ID: 1167358921

View in Genome Browser
Species Human (GRCh38)
Location 19:49019660-49019682
Sequence CAACTCGCAGACCACCACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167358921_1167358937 24 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG No data
1167358921_1167358931 6 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data
1167358921_1167358929 4 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358929 19:49019687-49019709 GGCTGGGGCCCGAAGTATTCCGG No data
1167358921_1167358938 25 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358938 19:49019708-49019730 GGGGCGCGCGGGTCCCCGCTGGG No data
1167358921_1167358930 5 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358930 19:49019688-49019710 GCTGGGGCCCGAAGTATTCCGGG No data
1167358921_1167358934 13 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358934 19:49019696-49019718 CCGAAGTATTCCGGGGCGCGCGG No data
1167358921_1167358935 14 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358935 19:49019697-49019719 CGAAGTATTCCGGGGCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167358921 Original CRISPR CAACTCGCAGACCACCACCG CGG (reversed) Intergenic