ID: 1167358937

View in Genome Browser
Species Human (GRCh38)
Location 19:49019707-49019729
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167358921_1167358937 24 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG No data
1167358919_1167358937 26 Left 1167358919 19:49019658-49019680 CCCCGCGGTGGTGGTCTGCGAGT No data
Right 1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG No data
1167358920_1167358937 25 Left 1167358920 19:49019659-49019681 CCCGCGGTGGTGGTCTGCGAGTT No data
Right 1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG No data
1167358918_1167358937 27 Left 1167358918 19:49019657-49019679 CCCCCGCGGTGGTGGTCTGCGAG No data
Right 1167358937 19:49019707-49019729 CGGGGCGCGCGGGTCCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167358937 Original CRISPR CGGGGCGCGCGGGTCCCCGC TGG Intergenic
No off target data available for this crispr