ID: 1167345426

View in Genome Browser
Species Human (GRCh38)
Location 19:48942656-48942678
Sequence CTTTAGCAATGATGTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 253}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167345426_1167345434 14 Left 1167345426 19:48942656-48942678 CCAATTTCACATCATTGCTAAAG 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1167345434 19:48942693-48942715 CAAGCCAAGAGGTGGGTTCTGGG 0: 1
1: 0
2: 1
3: 21
4: 212
1167345426_1167345429 6 Left 1167345426 19:48942656-48942678 CCAATTTCACATCATTGCTAAAG 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1167345429 19:48942685-48942707 TCCTTAACCAAGCCAAGAGGTGG 0: 1
1: 0
2: 2
3: 5
4: 117
1167345426_1167345427 3 Left 1167345426 19:48942656-48942678 CCAATTTCACATCATTGCTAAAG 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1167345427 19:48942682-48942704 TCCTCCTTAACCAAGCCAAGAGG 0: 1
1: 0
2: 1
3: 8
4: 119
1167345426_1167345431 7 Left 1167345426 19:48942656-48942678 CCAATTTCACATCATTGCTAAAG 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1167345431 19:48942686-48942708 CCTTAACCAAGCCAAGAGGTGGG 0: 1
1: 0
2: 0
3: 12
4: 118
1167345426_1167345433 13 Left 1167345426 19:48942656-48942678 CCAATTTCACATCATTGCTAAAG 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1167345433 19:48942692-48942714 CCAAGCCAAGAGGTGGGTTCTGG 0: 1
1: 0
2: 2
3: 17
4: 165
1167345426_1167345436 22 Left 1167345426 19:48942656-48942678 CCAATTTCACATCATTGCTAAAG 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1167345436 19:48942701-48942723 GAGGTGGGTTCTGGGCCTCTAGG 0: 1
1: 0
2: 6
3: 30
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167345426 Original CRISPR CTTTAGCAATGATGTGAAAT TGG (reversed) Intronic
907685038 1:56602084-56602106 CTTTATCAGTGGTGTGAAAATGG + Intronic
909605860 1:77507530-77507552 CTATACCACTGGTGTGAAATAGG + Intronic
910051719 1:82982085-82982107 CTGTAGCACTGCTGGGAAATAGG + Intergenic
911228871 1:95338287-95338309 CTTTATCAACAATGTGAAAATGG + Intergenic
915652785 1:157330937-157330959 CTTTAGCAAAAATGTGAAACTGG + Intergenic
916447987 1:164891424-164891446 CTTTATTAATTATGAGAAATTGG - Intronic
916485325 1:165253729-165253751 CTTCAGAAAGGAAGTGAAATTGG + Intronic
917870222 1:179234959-179234981 GTTTATTACTGATGTGAAATGGG + Intergenic
919557781 1:199082124-199082146 ATATAGCAATGTTGTTAAATGGG + Intergenic
920597694 1:207289520-207289542 GTTTAGCCATCATGTGAACTTGG - Intergenic
920719277 1:208371905-208371927 CTTTATCAACAATGTGAAAATGG - Intergenic
920895765 1:210048306-210048328 CTTTATCAGTGGTGTGAAAATGG - Intronic
922003971 1:221510067-221510089 CTTAAGCAAAATTGTGAAATAGG - Intergenic
1062762098 10:31234-31256 CTTTATCATTGATGGGAATTTGG - Intergenic
1062891053 10:1060138-1060160 CTTTAGAAATGCTGTAATATTGG - Intronic
1063341102 10:5263711-5263733 CTTTAGTAAAAATGGGAAATTGG - Intergenic
1064773955 10:18754889-18754911 ATTTAGCAGTAATGTGATATTGG + Intergenic
1066458083 10:35588826-35588848 CCTTAGCAATGAACTGAAACAGG - Intergenic
1067664949 10:48269808-48269830 CTGTAGCACAGATGGGAAATGGG + Intronic
1067671522 10:48327093-48327115 CTTTAGGTATGATGTTGAATAGG + Intronic
1068761683 10:60718418-60718440 CCTGAGCAATAATTTGAAATGGG + Intronic
1070534436 10:77364817-77364839 CTTAGGCAATGAGATGAAATTGG + Intronic
1071149975 10:82622453-82622475 TTTAAGAAATGATTTGAAATGGG - Intronic
1073440705 10:103551000-103551022 CTTTGGAAACGATGTGAAAGGGG - Intronic
1074256715 10:111810335-111810357 CTTTAGCAGTTATGTGTAAAAGG - Intergenic
1075249705 10:120855657-120855679 TTTTATATATGATGTGAAATAGG + Intronic
1076648687 10:131972201-131972223 CTTCAGCATTGTTGTGAAAGCGG - Intronic
1077937308 11:6801472-6801494 GTAAAGAAATGATGTGAAATTGG - Intergenic
1080288532 11:30644175-30644197 CTTTAGCAAAAATGGGAAACTGG + Intergenic
1082759522 11:57113772-57113794 CTTGAGCAATGAGGAGTAATGGG - Intergenic
1082883527 11:58060950-58060972 GTTCAGCAATGATGTGACAAAGG - Intronic
1082952005 11:58827369-58827391 CTTTAGCAAATATGAGAAAGTGG + Intergenic
1086416766 11:86596674-86596696 CTTTATCTATAATGTGAAAGAGG - Intronic
1087358014 11:97119988-97120010 CCTTAGCAAAGATTTGAACTTGG - Intergenic
1089767035 11:120775419-120775441 CTTTATCACTGATGTGACTTGGG + Intronic
1090203480 11:124872240-124872262 CTCCAGCAGTGATGTGAACTTGG - Intronic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1093326291 12:17778944-17778966 TTTAAGCAATGATCTGAAAAAGG + Intergenic
1093797551 12:23331111-23331133 CTATAGGAAGGCTGTGAAATGGG - Intergenic
1094531015 12:31274935-31274957 CTTTAGGAATGAAGTCTAATTGG - Intergenic
1095602712 12:44032273-44032295 CTTTAGTAAAGATGGAAAATTGG + Intronic
1095764122 12:45875633-45875655 CTTTATCAATGATGTTAGCTAGG + Intronic
1096900195 12:54869481-54869503 CTTTAGCTCTCATGTGCAATAGG + Intergenic
1097713220 12:62937291-62937313 CTTTAGTATTTATTTGAAATAGG + Intergenic
1098260837 12:68668923-68668945 CCTCAGCAATGCTATGAAATAGG + Exonic
1098432155 12:70431654-70431676 CAGTAGCAATGATGTGAGCTGGG - Exonic
1099425650 12:82519801-82519823 ATTTAGCAGTGATGAAAAATGGG - Intergenic
1100153543 12:91770643-91770665 CTTCAGGAAAGATGTGAAGTGGG + Intergenic
1100741064 12:97594098-97594120 AATTAACAATGATTTGAAATTGG - Intergenic
1101325936 12:103716047-103716069 CTTTGGGAATGAGGTGAAATGGG + Intronic
1102007404 12:109597334-109597356 CTTCAGCAATGGAGGGAAATAGG + Exonic
1104376843 12:128270562-128270584 CTATAGCAGGGATGAGAAATAGG + Intronic
1104701716 12:130909619-130909641 CCTTAGAAATGCTGTAAAATTGG + Intergenic
1107616552 13:42174158-42174180 CTTTACCTATCATTTGAAATGGG + Intronic
1107851924 13:44578749-44578771 CTTTAACAATCTTCTGAAATAGG - Intergenic
1108959992 13:56214801-56214823 CCTCAGCCATGATGTGAGATGGG + Intergenic
1109763001 13:66855222-66855244 ATTTAACAATAATGTGAATTTGG + Intronic
1109883579 13:68512648-68512670 CATTTCAAATGATGTGAAATTGG - Intergenic
1110405507 13:75145815-75145837 GCTGAGTAATGATGTGAAATGGG - Intergenic
1111530150 13:89526232-89526254 CTTTAGAAAAGAAGTGTAATAGG + Intergenic
1111753641 13:92364817-92364839 ATTTAGCATTGATCTTAAATAGG + Intronic
1113564329 13:111309839-111309861 CAGTAGCAAAGATGTCAAATAGG + Intergenic
1114989099 14:28264619-28264641 CTTTAGCAATAATGGGAAAGGGG + Intergenic
1115244353 14:31279781-31279803 CTTTAGCAAAAATGGGAAACTGG + Intergenic
1115467842 14:33735630-33735652 CTTGAGGACTGATATGAAATTGG - Intronic
1115737665 14:36352096-36352118 CTTGAGCAATCATGTGAAGGAGG + Intergenic
1117077549 14:52119332-52119354 TGTTAGCTATGTTGTGAAATGGG + Intergenic
1117599274 14:57357573-57357595 CATTAGCAAGGAAGTGAAACAGG - Intergenic
1117652707 14:57923602-57923624 CTTTGGAGCTGATGTGAAATGGG - Intronic
1117996155 14:61480011-61480033 CTTTAGAAGTGATGTTAAACCGG + Intronic
1118310219 14:64686637-64686659 GTTTAGCAACTCTGTGAAATGGG - Intergenic
1119318011 14:73711854-73711876 CTCTGACAAAGATGTGAAATGGG + Exonic
1120712574 14:87807955-87807977 CAATAGCAAAAATGTGAAATAGG + Intergenic
1124861658 15:33448054-33448076 CTTTTACAATGAGGTTAAATTGG + Intronic
1125226043 15:37397308-37397330 TTATAGCAATGTTTTGAAATAGG + Intergenic
1127558855 15:60115654-60115676 GTTTGGCAATTATGTCAAATGGG - Intergenic
1128166168 15:65466987-65467009 CCTTTTGAATGATGTGAAATTGG - Intronic
1129901646 15:79156084-79156106 CTTTGGCAAAGATGTTAACTGGG - Intergenic
1129907621 15:79200119-79200141 TTTTAGAAATCAGGTGAAATAGG - Intergenic
1130456074 15:84109909-84109931 CATTAGCAGTAATGTGGAATGGG + Intergenic
1130732313 15:86509543-86509565 CTTTTGGAATTATGTCAAATTGG + Intronic
1130820345 15:87488571-87488593 CTTTCGTAATGATGTGGAAGGGG - Intergenic
1131170087 15:90171829-90171851 CTTGAGAAATGTTGTGAAAACGG - Intronic
1131428236 15:92364918-92364940 GTTTTGCAATGATAAGAAATTGG - Intergenic
1132241188 15:100258408-100258430 CTTTATCAGTGGTGTGAAAATGG - Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1134912285 16:18038500-18038522 CTTCAGTAAAGATGTGAACTGGG + Intergenic
1135551695 16:23403530-23403552 GCTAAGCAATGAGGTGAAATTGG + Intronic
1137451506 16:48578649-48578671 TTTGAGCAAGGAAGTGAAATTGG - Intronic
1138983811 16:62302551-62302573 CTTGGGCAATGAGGTGAAAACGG - Intergenic
1142534979 17:608281-608303 CTTTGGAAAAGATGAGAAATTGG - Intronic
1143796349 17:9340035-9340057 CTTCAGCAATGCTGTGCTATGGG - Intronic
1146711824 17:35048614-35048636 CATTAGCAATGGGGTGGAATTGG - Intronic
1147515637 17:41114999-41115021 CTTTAGTAAAAATGGGAAATGGG + Intergenic
1148926126 17:51087298-51087320 AATTAGCAATCATGTGAAAGTGG + Intronic
1149037575 17:52152816-52152838 CCTCAGCAATGCTTTGAAATAGG + Intronic
1151643159 17:75411274-75411296 CTTTAGCAATAATGAAAAAGTGG - Intergenic
1152501446 17:80712902-80712924 ATTTCGTAATGATGTGAAATTGG + Intronic
1152955006 18:31564-31586 CTTTATCATTGATGGGAATTTGG - Intergenic
1153267943 18:3289694-3289716 CTTAACCAAAGAAGTGAAATGGG - Intergenic
1153909809 18:9696864-9696886 TTTTAGGCATGATGTGCAATGGG + Intergenic
1155889963 18:31255514-31255536 CCTGAGCATTGTTGTGAAATGGG - Intergenic
1156818596 18:41342711-41342733 CTTTAGCAATGGTATGAAGATGG - Intergenic
1157073839 18:44442498-44442520 CTTTACCAATGATTGGAAGTGGG - Intergenic
1158204256 18:54973906-54973928 TTTGAGCAAAGATTTGAAATTGG - Intergenic
1158439340 18:57460277-57460299 TTTTATAAATTATGTGAAATTGG + Intronic
1159124543 18:64207862-64207884 CTTTAGCTATGAAGTGAATTAGG - Intergenic
1159731739 18:72035537-72035559 CTTTATCAATCGTGTGAAAATGG - Intergenic
1160133431 18:76250341-76250363 CATTACCAATGAAGTGAATTAGG + Intergenic
1161877380 19:6922191-6922213 CTTTACCCATTCTGTGAAATGGG - Intronic
1164452578 19:28379666-28379688 CTTTTGCAATAATGTGATGTAGG - Intergenic
1167345426 19:48942656-48942678 CTTTAGCAATGATGTGAAATTGG - Intronic
927361008 2:22233661-22233683 CTGTATGAAAGATGTGAAATTGG - Intergenic
928941754 2:36733986-36734008 CTTTAGCTTTAATGTGAGATTGG + Intronic
929434224 2:41915128-41915150 TTTTAGCAATGAAATGAAGTGGG + Intergenic
932531983 2:72544808-72544830 TTTTACCAGTGATGAGAAATGGG - Intronic
934059446 2:88280549-88280571 CTTTAGCAATGTTATAAGATGGG - Intergenic
934878194 2:97947178-97947200 CTTTCACTATGATGTTAAATAGG - Intronic
935461162 2:103336257-103336279 AATTAGCCATGATGTGAAACTGG + Intergenic
935663731 2:105491867-105491889 CTCTAGAAAGGATGTGAAAAAGG - Intergenic
935902449 2:107807062-107807084 ATATAGCAGTGCTGTGAAATAGG - Intergenic
936690095 2:114876652-114876674 ATTGAGCAAAGATGAGAAATTGG - Intronic
939699166 2:145368007-145368029 CTTTAGTATTGATGTGAAAGAGG - Intergenic
940283271 2:152009022-152009044 CTTTATCAAAAATGTGAAAAAGG + Intronic
941547061 2:166864765-166864787 ATATAGCAATGAAGTGAAACTGG + Intergenic
942054164 2:172167158-172167180 CTTTATCAGTAATGTGAAAGTGG + Intergenic
942512737 2:176719409-176719431 CCTTGGCAAAGCTGTGAAATGGG - Intergenic
943577656 2:189649940-189649962 CTTCAGCAATCCTGTGAGATGGG - Intergenic
943595269 2:189848006-189848028 TGTTAGCCATGATGTGACATGGG + Intronic
944894156 2:204146793-204146815 CTTTAGGAAGGAAGGGAAATTGG + Intergenic
946034543 2:216731483-216731505 GTTTTGCAGTGATGTGAAAGGGG - Intergenic
946788235 2:223271231-223271253 TTTTGTCAATCATGTGAAATAGG + Intergenic
948133404 2:235618495-235618517 TTTTTGCACTAATGTGAAATGGG - Intronic
1168769118 20:403031-403053 CTTTAGCCTTGGTGTAAAATGGG + Intergenic
1169746313 20:8946565-8946587 CTTTGACAATGATGTGAAAGGGG + Intronic
1169843927 20:9969298-9969320 CTTTAGCAATTATGGTAAGTAGG - Intergenic
1177563012 21:22780859-22780881 ATTTAGCAGTGATGTAAACTAGG + Intergenic
1178094407 21:29198377-29198399 CTTTATCAGTGGTGTGAAAAGGG - Intronic
949369708 3:3321347-3321369 CTTTATCAATTATTTGGAATAGG - Intergenic
949458440 3:4264144-4264166 CTTCAGCAATCATCTGAAATTGG + Intronic
949940141 3:9148515-9148537 CTTTGGCAATTATTTGAAACAGG + Intronic
951093193 3:18598853-18598875 CTTTATCAACAATGTGAAAACGG - Intergenic
951760314 3:26140458-26140480 CTTTATCAGTGGTGTGAAAACGG + Intergenic
952223644 3:31351239-31351261 TCTTACCAATGATGTGAATTTGG + Intergenic
954373026 3:50179122-50179144 CCTTAAGAATTATGTGAAATAGG - Intronic
956113283 3:65892820-65892842 CTTTAACAATGACAGGAAATAGG + Intronic
958759485 3:98290990-98291012 CTCTAGCAAGGATTTGAAATGGG - Intergenic
959109739 3:102108035-102108057 CTTTAGCAATGATTTTAGCTAGG + Intronic
961591207 3:127983065-127983087 ATTTAGCAATGATGTGAACAAGG - Intronic
962475936 3:135755391-135755413 CTTTATTAATGATCTGAAAAAGG + Intergenic
962663074 3:137624811-137624833 TATTAGCAATGATGTCAAGTAGG - Intergenic
963304312 3:143633876-143633898 TTTTAGGAATGACGTGAATTAGG + Intronic
965295290 3:166937662-166937684 CTTTAGCATTGATGTTCATTAGG + Intergenic
965391898 3:168115011-168115033 CTTGAACAATGAAGTGAAATGGG + Intergenic
965630193 3:170725102-170725124 CTTTGGCAAGGAAGAGAAATAGG - Intronic
966062115 3:175770574-175770596 TTTATGCAATAATGTGAAATGGG + Intronic
966277697 3:178195321-178195343 CTAACGAAATGATGTGAAATAGG - Intergenic
967913670 3:194562416-194562438 CTTTACCAATAAAGAGAAATGGG - Intergenic
968358709 3:198130600-198130622 CTTTATCATTGATGGGAATTTGG + Intergenic
968544196 4:1188749-1188771 CTTTATCCATGATTGGAAATGGG - Intronic
969200457 4:5600315-5600337 ATGTAATAATGATGTGAAATAGG - Intronic
970780793 4:19735127-19735149 CTTTAGCTTTGTTGTTAAATTGG + Intergenic
971626648 4:28929251-28929273 CATTAGAAATGATATGAAGTTGG - Intergenic
971955673 4:33415284-33415306 CTTTAGTAATAATGAGAAACTGG + Intergenic
972023850 4:34351962-34351984 GATTAGAAATGATGGGAAATGGG - Intergenic
972168809 4:36319910-36319932 CTTCAGCACCGATGTGAAAGAGG - Intronic
972575529 4:40347931-40347953 CTTTGGCAACCTTGTGAAATAGG + Intronic
973169024 4:47115844-47115866 CTTCAGCATTAATGTAAAATTGG - Intronic
974642621 4:64651162-64651184 ATATAGCAATGATTTGTAATAGG - Intergenic
976019218 4:80599863-80599885 CTTTAGCAATGATGCAAAGAAGG + Intronic
976529114 4:86130706-86130728 CTTTAGTTTTGCTGTGAAATGGG + Intronic
977885953 4:102251784-102251806 CCCTATCAATGATGAGAAATTGG - Intronic
978114655 4:105004728-105004750 TTTTAGCAATATTTTGAAATAGG - Intergenic
978154045 4:105469674-105469696 CTATATCAGTGCTGTGAAATAGG - Intronic
978325125 4:107545057-107545079 TTTTAGCAATGATGTGACCTTGG - Intergenic
979162351 4:117479616-117479638 CTTTATCAGTGGTGTGAAAATGG - Intergenic
979222902 4:118249571-118249593 CTTTAATAATGATGAGAAACAGG + Intronic
979801468 4:124914249-124914271 CTTTAGCAAGGTGGTGGAATAGG - Intergenic
979871833 4:125833036-125833058 ATTTTGTAATGATGGGAAATGGG - Intergenic
980500513 4:133646316-133646338 GTTTAGCTATTATGTAAAATGGG - Intergenic
981373776 4:143990867-143990889 CTTTTGCCATCATGTGAAAAAGG - Intergenic
984515236 4:180730731-180730753 CTTTATCAGTGGTGTGAAAATGG + Intergenic
984665460 4:182422834-182422856 TTTTAGCAATTGTATGAAATAGG + Intronic
987195133 5:15518441-15518463 CCCTAGCAGTGATGTGCAATGGG + Intronic
991545095 5:67772848-67772870 TTATAGCAATTAGGTGAAATGGG + Intergenic
993179406 5:84531892-84531914 CTTTGGCATTGGTGTGAAACAGG + Intergenic
994228258 5:97280839-97280861 ATTCAGCAATGAAATGAAATGGG + Intergenic
995156659 5:108922322-108922344 CTTTATAAATGATCTGAAAGAGG + Intronic
996393153 5:122985654-122985676 CTTCAGCATTCATGTGAACTGGG + Intronic
997019934 5:129987926-129987948 TTTTAAGAATGATTTGAAATAGG - Intronic
997333668 5:133087415-133087437 CTTTAGTGATGATGGCAAATGGG + Intronic
999627775 5:153538191-153538213 ATTTAGAAATGATGGGAAGTAGG + Intronic
999629663 5:153557435-153557457 CTTTAACAATAAAGTGAACTTGG + Intronic
1004011924 6:11697299-11697321 CTTTATCAACCATGTGAAAACGG + Intergenic
1004226007 6:13784917-13784939 CCCTACCACTGATGTGAAATGGG + Intergenic
1005721790 6:28609608-28609630 CTATAACCATGAGGTGAAATTGG + Intronic
1010698177 6:79004522-79004544 CTTTAGCAGTGTTCTGAAAGAGG + Intronic
1013844115 6:114428452-114428474 CATTTCCAATGATGTGATATTGG + Intergenic
1014613548 6:123574422-123574444 CATTAGGAGTGATGTGAATTTGG - Intronic
1014622535 6:123686554-123686576 CTTTAGGTATGATGTGAAGTTGG - Intergenic
1015867872 6:137745499-137745521 CTTTAGCAATATTGTGAAATAGG - Intergenic
1016017695 6:139203419-139203441 ATTTAGCAATTATGGGACATTGG - Intergenic
1016564994 6:145442325-145442347 CTTTATCAGTGGTGTGAAAATGG - Intergenic
1016785739 6:148009165-148009187 TTTTAGCAATGGTGTTATATTGG + Intergenic
1017557334 6:155585428-155585450 CTTTAGTAATAATTTTAAATAGG - Intergenic
1018078386 6:160237019-160237041 CTTTAGCAAAAATGGGAAACTGG + Intronic
1020340887 7:7109688-7109710 CTTTAGCAAAAATGGGAAACTGG + Intergenic
1020550359 7:9596403-9596425 CTTGAGAGATGATCTGAAATTGG + Intergenic
1021301062 7:18973826-18973848 CTTTTGCCAAGATGTGAAATTGG + Intronic
1021472874 7:21025882-21025904 CTTAAGCATTTCTGTGAAATTGG + Intergenic
1021960371 7:25865926-25865948 ATTTACGAATTATGTGAAATGGG + Intergenic
1022792038 7:33699029-33699051 CTGCAGAAAGGATGTGAAATTGG - Intergenic
1022950497 7:35333587-35333609 AAGTAGCAATGATGTGAAAATGG + Intergenic
1024398157 7:48892876-48892898 CTTTTGCAATGAGATGCAATTGG + Intergenic
1025968300 7:66296531-66296553 CGTTAGCTATGATATGAGATGGG + Intronic
1026255013 7:68703491-68703513 CTTTAGCATATATGTGGAATGGG - Intergenic
1027733754 7:81906985-81907007 CTTTATCAGCGGTGTGAAATCGG + Intergenic
1030060762 7:105619026-105619048 CCTGAGCAATGCTGTGAAGTTGG - Intronic
1030572221 7:111242001-111242023 CTTTAACCAATATGTGAAATAGG + Intronic
1030960489 7:115914608-115914630 CTTTAACAATTGTGTGAGATTGG + Intergenic
1031440728 7:121791665-121791687 CTACAACAATGATGTGAATTTGG - Intergenic
1031492463 7:122405805-122405827 CTTTGGAAATGAAATGAAATTGG + Intronic
1031671972 7:124560001-124560023 TTTTATAAATGATGTGAAGTAGG - Intergenic
1032693452 7:134312743-134312765 CTTTAGAAATGGAATGAAATGGG - Intronic
1035920894 8:3675123-3675145 CTTGAGCCATGATGGGAAAGTGG - Intronic
1036295699 8:7535008-7535030 CTTTAGGAATGATATGAAACTGG + Intergenic
1036326868 8:7786011-7786033 CTTTAGGAATGATATGAAACTGG - Intergenic
1037866502 8:22448067-22448089 CTTTAGCAAGAATGTTACATAGG - Intronic
1040385177 8:46910267-46910289 CTTAAGAAATGATGTGACACTGG + Intergenic
1040948307 8:52908542-52908564 CTATAGCAAACATGTGAATTTGG + Intergenic
1042469948 8:69175415-69175437 TTTTGGCAATGTTGTGAAATTGG + Intergenic
1042506213 8:69563666-69563688 TTTTGGCAATGAATTGAAATAGG + Intronic
1042984118 8:74564846-74564868 CTTTATGAATTATGTGAACTTGG + Intergenic
1044146792 8:88725690-88725712 CATTAGCAATGTGGTGAAGTAGG - Intergenic
1044246101 8:89947876-89947898 CTTTAGCAAGAAAATGAAATTGG - Exonic
1044517481 8:93155913-93155935 CTTTGGTAATGATATGAAAATGG + Intronic
1045646211 8:104301872-104301894 CTTTGTGTATGATGTGAAATAGG - Intergenic
1045670920 8:104552680-104552702 TTTTATCAATTATGTGAAAAAGG - Intronic
1046005867 8:108482897-108482919 TTTTATGTATGATGTGAAATAGG + Intronic
1046261130 8:111769323-111769345 CTTTAGTATTCATGTAAAATTGG + Intergenic
1046829109 8:118724288-118724310 CTTTAGCAGCGGTGTGACATTGG - Intergenic
1048340007 8:133531141-133531163 TTTTAGAAATAATGTGAAATGGG + Intronic
1048655765 8:136534145-136534167 GTTTAGCCATAATGGGAAATGGG + Intergenic
1048681527 8:136847113-136847135 CTTTAAGAATGCTGAGAAATAGG - Intergenic
1050536910 9:6638574-6638596 GTTCAGAAATGATGTGAAATGGG - Intronic
1051093682 9:13439947-13439969 CCTTAGAAATGATCTAAAATAGG + Intergenic
1051347076 9:16161818-16161840 GCATAGCAATGATGAGAAATAGG + Intergenic
1053144538 9:35703644-35703666 CTTAAGCAATGATGTCACATTGG + Exonic
1053944840 9:43296335-43296357 CTTTACCAGTGGTGTGAAAATGG + Intergenic
1057723424 9:97551374-97551396 CTTTACATATGGTGTGAAATAGG + Intronic
1057814198 9:98282093-98282115 CTTTAGGAATGACATGACATAGG - Intergenic
1058058290 9:100471415-100471437 CTTTAACAATGATGATAATTAGG - Intronic
1059753728 9:117273020-117273042 CTTTATCAGCGATGTGAAAAAGG - Intronic
1060244557 9:121933455-121933477 CATTAGGAGTGATGTGAGATGGG + Intronic
1062742838 9:138189708-138189730 CTTTATCATTGATGGGAATTTGG + Intergenic
1203581338 Un_KI270746v1:8777-8799 CTTTACCAGTGGTGTGAAAATGG - Intergenic
1203587975 Un_KI270747v1:24913-24935 CTTTACCAGTGGTGTGAAAATGG + Intergenic
1186920764 X:14277146-14277168 CTTTATGAATGTTGTGATATAGG + Intergenic
1187145553 X:16633709-16633731 TTTTAGCAATGAACAGAAATAGG + Intronic
1188267972 X:28101902-28101924 TTTTAGCAATGATATAAACTAGG + Intergenic
1188306387 X:28564459-28564481 CTTTAGCAAAATTATGAAATTGG - Intergenic
1189647910 X:43154207-43154229 CTTTAGCAATGTTATTAAACTGG - Intergenic
1191845644 X:65545644-65545666 CTTTGGCCATGATGTGAATCTGG + Intergenic
1193153608 X:78149242-78149264 CTTTATCAGTGGTGTGAAAATGG + Intergenic
1193198064 X:78657376-78657398 CTTGAGCAATGAGGTGGAAGTGG + Exonic
1193631791 X:83898864-83898886 CTTTAGTAAGGATGTGTATTCGG - Intergenic
1194148017 X:90287447-90287469 CTTTAGCAAAAATGGGAAACTGG + Intergenic
1194887067 X:99329487-99329509 CTTTAGCAAAAATGGGAAACTGG + Intergenic
1196549591 X:117007068-117007090 CTTTATCAATGATCTATAATAGG - Intergenic
1199200656 X:145085288-145085310 CTTTCACTATGCTGTGAAATAGG + Intergenic
1199606355 X:149582678-149582700 CTTTGGCACTGATGTGAAGGAGG - Exonic
1199632767 X:149786690-149786712 CTTTGGCACTGATGTGAAGGAGG + Exonic
1199737807 X:150701054-150701076 CTTTAGCTATGATCTGATGTAGG - Intronic
1200494396 Y:3864206-3864228 CTTTAGCAAAAATGGGAAACTGG + Intergenic
1200751420 Y:6947635-6947657 CTTTAGCAAAAATGGGAAACTGG - Intronic