 251}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167340021_1167340031 19 Left 1167340021 19:48909912-48909934 CCTGATTCCCTCTGTAAAGACCT 0: 1
1: 1
2: 8
3: 40
4: 251
Right 1167340031 19:48909954-48909976 ATTCTGAGGTACTGGGGCTTAGG 0: 10
1: 214
2: 776
3: 1451
4: 1971
1167340021_1167340029 12 Left 1167340021 19:48909912-48909934 CCTGATTCCCTCTGTAAAGACCT 0: 1
1: 1
2: 8
3: 40
4: 251
Right 1167340029 19:48909947-48909969 AGGTCACATTCTGAGGTACTGGG 0: 147
1: 445
2: 1199
3: 1944
4: 2522
1167340021_1167340028 11 Left 1167340021 19:48909912-48909934 CCTGATTCCCTCTGTAAAGACCT 0: 1
1: 1
2: 8
3: 40
4: 251
Right 1167340028 19:48909946-48909968 CAGGTCACATTCTGAGGTACTGG 0: 6
1: 162
2: 499
3: 1158
4: 1918
1167340021_1167340030 13 Left 1167340021 19:48909912-48909934 CCTGATTCCCTCTGTAAAGACCT 0: 1
1: 1
2: 8
3: 40
4: 251
Right 1167340030 19:48909948-48909970 GGTCACATTCTGAGGTACTGGGG 0: 117
1: 507
2: 1152
3: 1595
4: 1851
1167340021_1167340027 5 Left 1167340021 19:48909912-48909934 CCTGATTCCCTCTGTAAAGACCT 0: 1
1: 1
2: 8
3: 40
4: 251
Right 1167340027 19:48909940-48909962 CCAAATCAGGTCACATTCTGAGG 0: 15
1: 400
2: 951
3: 1898
4: 2733
1167340021_1167340024 -8 Left 1167340021 19:48909912-48909934 CCTGATTCCCTCTGTAAAGACCT 0: 1
1: 1
2: 8
3: 40
4: 251
Right 1167340024 19:48909927-48909949 AAAGACCTAGTCTCCAAATCAGG 0: 1
1: 0
2: 10
3: 112
4: 623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167340021 Original CRISPR AGGTCTTTACAGAGGGAATC AGG (reversed) Intronic
902086546 1:13867268-13867290 AGGTCTTTGCAGATGTAGTCAGG - Intergenic
904489355 1:30848751-30848773 GGGTCTTTGCAGATGTAATCAGG - Intergenic
904611955 1:31730913-31730935 AGGTCATTCCATAGGGATTCTGG + Exonic
908008619 1:59752685-59752707 AGGTCATTACAGTGAGAATTGGG + Intronic
909076104 1:71052473-71052495 AGGGCTTGACAGAGGGAGTTTGG + Intergenic
909097855 1:71311871-71311893 AGTTCTTTACAGAGTGTTTCTGG + Intergenic
910268796 1:85370101-85370123 GGGTCTTTAGAGAGATAATCAGG + Intronic
910286262 1:85557707-85557729 GGGTCTTTAAAGAGGTAATTAGG + Intronic
911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG + Intronic
911595062 1:99790153-99790175 GGGCCTTTACAGAGCTAATCAGG - Intergenic
911882028 1:103251934-103251956 AGGTTTTTGCAGAGGTAATCAGG - Intergenic
912540905 1:110414592-110414614 GGACCTTTACAGAGGTAATCAGG + Intergenic
913370604 1:118094946-118094968 AGGTCTCTACAGAGCCAATTAGG - Intronic
915933553 1:160076297-160076319 AGATGTGGACAGAGGGAATCAGG + Intergenic
916053761 1:161053437-161053459 AGGTATTTTCAGGGAGAATCTGG - Intronic
916477051 1:165179745-165179767 TGGTTTTTACAGAGAGAATGTGG + Intergenic
916505529 1:165425097-165425119 ATGTCTGTACAGAGGGATTGGGG - Intronic
917520859 1:175747519-175747541 AGGTCTGGACATAGGGACTCAGG + Intergenic
919516727 1:198534176-198534198 GGGTCTTTGCAGATGTAATCAGG + Intronic
920702102 1:208225621-208225643 GGGTCTCTACAGAGGTAATCAGG + Intronic
920896621 1:210057265-210057287 AGTTCTTTGCAGAGGTAATTTGG + Intronic
921033388 1:211353594-211353616 AGGCCCTCACAGAGGGGATCTGG - Intronic
921837351 1:219791952-219791974 AAGGCTTCACAGAGGGAATGTGG + Intronic
922094885 1:222434867-222434889 AGGAGTTTACAGAGGGTATGGGG + Intergenic
923469901 1:234281156-234281178 AGGTCTTTACAGAAGTAATTAGG + Intronic
923758224 1:236813730-236813752 AGTCCTTTACTGAGGAAATCAGG + Intronic
924464806 1:244290381-244290403 ATGGATTTACAGAGGGATTCTGG - Intergenic
1062911580 10:1215546-1215568 ACGTCCTTACAGAGGGTCTCAGG + Intronic
1063085910 10:2817631-2817653 AGGTCTTTACAGAGAAAATAAGG - Intergenic
1063176669 10:3556900-3556922 TGGTCTTTATAGATGAAATCTGG - Intergenic
1063559503 10:7113212-7113234 GAGTCTTTACAGAGGAAATCAGG + Intergenic
1064361622 10:14671048-14671070 ATGGCTTTAAAGAGGAAATCAGG - Intronic
1064726783 10:18288131-18288153 AGGTCTTTACAGAGGTAATCAGG - Intronic
1064758622 10:18595309-18595331 ATGTCTTTCCAAAGGGAGTCTGG - Intronic
1065015280 10:21457120-21457142 AGGCCTTTACAGAGGTAATGAGG - Intergenic
1066668027 10:37805539-37805561 AGGTTTTTACAGAGTGAATGTGG - Intronic
1071465748 10:85938144-85938166 AGATCTTGCCAGGGGGAATCTGG + Intronic
1071553669 10:86586149-86586171 GGGTCTTAGCAGAGGGAGTCAGG + Intergenic
1071555692 10:86599801-86599823 AGGCCTTCACAGAGGGAAGTGGG - Intergenic
1071766610 10:88673151-88673173 AAGCCTTTACAGAGGCAATGAGG - Intronic
1075344836 10:121674350-121674372 AGGTCCTTACTAAGGTAATCAGG - Intergenic
1075545271 10:123350491-123350513 AAGCCTTTCCAGAGGGCATCGGG + Intergenic
1076926245 10:133489481-133489503 AGGTGTTTGCAGTGGCAATCAGG + Intergenic
1080826703 11:35854695-35854717 AGGTCTTTACATCTGGGATCAGG - Intergenic
1081501350 11:43669807-43669829 AGGTCTTTGCAGATGTAATCAGG - Intronic
1082231162 11:49768290-49768312 AAGTCCTTCCAAAGGGAATCTGG + Intergenic
1084652496 11:70497349-70497371 AGGTCTTTATTCAGGGACTCTGG + Intronic
1084706963 11:70821176-70821198 AGGTCTTTACAGAGATCATCTGG + Intronic
1085262901 11:75218477-75218499 AGGCCTTTAGAGAGGGACTCTGG + Intergenic
1086197646 11:84160212-84160234 AGGTCTGTACACTGGGTATCTGG + Intronic
1086618882 11:88860685-88860707 AAGTCCTTCCAAAGGGAATCTGG - Intronic
1091689516 12:2586003-2586025 AGGTACTTACAGAGGGACACTGG - Intronic
1092566561 12:9672266-9672288 AGGTCCTTTAAGAGGTAATCAGG - Intronic
1092745984 12:11673008-11673030 AGGACTTTCCAGACGAAATCTGG + Intronic
1095906430 12:47382867-47382889 AGGTCTTTACAGAGGTAATTGGG - Intergenic
1097141027 12:56902674-56902696 TGGTCTTTGCAGTGGGAACCAGG + Intergenic
1097249772 12:57626164-57626186 AGGTGTTTGCACAGGGACTCTGG + Exonic
1098179739 12:67833112-67833134 AGGTCTTTAGGGTGGGAGTCAGG + Intergenic
1103144221 12:118580440-118580462 GGGTCTTTAAAGAGGGATTAAGG + Intergenic
1104759411 12:131287965-131287987 AGCTCTTTACAGAGGACATATGG - Intergenic
1108545688 13:51490954-51490976 AGGGCTTGCCAGAGGGAGTCTGG - Intergenic
1109187922 13:59292132-59292154 AGGAATTTACAGAGGCAGTCTGG - Intergenic
1111102178 13:83602601-83602623 ATATCTTTACAGAGGTAATGAGG - Intergenic
1112821767 13:103345988-103346010 AGGAGTTTACAGTGGGAATGTGG + Intergenic
1113054813 13:106256753-106256775 AGGTCTCTACAGGGGGCCTCTGG + Intergenic
1113138296 13:107117882-107117904 AGCTCTTTAGAGAGGGAAATGGG + Intergenic
1113942590 13:114026113-114026135 ACGTCTTTACAGAGTGAAACAGG + Intronic
1114508779 14:23238911-23238933 AGAACTTTACATGGGGAATCAGG + Intronic
1115974383 14:38980898-38980920 AGGACTCTAGAGAGGCAATCTGG + Intergenic
1116402250 14:44522199-44522221 GGGTCTTTACAGATGTAATTAGG + Intergenic
1117003339 14:51393956-51393978 GGGTCTTTATAGAGGTAATTAGG - Intergenic
1118534360 14:66743162-66743184 AACTCTCTACACAGGGAATCAGG - Intronic
1118679660 14:68227085-68227107 ATGTCTTTAAAGATGCAATCAGG + Intronic
1121857792 14:97286171-97286193 GGGTCTTTGCAGAGATAATCAGG + Intergenic
1121925642 14:97924902-97924924 AGGTCATTTCAGAGAGTATCTGG + Intergenic
1121998685 14:98627834-98627856 AGGTCTTTGCAGATGTAATCAGG + Intergenic
1124080885 15:26494802-26494824 ATGTCTGTACACAGTGAATCTGG + Intergenic
1124393317 15:29279066-29279088 AGGCCTTTACAGTGGGGCTCTGG - Intronic
1124636520 15:31368109-31368131 GGGTCTTTGCAGATGTAATCAGG - Intronic
1126100733 15:45116886-45116908 AGATCTGCACAGACGGAATCCGG + Intronic
1128456253 15:67833188-67833210 AGTTCGTTACACAGGGTATCTGG - Exonic
1129544068 15:76376047-76376069 AGGGCTTTACAGAGGACATTTGG + Intronic
1131593922 15:93777521-93777543 AGGTCTTTAAATAGGAAACCAGG - Intergenic
1135060924 16:19270745-19270767 GGGTCTTTACAAAGGTGATCAGG + Intergenic
1137633641 16:49966616-49966638 AAGTCTTGAGAAAGGGAATCTGG + Intergenic
1137962630 16:52898230-52898252 AGGTCCTGACACAGGGATTCTGG - Intergenic
1138687337 16:58737053-58737075 GGGTCTTTACAGATGTAATCAGG - Intergenic
1140644770 16:77017716-77017738 GGGTCTTTGCAGATGTAATCAGG + Intergenic
1140787241 16:78354381-78354403 ATGACTTTCCAGAGGGACTCAGG + Intronic
1140890037 16:79277233-79277255 CGGTCTTTGCAGATGTAATCAGG - Intergenic
1141731363 16:85825175-85825197 GGGTCTTTGCAGATGTAATCAGG - Intergenic
1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG + Intergenic
1146257779 17:31401518-31401540 AGGTCCTTACAGCTGGAATCTGG - Intronic
1146462605 17:33058064-33058086 ATGGCTATACAGAGGGCATCTGG - Intronic
1146757070 17:35442238-35442260 AGCTCCTTCCAGAGGGACTCTGG + Exonic
1146769235 17:35553396-35553418 AGCTTCTTACAGAGGGATTCTGG + Exonic
1149291294 17:55220094-55220116 AGTTCTTTCCAGGGGAAATCTGG + Intergenic
1149521182 17:57319371-57319393 TGGTGTTTCCAGGGGGAATCTGG - Intronic
1149685541 17:58532459-58532481 AGGTTTTCACAAAGTGAATCCGG + Intronic
1150426376 17:65080508-65080530 AGGTCTTTACAGAAGTAATCAGG - Intergenic
1151871958 17:76842434-76842456 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1152862023 17:82702094-82702116 TGGTCTTTGCAGATGTAATCAGG + Intergenic
1156986797 18:43358919-43358941 AGGTCTTTACTGAGTGATCCTGG + Intergenic
1158185036 18:54761908-54761930 AAGTCTTTACAGATGTAATTAGG + Intronic
1160784852 19:895335-895357 GGGTCTTTGCAGAGGTAATCAGG + Intergenic
1165299416 19:34959254-34959276 AGGTCTTTACAGGGGAAGCCTGG + Exonic
1166002628 19:39886814-39886836 AGTTCTTTGCAGATGTAATCAGG + Intronic
1166005415 19:39903066-39903088 AGTTCTTTGCAGATGTAATCAGG + Intronic
1166238959 19:41476597-41476619 AGGTCTTTTCCAAGGGAAGCTGG + Intergenic
1166241243 19:41495871-41495893 AGGTCTTTTCCAAGGGAAACTGG + Intergenic
1167340021 19:48909912-48909934 AGGTCTTTACAGAGGGAATCAGG - Intronic
1167767389 19:51492547-51492569 GGGGCTTTACAGATGGAATTAGG + Intronic
1168470327 19:56635054-56635076 AGGACTTAACAGGGTGAATCTGG - Intergenic
925867660 2:8243299-8243321 GGGTCTTTGCAGATGTAATCAGG + Intergenic
926540229 2:14167950-14167972 AGGTATTTTCAGCAGGAATCAGG - Intergenic
927189968 2:20510846-20510868 GGGTCTTTGCAGAGGTAATTAGG - Intergenic
927386651 2:22541962-22541984 AGGTCTTTTCTGGGGGAAGCTGG + Intergenic
927691005 2:25208154-25208176 GGGTCTTTGCAGATGTAATCAGG + Intergenic
928730247 2:34223584-34223606 AGGACTTTTGAGAGGTAATCGGG + Intergenic
929241480 2:39658073-39658095 TGGTCTTGACAATGGGAATCTGG + Intergenic
930250236 2:49026865-49026887 AGGTCCTAACTGAGGGAATGAGG - Intronic
931669046 2:64630514-64630536 GGGTCTTTATAGAGGTAATTAGG - Intergenic
932788626 2:74632406-74632428 AGGTCTTGACAGAGGGCCTGAGG - Intronic
932790858 2:74653662-74653684 AGGTTTTGCCAGAGGAAATCAGG - Intergenic
932846371 2:75139588-75139610 AGGTCTCTACATAGAGAATTAGG + Intronic
935468195 2:103424918-103424940 GGGTCTTTACAGAGGAAATCAGG + Intergenic
935890928 2:107677162-107677184 AGATCTTTACATAGGGAAAAGGG + Intergenic
936337706 2:111605274-111605296 GGGTATTTATAGAGGTAATCAGG - Intergenic
936523626 2:113228047-113228069 AGGTCTTTACAGAGCTGATTTGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936881094 2:117251825-117251847 AAGACTTTAGAGAGGGCATCAGG - Intergenic
937418007 2:121732525-121732547 ATGGCTTAACAGTGGGAATCAGG + Intronic
939962624 2:148578849-148578871 GGGTCTTTACAGAGGTAATCAGG + Intergenic
940089405 2:149898950-149898972 AGCTCTTTAGAGAGGAAATCTGG + Intergenic
940165068 2:150761844-150761866 AGTTCTTATCAGAGGGAAGCAGG - Intergenic
941414767 2:165206253-165206275 GGGTATTTACAGAGATAATCAGG - Intergenic
942869509 2:180717889-180717911 AGGTCTGGACACATGGAATCTGG - Intergenic
942995424 2:182254566-182254588 AAGTCTTTACAGGGGGACTTTGG + Intronic
943610384 2:190026309-190026331 AGCTCTTTACAGAGAAAATTTGG + Intronic
944861004 2:203816011-203816033 AGGACTTTTTAGAGGGAATGAGG + Intergenic
945644925 2:212479249-212479271 GGGGCTTTAAAGAGGCAATCAGG - Intronic
945692755 2:213061326-213061348 AGGCCTTTACACAGGTAAACAGG + Intronic
945802181 2:214447781-214447803 AGGTTTAGACGGAGGGAATCTGG - Intronic
946585324 2:221179985-221180007 AGGTCTTTAAAGAGGTAAACAGG + Intergenic
946744611 2:222833024-222833046 CAGTTTTTACAGAGGTAATCAGG + Intergenic
948286491 2:236789929-236789951 GGGTCTTGGCAGAGGTAATCAGG + Intergenic
948756360 2:240161780-240161802 GGGTCTTTACAGAGGTAATGAGG - Intergenic
1168964888 20:1893447-1893469 AGGTCTTTAACCTGGGAATCAGG + Intergenic
1172076551 20:32302709-32302731 AGGTCTTCCCAGAGGATATCAGG + Intronic
1172767119 20:37356748-37356770 GGGTCTTTATGGAGGCAATCAGG - Intronic
1173092277 20:39984640-39984662 TGGTTATTTCAGAGGGAATCTGG - Intergenic
1174334825 20:49852144-49852166 AGCACTTAACAGAGGGAAGCTGG + Intronic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG + Intergenic
1175685485 20:61024993-61025015 AGGTCTTTATAGATGTAATTAGG - Intergenic
1176038968 20:63054521-63054543 AGGTCTTTGCAGATGTAATTAGG - Intergenic
1176180163 20:63746195-63746217 AGGCCCTTGCAGAGGGAACCTGG + Exonic
1178181022 21:30161743-30161765 GGGTCTTTATAGAGGTAATTAGG - Intergenic
1179657948 21:42857106-42857128 ATGTCTTTACAAAGAGAAACGGG + Intronic
1180955428 22:19739219-19739241 AGGTCTCTCCAGAGGGCACCAGG + Intergenic
1181418031 22:22774181-22774203 AGGTCATGACTGAGGGGATCTGG + Intronic
1182534798 22:30992903-30992925 AGGTCATTAAAAATGGAATCTGG - Intergenic
1184120487 22:42446566-42446588 GGGTCTTTTCAGATGTAATCAGG + Intergenic
1184794911 22:46726552-46726574 ATGTCATTGCAGGGGGAATCAGG - Intronic
951979491 3:28549796-28549818 GGGTCTTTAAAGAGGTAATTAGG - Intergenic
953857439 3:46510477-46510499 AGATGTTTACAAAGGGAATGAGG - Intergenic
955044151 3:55344008-55344030 AGTTTTTATCAGAGGGAATCTGG - Intergenic
955118875 3:56035593-56035615 AGGGCTTGACAGAGGGAGTTTGG + Intronic
955520411 3:59770336-59770358 GGGTCTTTGTAGAGGTAATCAGG + Intronic
955547104 3:60042654-60042676 CGGCCTTTACAGAGGTAATCAGG - Intronic
956552302 3:70474909-70474931 GGGTCTTTGCAGATGTAATCTGG - Intergenic
956836742 3:73101951-73101973 AGGTCTTTCCAGAGGAAATCTGG - Intergenic
960699388 3:120425829-120425851 AGATCATGGCAGAGGGAATCAGG + Intronic
961682978 3:128611229-128611251 AGGTCTTGACAGAGCCAGTCTGG - Intergenic
961749216 3:129085761-129085783 AGGTCTTGAGTGAGGGAGTCGGG + Intergenic
962203826 3:133419210-133419232 GGGTCTTTAAAGAGGTAATTCGG - Intronic
962251683 3:133839774-133839796 AGGGCCTTTCAGAGGGAACCGGG + Intronic
962607964 3:137048467-137048489 AGGTCTTTACTGAAGTAATCAGG + Intergenic
962846332 3:139277333-139277355 AGATGTTTATAGAGGGAATGGGG + Intronic
963232986 3:142927584-142927606 GGGCCTTTAAAGAGGTAATCAGG - Intergenic
964459442 3:156907194-156907216 TGATCTCTACAGAGAGAATCAGG - Intronic
964461741 3:156939180-156939202 AGGTTTTTAAAGAGGTCATCAGG + Intronic
964703479 3:159593933-159593955 AGGTGATCACAGAGGCAATCAGG - Intronic
966154420 3:176900459-176900481 GTGTCTTTATAGAGCGAATCAGG - Intergenic
966765691 3:183459983-183460005 AGGTTTGGACAGAGGCAATCTGG + Intergenic
968507338 4:976953-976975 GAGTCTTTACAGAGAAAATCAGG + Intronic
968607947 4:1544436-1544458 GAGTCTTTACAGAGAAAATCAGG + Intergenic
969050423 4:4369093-4369115 AGCCCTTTAAAGAGGGAAACTGG + Intronic
969210662 4:5684767-5684789 GGGTCTTTACAGAGGTAGTAAGG + Intronic
969336733 4:6515035-6515057 GGGTCTTTGCAGATGTAATCAGG - Intronic
969844913 4:9912887-9912909 GGGTCCTTAAAGAGGGAGTCAGG + Intronic
971756198 4:30711567-30711589 AGGTGTCTATAGAGGGAATGTGG + Intergenic
972167689 4:36307483-36307505 AGGACTTTACAGAAGTAATCAGG - Intronic
975412732 4:74073687-74073709 AAGTCTTTACAGAGGTAACCAGG - Intergenic
976967077 4:91056486-91056508 AGGTCTTGCCAGAGGGAATTTGG - Intronic
980784380 4:137533058-137533080 AAGTATTTACAGAGGGAGTGGGG - Intergenic
981769419 4:148290281-148290303 AGCTCTTTAAAGAGGTAATTAGG - Intronic
981772600 4:148327573-148327595 AGGTCATTGCAGAGGGACTTTGG - Intronic
982217231 4:153092900-153092922 AGATCTTTTCAGTGGGAAGCTGG - Intergenic
985931523 5:3061588-3061610 AGGGCTTTACAGAGATTATCTGG + Intergenic
986134373 5:4960434-4960456 AGGTCTTTGCAGATGTAATTAGG - Intergenic
986205107 5:5616664-5616686 AGGTCTTTAAAGACGGAAGACGG + Intergenic
986688177 5:10291940-10291962 AGGAATTTACAGTGGGAATGGGG + Intronic
987603932 5:20108390-20108412 GGGCCTTTAAAGAGGGAATTAGG - Intronic
988411321 5:30889288-30889310 GGGTCTTTAAAGAGGTAATTTGG - Intergenic
989799649 5:45521633-45521655 GGGTCATAACAGAGGTAATCAGG - Intronic
991613233 5:68469597-68469619 GGGTCTTTGCAGAGGTAATCAGG + Intergenic
991648328 5:68824101-68824123 TGGTCATTTCAGAGGGAATATGG - Intergenic
992368182 5:76114608-76114630 CTGTCTTTTCTGAGGGAATCAGG - Intronic
995460648 5:112399612-112399634 AGAGCTTTAGGGAGGGAATCTGG - Intronic
996280709 5:121726416-121726438 AGGAATTTACAGAGGCACTCTGG + Intergenic
996497757 5:124181277-124181299 AGTTCTTTACAGATGAAATGTGG + Intergenic
996929212 5:128866235-128866257 AGGTCTTTATAAGGGGAAGCTGG + Intronic
997853056 5:137349867-137349889 GAGTCTTTAGAGAGGTAATCAGG - Intronic
999502356 5:152160014-152160036 AGGAATCTAGAGAGGGAATCTGG + Intergenic
1000041273 5:157486863-157486885 AGGTCTTTAAAGAGGTGATTAGG + Intronic
1000704159 5:164490171-164490193 AGGGCTTAACAGAGGGAGTTTGG - Intergenic
1001154702 5:169262968-169262990 GGGTCTTTGCAGATGTAATCAGG + Intronic
1001594601 5:172890055-172890077 AGGCCTTTACTGAGGAAATATGG + Intronic
1001832230 5:174798551-174798573 AGATCTTTTCAGAGGAAATTAGG - Intergenic
1002309438 5:178305881-178305903 AGGTGTCTACACAGGGAAGCAGG + Intronic
1002673554 5:180890131-180890153 AGGACTCTAGAGAGGGAGTCGGG - Intergenic
1003143394 6:3490140-3490162 GGGTCTTTACAGAGGTAATCAGG + Intergenic
1003617491 6:7668770-7668792 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1003634734 6:7821858-7821880 AGGTCTATACAGAGGGACTTTGG + Intronic
1004489531 6:16101029-16101051 AAGTCTTTGCAGATGTAATCAGG - Intergenic
1005027133 6:21474008-21474030 GAATCTTTACAGAGGTAATCAGG - Intergenic
1005979931 6:30829033-30829055 AGATTTTTACAGTGGGAATCTGG + Intergenic
1006935476 6:37714495-37714517 AGGAATTTACAAAGGAAATCAGG + Intergenic
1007402755 6:41613396-41613418 AGGCCTATAAAGAGAGAATCAGG + Intergenic
1008071484 6:47103188-47103210 AGGTCTCCACAGAGAGAAGCGGG + Intergenic
1009626362 6:66142598-66142620 TGGTCTTTTCAGAGGGGACCTGG - Intergenic
1010875927 6:81105631-81105653 AAGGCTTTAAAGATGGAATCAGG - Intergenic
1011653113 6:89525323-89525345 AGGTCTTTAGGGAGGGAGCCTGG - Intronic
1011889317 6:92137385-92137407 AGGAGTTTAGTGAGGGAATCAGG + Intergenic
1014409070 6:121091818-121091840 GGGTCTTTACAGACGTAATCAGG + Intronic
1015927540 6:138325285-138325307 AGTTCTTTACATGGGTAATCAGG - Intronic
1016629520 6:146212092-146212114 ATGTATTAACTGAGGGAATCAGG + Intronic
1017630659 6:156393300-156393322 AGTTCTTTACAGAGTGAAGGAGG - Intergenic
1018446397 6:163862864-163862886 GGGCCTTTGCAGAGGGAATCAGG + Intergenic
1018544922 6:164924883-164924905 CGGTGTTTACAGACGGGATCTGG + Intergenic
1023624220 7:42100365-42100387 AGGGCTTTGCAGAAGCAATCAGG + Intronic
1024248472 7:47488598-47488620 AGGTCTTTAAAGAGGTAATTAGG - Intronic
1024762234 7:52612504-52612526 AAGTCTTTACAGAGGTAATTAGG - Intergenic
1026153359 7:67807138-67807160 GGGTCTTTAAAGAGGTAATTAGG + Intergenic
1029929092 7:104351884-104351906 AGGTCTTAACAGAGAAAAACAGG - Intronic
1031236112 7:119179850-119179872 AGGTCTTTCTAGAGGGAATGTGG + Intergenic
1033132062 7:138753146-138753168 GGGTCTTTGCAGATGGAATCAGG + Intronic
1033247317 7:139728596-139728618 GGGACTTTATAGAAGGAATCAGG - Intronic
1034226814 7:149490849-149490871 AGGTCTCTAGAGAGGGATTGAGG + Intronic
1034241958 7:149617606-149617628 GGGTCTCTACAGAGGGAGTGAGG + Intergenic
1034258017 7:149735019-149735041 GGGTGTTTAGAGAGGTAATCAGG - Intergenic
1034272786 7:149811529-149811551 AGGTCTGTACAGAGGTGATCAGG - Intergenic
1034854347 7:154527349-154527371 AGCCATTTACAGAGAGAATCTGG + Intronic
1034897600 7:154887480-154887502 GGGTCTTTACAAGGGGCATCAGG - Intronic
1036044707 8:5126877-5126899 AGTCCTTTACAGATGGAGTCAGG + Intergenic
1036943649 8:13074158-13074180 AAGTCATTATAGAGGGAATACGG - Intergenic
1037443606 8:18942551-18942573 AGGTCTTTAAAGAGATAATTAGG + Intronic
1038120564 8:24609633-24609655 ATGTCTTTACAGAGGCAATCAGG + Intergenic
1039097718 8:33904577-33904599 AGGGCTGTCCAGAGAGAATCTGG - Intergenic
1039647623 8:39304823-39304845 AGGGCTTGACAGAGGGAATGTGG - Intergenic
1039864183 8:41487011-41487033 GGGTCTTTACAGATGTAATCAGG + Intergenic
1040995305 8:53395168-53395190 AGGTTTATGCAGAGGCAATCTGG - Intergenic
1043454209 8:80397742-80397764 ATTTCTTTACAGAGGAAATCAGG - Intergenic
1044704239 8:94993248-94993270 AGGTCTTTGAAGAGGTAATTAGG - Intronic
1045891997 8:107168497-107168519 AGGTCCTAACAGAGGGAAAGGGG - Intergenic
1047060848 8:121223468-121223490 AGGGCTTGACAGAGGGAGTTTGG - Intergenic
1048148075 8:131865012-131865034 GGGACTTTAAAGAGGGAATTAGG + Intergenic
1049221261 8:141429918-141429940 AGGTCCTTACAGCGGGGACCCGG - Intronic
1049352752 8:142172790-142172812 GGGTCTTTACAGAGGTACTTAGG + Intergenic
1053086639 9:35229528-35229550 AAATCTTTTGAGAGGGAATCAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054960340 9:70961112-70961134 AGGTCCTTACAGAGGAAGGCAGG + Intronic
1055022261 9:71682964-71682986 ACTTCTTTACAGCTGGAATCTGG + Intergenic
1055111009 9:72559494-72559516 TGGTCGTTACAGAAGGTATCAGG - Intronic
1059250343 9:112882475-112882497 AGGTCCTTAAAGTGTGAATCAGG - Intronic
1059658191 9:116375682-116375704 AGGCTGTGACAGAGGGAATCAGG - Intronic
1060758856 9:126232124-126232146 AGGTCTTTAAAGAGGTGATAAGG + Intergenic
1061247788 9:129409941-129409963 TGGTCTTTACAGAGGTAACCAGG + Intergenic
1061374287 9:130214900-130214922 AGGTCTTTGCAGAGGGAAACTGG - Intronic
1061551538 9:131337579-131337601 TGGTCTTTACCGAGGTAACCGGG + Intergenic
1186295459 X:8143723-8143745 GGGTCATGACAGAGGCAATCAGG - Intergenic
1187548340 X:20275536-20275558 TGGTCTTTACAGAAGAATTCTGG + Intergenic
1188166019 X:26865357-26865379 AGTTTTTGACAGAGTGAATCTGG + Intergenic
1194128299 X:90047358-90047380 AGGTCTTCAAAGAGGGAACAAGG - Intergenic
1195003340 X:100663540-100663562 AGGTCTTTACAAAGGGACACTGG + Intronic
1197822674 X:130557033-130557055 GGGTCATTACAGAGGTAATCAGG + Intergenic
1198882222 X:141293983-141294005 AGGTCTTTAAAAAGGTACTCGGG - Intergenic
1198882231 X:141294042-141294064 AGGTCTTTAAAAAGGTAATAAGG + Intergenic
1199981286 X:152921907-152921929 GGGTCTTTGCAGATGTAATCAGG - Intronic
1200988722 Y:9328438-9328460 AGGCCACTACACAGGGAATCTGG + Intergenic
1201945335 Y:19504463-19504485 CAGACTTTCCAGAGGGAATCGGG + Intergenic
1201974132 Y:19830081-19830103 AGACCTTTAGAGAGGGAAGCAGG + Intergenic
1202119258 Y:21507750-21507772 AGGCCGCTACACAGGGAATCTGG - Intergenic
1202121710 Y:21531290-21531312 AGGCCGCTACACAGGGAATCTGG - Intronic
1202157295 Y:21898092-21898114 AGGCCGCTACACAGGGAATCTGG + Intronic
1202159742 Y:21921633-21921655 AGGCCGCTACACAGGGAATCTGG + Intergenic