ID: 1167348353

View in Genome Browser
Species Human (GRCh38)
Location 19:48960831-48960853
Sequence GAACTGATCAGAACCATCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 78}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167348338_1167348353 24 Left 1167348338 19:48960784-48960806 CCTAACGCCCACTCCACTCCCCA 0: 1
1: 0
2: 4
3: 43
4: 473
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348343_1167348353 6 Left 1167348343 19:48960802-48960824 CCCCACAGGCCCTGTGCACCAAG 0: 1
1: 0
2: 1
3: 11
4: 246
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348346_1167348353 4 Left 1167348346 19:48960804-48960826 CCACAGGCCCTGTGCACCAAGGT 0: 1
1: 1
2: 1
3: 30
4: 216
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348337_1167348353 25 Left 1167348337 19:48960783-48960805 CCCTAACGCCCACTCCACTCCCC 0: 1
1: 0
2: 1
3: 20
4: 326
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348349_1167348353 -4 Left 1167348349 19:48960812-48960834 CCTGTGCACCAAGGTGCCGGAAC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348340_1167348353 17 Left 1167348340 19:48960791-48960813 CCCACTCCACTCCCCACAGGCCC 0: 1
1: 2
2: 9
3: 102
4: 774
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348342_1167348353 11 Left 1167348342 19:48960797-48960819 CCACTCCCCACAGGCCCTGTGCA 0: 1
1: 1
2: 9
3: 86
4: 631
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348344_1167348353 5 Left 1167348344 19:48960803-48960825 CCCACAGGCCCTGTGCACCAAGG 0: 1
1: 0
2: 4
3: 15
4: 168
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348348_1167348353 -3 Left 1167348348 19:48960811-48960833 CCCTGTGCACCAAGGTGCCGGAA 0: 1
1: 0
2: 1
3: 1
4: 55
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1167348341_1167348353 16 Left 1167348341 19:48960792-48960814 CCACTCCACTCCCCACAGGCCCT 0: 1
1: 1
2: 14
3: 119
4: 1157
Right 1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG 0: 1
1: 0
2: 0
3: 8
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167348353 Original CRISPR GAACTGATCAGAACCATCAT GGG Exonic
907678564 1:56541796-56541818 GCACTGTTCAGAACAATCAAGGG + Intronic
908777606 1:67656314-67656336 AAACTGATCAGAGACATCAATGG - Intergenic
908926595 1:69262791-69262813 GAACAGATCAGCAACATGATGGG + Intergenic
911320200 1:96404641-96404663 GAACTGTTTAGAACCATAAGTGG + Intergenic
919027050 1:192186105-192186127 AATCTCATCAGAAACATCATGGG + Intergenic
923833265 1:237581297-237581319 GATTTGATTATAACCATCATGGG - Intronic
1063141648 10:3261027-3261049 GACCTTATCATAACCATCATTGG + Intergenic
1063512209 10:6656408-6656430 GGACAGATCAGAACCCTCAGTGG + Intergenic
1071146648 10:82582411-82582433 GAAATGATCAGAAGCTACATAGG - Intronic
1073937304 10:108648701-108648723 GAACTGATCAGAAAAATAAGAGG + Intergenic
1081966333 11:47172312-47172334 GAACTGAAAAGCTCCATCATTGG - Exonic
1083201638 11:61124361-61124383 GGACTTATCAGAACCTTAATGGG + Intronic
1084585832 11:70061723-70061745 CAACTGTTAAGAAGCATCATGGG - Intergenic
1089321232 11:117627981-117628003 GAAGTGCTCAGGACCATGATGGG - Intronic
1089361112 11:117887298-117887320 GAACTGATCAGTACCATGCCAGG - Intergenic
1090437358 11:126697754-126697776 GAGGTGATCAGAGCAATCATGGG - Intronic
1090930243 11:131291063-131291085 GAAATGATCAGAGACATAATGGG - Intergenic
1091530690 12:1352296-1352318 GAACTGAGCTGAACCAGCAAGGG + Intronic
1094154124 12:27319899-27319921 GAACAGATCAGAACTACCAATGG - Intronic
1101444974 12:104731153-104731175 AAATTGACCAGAACCCTCATCGG + Intronic
1104110438 12:125699409-125699431 GAACTCATCAAAAACATCAGAGG + Intergenic
1104546334 12:129716281-129716303 GAGCAGATCTGATCCATCATCGG - Intronic
1114761966 14:25325949-25325971 GAAATGACCAGAACCATTAAAGG - Intergenic
1117007319 14:51434663-51434685 GTTCAGATAAGAACCATCATTGG + Intergenic
1118997497 14:70850016-70850038 CAACTGAGCAGAGACATCATTGG - Intergenic
1122739266 14:103861818-103861840 GAACTTTTCAGAACCATCTCAGG - Intergenic
1124024889 15:25956782-25956804 GAACTGAACAGAAGCTCCATAGG + Intergenic
1125438963 15:39680564-39680586 GAAATGGTCAGAGCCATCTTAGG + Intronic
1126372587 15:47962929-47962951 GCAATGACTAGAACCATCATGGG + Intergenic
1130659296 15:85817581-85817603 GAAAGGATAAGAACCATAATGGG - Intergenic
1134208485 16:12256801-12256823 GAACTAAGCAGAGCCATCAGTGG - Intronic
1139243756 16:65420468-65420490 GAAATGAACAGAAACATCACAGG + Intergenic
1140556158 16:75923687-75923709 AAACTGAGCAGAAGCACCATGGG - Intergenic
1141783763 16:86184129-86184151 GAATTGATCATAGCCAGCATTGG + Intergenic
1142096902 16:88244974-88244996 GAACTGATCAGAAGACCCATCGG + Intergenic
1151548161 17:74806041-74806063 GAACTGCTCAGAACATTCATTGG - Intronic
1152380423 17:79939493-79939515 GATGTGCTGAGAACCATCATGGG - Exonic
1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG + Exonic
933019794 2:77175786-77175808 GAGGTGATCAGAACCAACATCGG - Intronic
933384340 2:81590528-81590550 GAGCTTATCAGAATCACCATGGG + Intergenic
939300931 2:140337217-140337239 GAACTGATCATAAACAGCATTGG - Intronic
939562306 2:143747048-143747070 AAACTGATCAGAATCACCACTGG + Intronic
948110878 2:235454889-235454911 TAACAGATCAGAAGCATCAATGG + Intergenic
1171959452 20:31483410-31483432 GAACTGAAAAGAACCATTATTGG + Intronic
1174754050 20:53140768-53140790 GCACAGATCAGAACCACCAACGG - Intronic
1177201840 21:17966207-17966229 GAACTAAGCAAAACCTTCATTGG - Intronic
1178571913 21:33746128-33746150 CAACTGAGCAGAACCATCAGGGG + Intronic
1181513052 22:23397367-23397389 GATCAGAGCAGAAGCATCATTGG + Intergenic
949336397 3:2979899-2979921 GAACTGCTCAGAAAAATCATAGG + Intronic
956914030 3:73851888-73851910 GAACAGATAAGACACATCATGGG - Intergenic
958559269 3:95722759-95722781 AAAATGATTATAACCATCATAGG + Intergenic
962204735 3:133425501-133425523 CAAGTGATCAGAAAAATCATGGG - Intronic
962249895 3:133829434-133829456 GCACTTATCAGAACCACCACAGG + Intronic
963564659 3:146913479-146913501 GAAGTTTTCACAACCATCATTGG - Intergenic
970513796 4:16807045-16807067 GAGCTGATCAGTCCCATCCTGGG + Intronic
971363840 4:25960208-25960230 AAACCCATCAGAACAATCATAGG - Intergenic
972316691 4:37933754-37933776 GTACTGATCGGAATCACCATGGG + Intronic
980902664 4:138919840-138919862 GAACTGATGACATCCATCCTAGG + Intergenic
981186827 4:141813864-141813886 AAACTGATCAGTACCTTCTTTGG + Intergenic
984377384 4:178949112-178949134 TAACTGATCAGAATCAACTTTGG - Intergenic
992066219 5:73112497-73112519 GCAAGGATCAGAACCATCAAGGG + Intergenic
996191699 5:120551639-120551661 CCACTGATCAAAACAATCATTGG - Intronic
1001311973 5:170617575-170617597 GAATTGAGCAGAACCAGCTTTGG - Intronic
1003032575 6:2615313-2615335 GAAGAGATCATAACGATCATTGG + Intergenic
1007439340 6:41844611-41844633 AAATTGATCAAAACCATCATTGG - Intronic
1007611565 6:43152607-43152629 GCACTGATCAGGACGATGATGGG + Intronic
1008224082 6:48890702-48890724 GTACTAATCAGAACCAGTATAGG + Intergenic
1008693236 6:54004583-54004605 GAACTGATCAGGAACACAATAGG - Intronic
1014231404 6:118906440-118906462 GAAATGAACAGAATCATGATGGG - Intronic
1018002410 6:159591314-159591336 GAACTGCCCACAACCATCAGGGG + Intergenic
1024945313 7:54802198-54802220 GCAAAGATCAGAACCATCAGAGG + Intergenic
1031569447 7:123341051-123341073 CAACCCATGAGAACCATCATAGG - Intergenic
1033936526 7:146592615-146592637 GAACAGATCAGAACCAATGTAGG + Intronic
1039198801 8:35063053-35063075 AAACTGATTACAACCATCCTTGG - Intergenic
1045724251 8:105153045-105153067 GGGCTTATCTGAACCATCATAGG - Intronic
1047700991 8:127449226-127449248 CAACTCATCAGAACAACCATTGG + Intergenic
1048091322 8:131243606-131243628 GAACTGATGACAACCTTCTTGGG - Intergenic
1049271562 8:141698838-141698860 GTACTGAGCAGCAACATCATAGG - Intergenic
1051764757 9:20511302-20511324 AAACTGATCAGACCCAGTATTGG + Intronic
1055448746 9:76410750-76410772 GAACTCAACAGCACCATCAATGG - Intergenic
1058501053 9:105617212-105617234 GAAATGATTAGAAAGATCATAGG + Intronic
1058777815 9:108302485-108302507 GAAATGATCAGGGCCATCCTAGG - Intergenic
1186126240 X:6417516-6417538 GAACTGATCAGAGCATCCATGGG + Intergenic
1186661715 X:11674700-11674722 GAACTGTTCTGAACAATAATAGG - Intergenic
1190429706 X:50367479-50367501 GAAGTGATCAGAAAAAACATGGG - Exonic
1190728971 X:53212094-53212116 GAACTGAGCAAAAGCATGATGGG - Intronic
1200015154 X:153155833-153155855 GAATAGATAATAACCATCATTGG + Intergenic