ID: 1167358913

View in Genome Browser
Species Human (GRCh38)
Location 19:49019639-49019661
Sequence GGGGGTCCTTCCCAGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167358913_1167358927 9 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358927 19:49019671-49019693 GTCTGCGAGTTGTGGGGGCTGGG No data
1167358913_1167358922 1 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358922 19:49019663-49019685 CGGTGGTGGTCTGCGAGTTGTGG No data
1167358913_1167358931 27 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data
1167358913_1167358930 26 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358930 19:49019688-49019710 GCTGGGGCCCGAAGTATTCCGGG No data
1167358913_1167358928 10 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358928 19:49019672-49019694 TCTGCGAGTTGTGGGGGCTGGGG No data
1167358913_1167358924 3 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358924 19:49019665-49019687 GTGGTGGTCTGCGAGTTGTGGGG No data
1167358913_1167358926 8 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358926 19:49019670-49019692 GGTCTGCGAGTTGTGGGGGCTGG No data
1167358913_1167358925 4 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358925 19:49019666-49019688 TGGTGGTCTGCGAGTTGTGGGGG No data
1167358913_1167358923 2 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358923 19:49019664-49019686 GGTGGTGGTCTGCGAGTTGTGGG No data
1167358913_1167358929 25 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358929 19:49019687-49019709 GGCTGGGGCCCGAAGTATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167358913 Original CRISPR GGGGGTCCTTCCCAGGTGTC TGG (reversed) Intergenic