ID: 1167358938

View in Genome Browser
Species Human (GRCh38)
Location 19:49019708-49019730
Sequence GGGGCGCGCGGGTCCCCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167358918_1167358938 28 Left 1167358918 19:49019657-49019679 CCCCCGCGGTGGTGGTCTGCGAG No data
Right 1167358938 19:49019708-49019730 GGGGCGCGCGGGTCCCCGCTGGG No data
1167358919_1167358938 27 Left 1167358919 19:49019658-49019680 CCCCGCGGTGGTGGTCTGCGAGT No data
Right 1167358938 19:49019708-49019730 GGGGCGCGCGGGTCCCCGCTGGG No data
1167358932_1167358938 -10 Left 1167358932 19:49019695-49019717 CCCGAAGTATTCCGGGGCGCGCG No data
Right 1167358938 19:49019708-49019730 GGGGCGCGCGGGTCCCCGCTGGG No data
1167358921_1167358938 25 Left 1167358921 19:49019660-49019682 CCGCGGTGGTGGTCTGCGAGTTG No data
Right 1167358938 19:49019708-49019730 GGGGCGCGCGGGTCCCCGCTGGG No data
1167358920_1167358938 26 Left 1167358920 19:49019659-49019681 CCCGCGGTGGTGGTCTGCGAGTT No data
Right 1167358938 19:49019708-49019730 GGGGCGCGCGGGTCCCCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167358938 Original CRISPR GGGGCGCGCGGGTCCCCGCT GGG Intergenic