ID: 1167347427

View in Genome Browser
Species Human (GRCh38)
Location 19:48955210-48955232
Sequence CGACAAGCCCGGGCCTGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167347427_1167347435 6 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347435 19:48955239-48955261 CCACTTCCTGCCTCTGGCACTGG 0: 1
1: 0
2: 5
3: 51
4: 355
1167347427_1167347440 14 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347440 19:48955247-48955269 TGCCTCTGGCACTGGTGGGAGGG 0: 1
1: 0
2: 3
3: 34
4: 291
1167347427_1167347439 13 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347439 19:48955246-48955268 CTGCCTCTGGCACTGGTGGGAGG 0: 1
1: 0
2: 6
3: 28
4: 311
1167347427_1167347443 18 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347443 19:48955251-48955273 TCTGGCACTGGTGGGAGGGGCGG 0: 1
1: 1
2: 7
3: 53
4: 581
1167347427_1167347441 15 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347441 19:48955248-48955270 GCCTCTGGCACTGGTGGGAGGGG 0: 1
1: 0
2: 3
3: 40
4: 342
1167347427_1167347432 0 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347432 19:48955233-48955255 CCCGCACCACTTCCTGCCTCTGG 0: 1
1: 0
2: 1
3: 23
4: 331
1167347427_1167347436 9 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347436 19:48955242-48955264 CTTCCTGCCTCTGGCACTGGTGG 0: 1
1: 0
2: 2
3: 54
4: 401
1167347427_1167347437 10 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347437 19:48955243-48955265 TTCCTGCCTCTGGCACTGGTGGG 0: 1
1: 0
2: 3
3: 30
4: 320
1167347427_1167347444 19 Left 1167347427 19:48955210-48955232 CCCGGGCAGGCCCGGGCTTGTCG 0: 1
1: 0
2: 0
3: 14
4: 138
Right 1167347444 19:48955252-48955274 CTGGCACTGGTGGGAGGGGCGGG 0: 1
1: 1
2: 3
3: 80
4: 691

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167347427 Original CRISPR CGACAAGCCCGGGCCTGCCC GGG (reversed) Intronic
900240922 1:1616860-1616882 CGGCAAGCCTGGCCCTTCCCGGG + Intronic
903342510 1:22663313-22663335 AGACAAGCCCGGCTCTGCCTGGG - Intergenic
903538042 1:24080337-24080359 CGCCAAGCCCGGGCCAACCTTGG + Intronic
905151450 1:35931088-35931110 CGACCTGCCCGGGGCCGCCCCGG - Exonic
905884086 1:41482407-41482429 CTGCAAGCCCGGGCATGCCCTGG - Intronic
905912319 1:41662905-41662927 CGGGAAGCCCGCGCCTCCCCAGG + Intronic
913131224 1:115839411-115839433 CGACATGCCCGGACTTGGCCAGG - Exonic
914901582 1:151714027-151714049 AGACCTGCCCAGGCCTGCCCAGG + Intronic
918310727 1:183283471-183283493 CCACCGGCTCGGGCCTGCCCTGG + Intronic
1065343002 10:24723747-24723769 CGACCTGCCCCGGCCGGCCCCGG + Intergenic
1065501954 10:26391810-26391832 TGACGCGCCTGGGCCTGCCCAGG - Intergenic
1069004048 10:63297724-63297746 CAACAGGGCCGGGCCAGCCCAGG + Intronic
1069828351 10:71268001-71268023 CTACAAGGCCTGGCCTCCCCGGG + Intronic
1069949409 10:72008714-72008736 CAACAGGCCCGGGCCTGCCTAGG - Exonic
1069962070 10:72085198-72085220 GGAAAAGCCCAGGACTGCCCAGG + Intronic
1071532662 10:86401315-86401337 AGACAAGCTCGGGCCTGGCACGG - Intergenic
1076120431 10:127932726-127932748 AGAGAAGCCTGGGCCTGGCCTGG + Intronic
1076139799 10:128069928-128069950 CAACCAGCCTGGGCCTGGCCTGG + Intronic
1076844376 10:133061823-133061845 CGTCAGACCTGGGCCTGCCCAGG + Intergenic
1076885089 10:133258523-133258545 CGAGAAGCCCGAGCCAACCCAGG - Intergenic
1076905588 10:133359130-133359152 AGAGAAGACCGGGGCTGCCCAGG + Intergenic
1077187465 11:1241781-1241803 CGAGTAGCCCGGGGCTGACCAGG + Exonic
1077305051 11:1865201-1865223 TCAGAAGCCCGGGACTGCCCAGG - Exonic
1077500862 11:2909279-2909301 CCTCCAGCCCGGCCCTGCCCGGG + Exonic
1080871468 11:36240674-36240696 AGACAAGCCCAGGCCAGTCCTGG + Intergenic
1081813258 11:45924849-45924871 CCACAGGCCCTGGCCTGCCTTGG + Exonic
1084169808 11:67395669-67395691 CGAAATGCCTGGCCCTGCCCAGG - Intronic
1084794188 11:71493511-71493533 CCATCAGCCTGGGCCTGCCCTGG - Intronic
1085337502 11:75707242-75707264 TGGCAAGGCCTGGCCTGCCCTGG - Intergenic
1085351807 11:75802565-75802587 CCAGAAGCCCCAGCCTGCCCGGG + Intergenic
1089455545 11:118623479-118623501 ACACAAGCCCAGTCCTGCCCGGG - Intronic
1089672717 11:120067621-120067643 CCATAAGCCAGGGCCTGCCTGGG - Intergenic
1091276923 11:134359023-134359045 AGACAAGCCCTCGTCTGCCCTGG - Intronic
1096686361 12:53290906-53290928 TGAGGAGCCCGGCCCTGCCCAGG + Exonic
1106390326 13:29329292-29329314 TCACAAGCCCGGGCCTGTCAGGG - Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1109695904 13:65957148-65957170 AGACAACCCCTGGCCTCCCCAGG - Intergenic
1113894495 13:113755085-113755107 CGCCAAGCCCAGCCCTGCTCTGG + Intergenic
1113945550 13:114042187-114042209 TGACAAGCCCTGTCCTGCCGGGG - Intronic
1115349979 14:32383635-32383657 CAATAAGCCCAGGCCTGCTCTGG + Intronic
1124008098 15:25810705-25810727 CGAGGAGCCCAGGGCTGCCCAGG + Intronic
1126104659 15:45139523-45139545 AGACAAGCCCAGTGCTGCCCTGG - Exonic
1127700443 15:61494797-61494819 TGACTAGCCCTGCCCTGCCCTGG - Intergenic
1128156636 15:65395702-65395724 CGCCCCGCCCGGGCCTGCGCTGG + Intronic
1128607258 15:69046276-69046298 AGAGAAGCCAGGGCCTCCCCTGG - Intronic
1130486603 15:84401687-84401709 AGACACTCCCGGGCCTGCCATGG - Intergenic
1131258088 15:90874398-90874420 CGCCAAGCCCTGCCCTGCCTGGG - Intronic
1133202473 16:4212649-4212671 CGTCAGTCCCGGGCCTGGCCTGG - Intronic
1133274068 16:4626021-4626043 AGACATGCCAGGGCCTGCCTGGG + Intronic
1136452308 16:30360202-30360224 CGATAAGGCAGGCCCTGCCCTGG - Intronic
1137507303 16:49065413-49065435 CCACCAGCCGGGGCCTGCCAGGG + Intergenic
1138497287 16:57416247-57416269 CGCCAACCCCGCCCCTGCCCGGG - Intergenic
1141596152 16:85098065-85098087 CTACAAGCCCAGGCGTGCCAAGG + Intergenic
1143390287 17:6556052-6556074 GGCGAAGCCCGGGTCTGCCCGGG + Intronic
1147742804 17:42678334-42678356 CGCCCAGCCCAGCCCTGCCCAGG - Intergenic
1151561639 17:74872996-74873018 GGGCAAGCCCGCTCCTGCCCGGG + Exonic
1151771303 17:76163811-76163833 CACCAAGGCCTGGCCTGCCCAGG + Intronic
1152690507 17:81715791-81715813 AGACATGCCAGGGCCTGCCAGGG + Intronic
1152690755 17:81716717-81716739 CGAGAACCCCCGGCCTGCCTCGG + Intronic
1159040651 18:63320311-63320333 CGCCACTCCCGGGCCTGCCGCGG - Intergenic
1160710366 19:548632-548654 CTACAAGCCCGTCCCTGCCCTGG + Exonic
1160874699 19:1291562-1291584 CGGCCAGCCTGGGCCTCCCCGGG + Intronic
1161051736 19:2167511-2167533 TGCCAAGCCAGGGCCTGGCCAGG - Intronic
1161070020 19:2255389-2255411 CCACAGGCCTGGGCCTGACCTGG + Intronic
1162495991 19:11023716-11023738 CCACAGTCCCAGGCCTGCCCTGG + Intronic
1163163621 19:15480405-15480427 GGACATTCCCAGGCCTGCCCTGG - Intronic
1163676971 19:18660184-18660206 GGACACGCCCAGGTCTGCCCTGG - Intronic
1166541156 19:43607059-43607081 TTACAAGCCCTGGCCTGCCAGGG - Intronic
1166720442 19:44993053-44993075 AAACAAACCCTGGCCTGCCCCGG - Exonic
1166744783 19:45136456-45136478 GGACAAGCCCATGCATGCCCTGG - Intronic
1167007395 19:46784831-46784853 CGACCTGCCCTGGCCTGCCGTGG - Intronic
1167347427 19:48955210-48955232 CGACAAGCCCGGGCCTGCCCGGG - Intronic
927083779 2:19654847-19654869 CCACAAGCCCAGGCATGCCCAGG + Intergenic
927154255 2:20212663-20212685 AGGCAAGCCGGGGCCTGCCGAGG + Intronic
928928070 2:36598187-36598209 CGCCCAGCCCGGCCCCGCCCCGG + Exonic
931566812 2:63622901-63622923 CGCCGAGCCCCGGCCTGGCCCGG - Intronic
934056838 2:88258359-88258381 CAACAAGCCCTGGGCTGCCCTGG - Intergenic
934736340 2:96691660-96691682 AGAGAAGCCAGGGCCTGGCCTGG + Intergenic
936068114 2:109347586-109347608 TGAGAAGCCCCGGCCTGCCCCGG + Intronic
947585616 2:231354729-231354751 CGACAAGCTCATGCCTGCCTAGG - Intronic
948629193 2:239291271-239291293 TGGCCAGCCCGGGCCAGCCCTGG - Intronic
1172113259 20:32559855-32559877 CGGCCAGCCCAGGCCTGCCCAGG + Intronic
1173249200 20:41355785-41355807 CGCCATGCCAGGGCCTACCCAGG - Intronic
1173799645 20:45886977-45886999 CCACAAGCCAGGGGCTGCCCTGG - Exonic
1174346848 20:49936558-49936580 CGGCGAGCCCGGGCCTGGTCGGG + Intronic
1175026398 20:55907137-55907159 CGACTTGCCCTGGTCTGCCCAGG - Intergenic
1175241038 20:57549124-57549146 CGGGAAGCCAGGGCCTGCACGGG - Intergenic
1175800415 20:61798178-61798200 CGCCCCGCCCGGCCCTGCCCCGG + Intronic
1175858823 20:62138329-62138351 TGACAACCCAGGGCCAGCCCTGG + Intronic
1176041691 20:63069005-63069027 AGAGATGCCCGGGCCTGCCGAGG + Intergenic
1176178656 20:63739833-63739855 CGGCCAGCCCGGCCCGGCCCGGG + Intronic
1179630229 21:42673345-42673367 AGCCAAGCCCAGGCCTGCCCAGG + Intronic
1179791813 21:43760077-43760099 CGACAGGCCCAGCTCTGCCCAGG - Exonic
1180001603 21:44997760-44997782 CCACAGGCCCGGGCCTCCCCCGG - Intergenic
1180220726 21:46356297-46356319 AGAGAAGCCTGGGCCTGCCTGGG + Intronic
1180699684 22:17774500-17774522 CCCCACGCCCGGGCCCGCCCCGG + Intronic
1180772482 22:18400663-18400685 AGACAAGGCTGGGCCTGGCCTGG + Intergenic
1180791445 22:18577574-18577596 CACAAAGCCCGGGCCTGCCAGGG + Intergenic
1180791744 22:18578492-18578514 CAACCAGCCCGGGCTTCCCCAGG - Intergenic
1181229992 22:21416817-21416839 CAACCAGCCCGGGCTTCCCCAGG + Intergenic
1181230294 22:21417737-21417759 CACAAAGCCCGGGCCTGCCAGGG - Intronic
1181248356 22:21517126-21517148 CACAAAGCCCGGGCCTGCCAGGG + Intergenic
1181248657 22:21518049-21518071 CAACCAGCCCGGGCTTCCCCAGG - Intergenic
1183744703 22:39685850-39685872 CGACAGCCCCCGGCGTGCCCTGG + Exonic
1184340664 22:43884171-43884193 CCACAAGCCAGGCCCTTCCCAGG + Intronic
1185023465 22:48394179-48394201 CGAAAAGCCCAGTGCTGCCCTGG + Intergenic
1203234322 22_KI270731v1_random:141651-141673 AGACAAGGCTGGGCCTGGCCTGG + Intergenic
950264868 3:11566078-11566100 AGAAAAGCCTAGGCCTGCCCTGG + Intronic
953614403 3:44477500-44477522 CGGCATTCTCGGGCCTGCCCGGG - Intronic
954433889 3:50485857-50485879 AAACAAGCCCGGGCCTCCCAGGG + Intronic
960587698 3:119335484-119335506 AGACATCCCCTGGCCTGCCCTGG - Intronic
968508395 4:983008-983030 CGACAGGCGCGGGCCTGGACAGG + Intronic
968578332 4:1378158-1378180 CGGGAAGCCAGGGCCTGGCCAGG + Intronic
968902216 4:3437088-3437110 CTACATGCCAGGGCCTGCCCGGG - Intronic
969447833 4:7255755-7255777 AGACAGGCCAGGGCATGCCCTGG + Intronic
969489841 4:7492863-7492885 TGAGGAGTCCGGGCCTGCCCTGG - Intronic
978776215 4:112509527-112509549 CGCGAAGCCGGCGCCTGCCCGGG + Intergenic
981315273 4:143335720-143335742 AGACCAGCCCTGGCCAGCCCTGG + Intergenic
985547382 5:516504-516526 CACCAAGTCAGGGCCTGCCCAGG + Intronic
985694320 5:1331369-1331391 CCACACGCCCAGGCCTGCGCTGG + Intronic
990942402 5:61215817-61215839 AGTCAAGCCTGGCCCTGCCCTGG - Intergenic
995538548 5:113161930-113161952 AGACAAGCCAGGGCCTGCCTGGG - Intronic
999767966 5:154755402-154755424 CGGGAAGCCCGGGCCGCCCCGGG + Intronic
1001309415 5:170600222-170600244 CGACCAGCCCTGCCCTGCCTTGG + Intronic
1001682586 5:173569793-173569815 TGACTTGCCCGGGCTTGCCCAGG - Intergenic
1002166608 5:177351578-177351600 CGAGAAGCCCAGGCCTTCCCAGG + Exonic
1003976937 6:11353442-11353464 CCACAAGCCCAGGAATGCCCGGG + Intronic
1006082377 6:31574962-31574984 GGACAAGCCTGGGACAGCCCCGG - Intergenic
1006642325 6:35495852-35495874 CAACAAGTCCAGGCCTGACCTGG + Intronic
1007126657 6:39431445-39431467 CGCCAAGCCCTGGACTGCCGAGG + Intronic
1013380573 6:109565922-109565944 GGACAAGCCTGGGACTGGCCTGG + Intronic
1015604785 6:134943652-134943674 CCACAAGTCCTGGCCTTCCCAGG + Intronic
1015840933 6:137476718-137476740 GAACAAGCCTGGGCCTGCCCAGG + Intergenic
1026779254 7:73253305-73253327 GGACAAGCCCGGGCATTACCTGG - Intergenic
1027020113 7:74806711-74806733 GGACAAGCCCGGGCATTACCTGG - Intronic
1027067913 7:75139228-75139250 GGACAAGCCCGGGCATTACCTGG + Intronic
1029664574 7:101986908-101986930 GGACAAGCCAGCTCCTGCCCTGG + Intronic
1035308207 7:157946993-157947015 TGAGCAGCCCTGGCCTGCCCTGG + Intronic
1035443627 7:158924310-158924332 CGACATGGTCGGGCCTGCACTGG + Intronic
1042488744 8:69375771-69375793 TGAAAAGCCCAGGCTTGCCCAGG - Intergenic
1049587487 8:143438772-143438794 CCACAGGACTGGGCCTGCCCAGG + Intronic
1049989542 9:977945-977967 CGGCCGGCCCGGCCCTGCCCAGG + Intronic
1052996003 9:34551912-34551934 CGGCAGGCCCGGGCCCGCCGGGG + Exonic
1053292299 9:36889188-36889210 CCACAAGCCAGGCCCTGGCCAGG + Intronic
1057139349 9:92717324-92717346 AGACAAGCCTGGGCCTGCTGCGG + Intronic
1061679999 9:132238278-132238300 AGACAAGCCCGTGACTGCCTGGG - Intronic
1061945688 9:133907249-133907271 CAGCAAGCCCTGCCCTGCCCAGG + Intronic
1062271545 9:135712142-135712164 AGACAAGGCCGGGGCAGCCCAGG - Intronic
1186461416 X:9751261-9751283 CTACAAGGCTGGGCTTGCCCTGG + Intronic
1189294874 X:39910957-39910979 TGCGCAGCCCGGGCCTGCCCTGG - Intergenic
1198302454 X:135345021-135345043 CGACCCGACCGGGCCTTCCCGGG + Intronic
1202369134 Y:24185538-24185560 AGACACTCCCGGGCCTGCCATGG - Intergenic
1202501651 Y:25484579-25484601 AGACACTCCCGGGCCTGCCATGG + Intergenic