ID: 1167350921

View in Genome Browser
Species Human (GRCh38)
Location 19:48974224-48974246
Sequence CCCTCCTACTATGAGCCTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167350921_1167350930 25 Left 1167350921 19:48974224-48974246 CCCCAAGGCTCATAGTAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1167350930 19:48974272-48974294 ACAAACTCCTCATAGTCCACAGG 0: 1
1: 0
2: 1
3: 10
4: 153
1167350921_1167350926 -10 Left 1167350921 19:48974224-48974246 CCCCAAGGCTCATAGTAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1167350926 19:48974237-48974259 AGTAGGAGGGGAAGACTCCAAGG 0: 1
1: 1
2: 1
3: 19
4: 255
1167350921_1167350931 26 Left 1167350921 19:48974224-48974246 CCCCAAGGCTCATAGTAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1167350931 19:48974273-48974295 CAAACTCCTCATAGTCCACAGGG 0: 1
1: 1
2: 1
3: 18
4: 131
1167350921_1167350927 2 Left 1167350921 19:48974224-48974246 CCCCAAGGCTCATAGTAGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 113
Right 1167350927 19:48974249-48974271 AGACTCCAAGGTGACAGCCACGG 0: 1
1: 0
2: 2
3: 28
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167350921 Original CRISPR CCCTCCTACTATGAGCCTTG GGG (reversed) Exonic
900117370 1:1034356-1034378 TCCTCCCACGATGAGCCTGGAGG + Intronic
904391367 1:30188462-30188484 CCCTCCTGCTCTGACCCCTGTGG + Intergenic
905252483 1:36658637-36658659 CCTTCCTCCTTTGAGCCTTTGGG + Intergenic
905363035 1:37433480-37433502 CCCACCTTCTCTCAGCCTTGAGG + Intergenic
909681219 1:78294338-78294360 CCCTCCCATTATGGGCCTTGAGG + Intergenic
911236228 1:95415315-95415337 CCCTGTTATAATGAGCCTTGTGG + Intergenic
911888812 1:103340825-103340847 CCCTGCAACTATAAGCTTTGTGG - Intergenic
918139090 1:181705064-181705086 CCCTCCTAGTATCAGCCTATGGG + Intronic
919763782 1:201114027-201114049 CCCTCAGACTGTAAGCCTTGGGG - Exonic
921569831 1:216764881-216764903 CCCTCTCACTTTGGGCCTTGTGG - Intronic
923908157 1:238409086-238409108 CTCTCCTAATATTAACCTTGCGG - Intergenic
924290802 1:242534496-242534518 CCCTCCAACCAGGACCCTTGGGG + Intergenic
1064035031 10:11908078-11908100 CCCTCCTGCTGTGAGCGGTGAGG + Intergenic
1064224586 10:13471685-13471707 CCCTCATTCTTTGAACCTTGGGG - Intronic
1067725165 10:48764753-48764775 ACCACCTACTATGTGCCTTTGGG + Intronic
1069917678 10:71797465-71797487 CCTTCCTACTCTCAGCCTGGGGG - Intronic
1076194006 10:128502376-128502398 GCCTCCTACTGTGAGTCTTTGGG + Intergenic
1077497155 11:2891892-2891914 CCCTCCTTCTCTGACCCTGGAGG - Intronic
1080861720 11:36155759-36155781 CGCACCTACTATGAGCCAGGCGG - Intronic
1083444015 11:62695198-62695220 CCTTCCTACTCTGAGTCTTGGGG - Intronic
1083789792 11:64977050-64977072 CCATCCAGGTATGAGCCTTGTGG + Intergenic
1089528021 11:119109431-119109453 CCGTCCTGCTATCTGCCTTGAGG + Intronic
1093642739 12:21546355-21546377 CCATCATACTATGAACCCTGGGG - Exonic
1099258199 12:80342770-80342792 CCTTCCTACTAGGCTCCTTGAGG - Intronic
1099414938 12:82373371-82373393 CCCTCCTACAATGGGGCTTTGGG + Intronic
1100150334 12:91728895-91728917 TCTTCCTCCCATGAGCCTTGTGG - Intergenic
1102856568 12:116299478-116299500 TCCTCCTACTCTGAACCTTTGGG - Intergenic
1107278924 13:38710658-38710680 ACCTCCTACTAAGTGCCGTGTGG - Intronic
1113343994 13:109455847-109455869 CCCTCCGATGATGACCCTTGTGG + Intergenic
1113394446 13:109933635-109933657 CCCTCCTCCTGTGAGCCAGGAGG - Intergenic
1114721903 14:24891631-24891653 CCCCACTAATATTAGCCTTGAGG + Intronic
1114871033 14:26658895-26658917 CCCTCCTGCTCTGAGCTTAGAGG - Intergenic
1118318179 14:64738078-64738100 TCCTCCTCCTCTGAGCCTGGGGG - Intronic
1121534561 14:94682266-94682288 GCCTCCTACAATGAGGCTAGAGG + Intergenic
1124467446 15:29950839-29950861 ACTTCCTACTATGAGACTGGTGG - Intronic
1127316638 15:57801314-57801336 TCCTCCTACTAGGAGCTTTATGG + Intergenic
1127892718 15:63269437-63269459 CCCTCCTACCCTGTGGCTTGTGG + Intergenic
1130833412 15:87626221-87626243 CCCTTCCACTAGGAGCCATGAGG + Intergenic
1139277591 16:65742206-65742228 CCCTGCTCCTAGGAGGCTTGAGG - Intergenic
1142000428 16:87661213-87661235 CCCTCTTACAAGGACCCTTGTGG + Intronic
1142594485 17:1022866-1022888 CCTTCCTCCCATGAGGCTTGGGG - Intronic
1146691905 17:34882564-34882586 GCCCCAGACTATGAGCCTTGGGG - Intergenic
1147423519 17:40334309-40334331 CCCTCCCTCTGTGAGCCTTTTGG + Intronic
1148848102 17:50540912-50540934 CTCTCCTCCTCTGAGCCCTGGGG + Exonic
1162689173 19:12414467-12414489 CCCTCCTGCTCTGAGGCTAGGGG - Intronic
1162725502 19:12687944-12687966 ACCTCCTTCTATGTTCCTTGGGG - Intergenic
1163768929 19:19179141-19179163 CCCTCCTACTTTGTGCCTCGAGG - Intronic
1167350921 19:48974224-48974246 CCCTCCTACTATGAGCCTTGGGG - Exonic
928057222 2:28069561-28069583 CCCTGCTACCATGAGAATTGTGG + Intronic
930389248 2:50739682-50739704 CCCTCCTGCTATGTGCATTTAGG - Intronic
931020605 2:58040763-58040785 CTCTCCTACTGTGAACCTTTTGG - Intronic
932668968 2:73720208-73720230 CCCTTATCCTATGAGCCATGGGG - Intergenic
934708027 2:96498255-96498277 CCCTCCTGCTCTGAGGGTTGAGG - Exonic
939805706 2:146773874-146773896 CCCTACTTCTCAGAGCCTTGCGG + Intergenic
943073889 2:183172309-183172331 CCCTACTACTAGTAGCCTGGTGG - Intergenic
946309681 2:218876450-218876472 CCTCCCCACCATGAGCCTTGAGG - Intergenic
948890191 2:240903650-240903672 CCCACCTCCTCTTAGCCTTGGGG - Intergenic
1171387261 20:24778777-24778799 CCCTCCTACCCTGACCCTGGAGG - Intergenic
1171459713 20:25291679-25291701 CCCTCCTCCTATGTGTTTTGGGG + Intronic
1171780315 20:29411259-29411281 CCCTGCTTCTCTGAGCCTTTGGG - Intergenic
1173446242 20:43121246-43121268 CCATTCTACTATGGGCTTTGGGG + Intronic
1181086084 22:20440025-20440047 CCCTGCCACTGTCAGCCTTGGGG - Intronic
1181633225 22:24162264-24162286 CCCTCCTAATGAGAGCCTTTAGG - Intronic
1183541985 22:38434703-38434725 CCCTGCTACTCTGAGCCCTCAGG + Intronic
950811180 3:15651312-15651334 CCCTCCTGCTATGGCCCTTACGG - Intergenic
954956731 3:54527731-54527753 CCCTCCAACTGTGAACTTTGGGG + Intronic
955719089 3:61862882-61862904 CCCTCCTACTATGTGACATTGGG + Intronic
963007742 3:140741653-140741675 CCCTCCTCCTATGAGACCTATGG - Intergenic
965577688 3:170234636-170234658 CCCTCATACTAGTAACCTTGAGG + Intronic
966102374 3:176286289-176286311 CCATCCTACTATGAGGCTTTAGG - Intergenic
966188170 3:177246946-177246968 CCATCCTGTCATGAGCCTTGTGG + Intergenic
967835245 3:193956920-193956942 CTCTCCTACTATATGGCTTGAGG + Intergenic
968171794 3:196516696-196516718 CCCTGCTAGTATGTTCCTTGAGG - Intergenic
975701750 4:77074587-77074609 GGCTCCTACTACCAGCCTTGGGG + Intronic
982428876 4:155298814-155298836 CCCTGCTGCCTTGAGCCTTGGGG - Intergenic
985078394 4:186241303-186241325 CCCTCCTTCCAGGAGCCTTAGGG - Intronic
987697864 5:21355239-21355261 CCCTCCCATTATAAGCCTGGAGG - Intergenic
988471320 5:31541966-31541988 CCCACTTACTATGTGACTTGGGG - Intronic
991535870 5:67669038-67669060 CCCTCCAACCATAAGCCTGGCGG + Intergenic
991742581 5:69697148-69697170 CCCTCCCATTATAAGCCTGGAGG + Intergenic
991755113 5:69858056-69858078 CCCTCCCATTATAAGCCTGGAGG - Intergenic
991794154 5:70276886-70276908 CCCTCCCATTATAAGCCTGGAGG + Intergenic
991821971 5:70572461-70572483 CCCTCCCATTATAAGCCTGGAGG + Intergenic
991834440 5:70733204-70733226 CCCTCCCATTATAAGCCTGGAGG - Intergenic
991886532 5:71276428-71276450 CCCTCCCATTATAAGCCTGGAGG + Intergenic
993441134 5:87958006-87958028 TCCTCCTACTATGTGCCATGAGG - Intergenic
997353557 5:133247985-133248007 CCTTCCAACTCTGAGACTTGTGG - Intronic
997605535 5:135173342-135173364 CCATCCAAATATGAGCCATGGGG - Intronic
1005552987 6:26943165-26943187 CCCTCCCATTATAAGCCTGGAGG + Intergenic
1008003250 6:46383029-46383051 CTCTCCTACTAGACGCCTTGAGG - Intronic
1008857888 6:56113288-56113310 CCTTCCTTCTATAATCCTTGAGG + Intronic
1020006336 7:4785403-4785425 CCCTCCTTCCAGGAGCCCTGAGG + Exonic
1020814728 7:12891488-12891510 TTCTCCTACTATCAACCTTGGGG - Intergenic
1022689840 7:32637964-32637986 CCCTCCCACTCTGTGCCTTCAGG + Intergenic
1022917420 7:34972197-34972219 CCCTCCCACTCTGTGCCTTCAGG + Intronic
1023132258 7:37014765-37014787 CCCTTCCATTCTGAGCCTTGAGG - Intronic
1024383573 7:48725701-48725723 CCCTCCTATTATAGGCCTGGAGG - Intergenic
1026539416 7:71267302-71267324 CCTTCCTGGAATGAGCCTTGGGG + Intronic
1032468365 7:132161046-132161068 CCCTCCTTCTAAGAGTCTTCTGG + Intronic
1034027657 7:147724422-147724444 CCCTGCAACTGTGAGGCTTGAGG - Intronic
1034451437 7:151139214-151139236 CCCTCCCAGTAGGAGCCCTGAGG + Intronic
1036771375 8:11580537-11580559 TCCTCCTTCTATGGGCCTGGAGG - Intergenic
1037026101 8:14040182-14040204 CCCTCCTACTATCAGAGATGTGG + Intergenic
1039693403 8:39884323-39884345 CCCCCCTACAATGAGGCTTTGGG + Intergenic
1039790290 8:40870341-40870363 CCCACCAAATATGAGACTTGAGG - Intronic
1040755043 8:50762893-50762915 CCCTCCTACCAGCAGCATTGGGG + Intronic
1045357886 8:101405445-101405467 CCCTCCTCCTTTCAGACTTGTGG + Intergenic
1048660860 8:136599775-136599797 ACCTCCCACTATAAGCCTGGAGG + Intergenic
1048988044 8:139745781-139745803 CCTTGCTACTATGTGCCTTTTGG + Intronic
1049819020 8:144622916-144622938 CCCTCCCAGTCTCAGCCTTGGGG - Intergenic
1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG + Intronic
1059233785 9:112745159-112745181 CCCAGCTACTAGGAGCCTTCAGG + Intergenic
1061754672 9:132804284-132804306 AGCTCCTACCATGAGCCCTGCGG + Intronic
1062526772 9:136981098-136981120 CCCCCCAACCATGAGCCTTCAGG - Intronic
1203491375 Un_GL000224v1:108552-108574 CCCTCCTACAGCCAGCCTTGAGG + Intergenic
1203503999 Un_KI270741v1:50422-50444 CCCTCCTACAGCCAGCCTTGAGG + Intergenic
1189245459 X:39560174-39560196 CCCTCCTGCTGGGAGCCTTCTGG - Intergenic
1189351515 X:40279229-40279251 CCCTACCTCTCTGAGCCTTGAGG - Intergenic
1192082210 X:68059355-68059377 TCCTCCTACTCTGTGCCTTCAGG - Intronic