ID: 1167358719

View in Genome Browser
Species Human (GRCh38)
Location 19:49018845-49018867
Sequence GGCGGTGCCGAGCGAGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167358706_1167358719 22 Left 1167358706 19:49018800-49018822 CCCAGGGGCTCGGCGTGCACCGG No data
Right 1167358719 19:49018845-49018867 GGCGGTGCCGAGCGAGAGCCCGG No data
1167358705_1167358719 26 Left 1167358705 19:49018796-49018818 CCAGCCCAGGGGCTCGGCGTGCA No data
Right 1167358719 19:49018845-49018867 GGCGGTGCCGAGCGAGAGCCCGG No data
1167358708_1167358719 21 Left 1167358708 19:49018801-49018823 CCAGGGGCTCGGCGTGCACCGGC No data
Right 1167358719 19:49018845-49018867 GGCGGTGCCGAGCGAGAGCCCGG No data
1167358714_1167358719 3 Left 1167358714 19:49018819-49018841 CCGGCCACGGCGGGGGCTGTGCA No data
Right 1167358719 19:49018845-49018867 GGCGGTGCCGAGCGAGAGCCCGG No data
1167358716_1167358719 -1 Left 1167358716 19:49018823-49018845 CCACGGCGGGGGCTGTGCAGGAG No data
Right 1167358719 19:49018845-49018867 GGCGGTGCCGAGCGAGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167358719 Original CRISPR GGCGGTGCCGAGCGAGAGCC CGG Intergenic