ID: 1167358932

View in Genome Browser
Species Human (GRCh38)
Location 19:49019695-49019717
Sequence CGCGCGCCCCGGAATACTTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167358932_1167358938 -10 Left 1167358932 19:49019695-49019717 CCCGAAGTATTCCGGGGCGCGCG No data
Right 1167358938 19:49019708-49019730 GGGGCGCGCGGGTCCCCGCTGGG No data
1167358932_1167358943 27 Left 1167358932 19:49019695-49019717 CCCGAAGTATTCCGGGGCGCGCG No data
Right 1167358943 19:49019745-49019767 GCGCCCTCGTCTCGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167358932 Original CRISPR CGCGCGCCCCGGAATACTTC GGG (reversed) Intergenic