ID: 1167348728

View in Genome Browser
Species Human (GRCh38)
Location 19:48962441-48962463
Sequence CTGGCTGGCGACTGAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167348720_1167348728 10 Left 1167348720 19:48962408-48962430 CCTGAGCTGGGCTGAGGACAGAG No data
Right 1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG No data
1167348714_1167348728 26 Left 1167348714 19:48962392-48962414 CCCACGGGAGAGGCCTCCTGAGC No data
Right 1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG No data
1167348715_1167348728 25 Left 1167348715 19:48962393-48962415 CCACGGGAGAGGCCTCCTGAGCT No data
Right 1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG No data
1167348719_1167348728 13 Left 1167348719 19:48962405-48962427 CCTCCTGAGCTGGGCTGAGGACA No data
Right 1167348728 19:48962441-48962463 CTGGCTGGCGACTGAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167348728 Original CRISPR CTGGCTGGCGACTGAGAGGC TGG Intergenic
No off target data available for this crispr