ID: 1167358931

View in Genome Browser
Species Human (GRCh38)
Location 19:49019689-49019711
Sequence CTGGGGCCCGAAGTATTCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167358913_1167358931 27 Left 1167358913 19:49019639-49019661 CCAGACACCTGGGAAGGACCCCC No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data
1167358921_1167358931 6 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data
1167358912_1167358931 28 Left 1167358912 19:49019638-49019660 CCCAGACACCTGGGAAGGACCCC No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data
1167358919_1167358931 8 Left 1167358919 19:49019658-49019680 CCCCGCGGTGGTGGTCTGCGAGT No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data
1167358915_1167358931 20 Left 1167358915 19:49019646-49019668 CCTGGGAAGGACCCCCGCGGTGG No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data
1167358918_1167358931 9 Left 1167358918 19:49019657-49019679 CCCCCGCGGTGGTGGTCTGCGAG No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data
1167358920_1167358931 7 Left 1167358920 19:49019659-49019681 CCCGCGGTGGTGGTCTGCGAGTT No data
Right 1167358931 19:49019689-49019711 CTGGGGCCCGAAGTATTCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167358931 Original CRISPR CTGGGGCCCGAAGTATTCCG GGG Intergenic