ID: 1167358911

View in Genome Browser
Species Human (GRCh38)
Location 19:49019635-49019657
Sequence GTCCTTCCCAGGTGTCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167358911_1167358924 7 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358924 19:49019665-49019687 GTGGTGGTCTGCGAGTTGTGGGG No data
1167358911_1167358928 14 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358928 19:49019672-49019694 TCTGCGAGTTGTGGGGGCTGGGG No data
1167358911_1167358925 8 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358925 19:49019666-49019688 TGGTGGTCTGCGAGTTGTGGGGG No data
1167358911_1167358927 13 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358927 19:49019671-49019693 GTCTGCGAGTTGTGGGGGCTGGG No data
1167358911_1167358923 6 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358923 19:49019664-49019686 GGTGGTGGTCTGCGAGTTGTGGG No data
1167358911_1167358929 29 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358929 19:49019687-49019709 GGCTGGGGCCCGAAGTATTCCGG No data
1167358911_1167358926 12 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358926 19:49019670-49019692 GGTCTGCGAGTTGTGGGGGCTGG No data
1167358911_1167358930 30 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358930 19:49019688-49019710 GCTGGGGCCCGAAGTATTCCGGG No data
1167358911_1167358922 5 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358922 19:49019663-49019685 CGGTGGTGGTCTGCGAGTTGTGG No data
1167358911_1167358917 -9 Left 1167358911 19:49019635-49019657 CCACCCAGACACCTGGGAAGGAC No data
Right 1167358917 19:49019649-49019671 GGGAAGGACCCCCGCGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167358911 Original CRISPR GTCCTTCCCAGGTGTCTGGG TGG (reversed) Intergenic