ID: 1167361483

View in Genome Browser
Species Human (GRCh38)
Location 19:49032702-49032724
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 7, 1: 0, 2: 2, 3: 37, 4: 363}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167361483_1167361501 26 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361501 19:49032751-49032773 GCCTCTCTGGTCAGGGGCTGCGG 0: 6
1: 0
2: 1
3: 40
4: 377
1167361483_1167361498 18 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361498 19:49032743-49032765 GGTGGTCTGCCTCTCTGGTCAGG 0: 6
1: 0
2: 0
3: 9
4: 133
1167361483_1167361499 19 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361499 19:49032744-49032766 GTGGTCTGCCTCTCTGGTCAGGG 0: 6
1: 0
2: 0
3: 12
4: 158
1167361483_1167361495 -3 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361495 19:49032722-49032744 CAGAGGCAGCGGGGGAGGAAGGG 0: 7
1: 0
2: 3
3: 117
4: 1164
1167361483_1167361494 -4 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361494 19:49032721-49032743 ACAGAGGCAGCGGGGGAGGAAGG 0: 7
1: 2
2: 4
3: 119
4: 1437
1167361483_1167361497 13 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361497 19:49032738-49032760 GGAAGGGTGGTCTGCCTCTCTGG 0: 7
1: 0
2: 2
3: 16
4: 183
1167361483_1167361500 20 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361500 19:49032745-49032767 TGGTCTGCCTCTCTGGTCAGGGG 0: 6
1: 1
2: 3
3: 21
4: 186
1167361483_1167361491 -8 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361491 19:49032717-49032739 ACCCACAGAGGCAGCGGGGGAGG 0: 7
1: 0
2: 4
3: 35
4: 328
1167361483_1167361496 0 Left 1167361483 19:49032702-49032724 CCACCTCAGGGCCAGACCCACAG 0: 7
1: 0
2: 2
3: 37
4: 363
Right 1167361496 19:49032725-49032747 AGGCAGCGGGGGAGGAAGGGTGG 0: 7
1: 2
2: 36
3: 1248
4: 12989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167361483 Original CRISPR CTGTGGGTCTGGCCCTGAGG TGG (reversed) Intronic
900409921 1:2507856-2507878 CTGCTGGGCAGGCCCTGAGGAGG - Intergenic
901224655 1:7606175-7606197 CTGAGAGTCTGGACCTGGGGAGG - Intronic
901456735 1:9367484-9367506 CGGTGCGCCTGGCCCTGGGGAGG + Exonic
901635102 1:10666870-10666892 CTGTGGGCCAGACCCTGTGGTGG + Intronic
902077023 1:13795469-13795491 CTGTGGATCTAGGCGTGAGGAGG + Intronic
902122890 1:14182984-14183006 CTGTGGGTATGGAACTGAGAGGG - Intergenic
902810785 1:18886649-18886671 CTGTGGGCCGGGCACTGGGGAGG - Intronic
903320729 1:22541644-22541666 GTGGGGGCCTGGCCCAGAGGAGG - Intergenic
903501554 1:23802851-23802873 CTGTGGGCCAGGCCCTGTGCTGG - Intronic
903814949 1:26058096-26058118 CTGTAGGCCAGGCACTGAGGTGG - Intronic
903943670 1:26948671-26948693 CTGTGGCTCTGGCCTTGCTGGGG - Intergenic
905242146 1:36588264-36588286 CTGTGTGCCAGGCCCTGAGCTGG - Intergenic
905255430 1:36678779-36678801 ATGTGGCTCTCTCCCTGAGGTGG - Intergenic
905458849 1:38107627-38107649 CAGTGTGTGTGGCTCTGAGGTGG + Intergenic
905678017 1:39843488-39843510 GGGTGGGGCTGGCCCTGAGGTGG + Intronic
906212549 1:44020156-44020178 CTGTGTGCCAGGCCCTGAGCCGG + Intronic
907460284 1:54601629-54601651 GTGTGGGTCTGGCTCGGAGTTGG + Intronic
908360972 1:63367935-63367957 CTGAGGGCCTGGCCCTCAAGAGG + Intronic
912491695 1:110066032-110066054 GTGGAGGCCTGGCCCTGAGGAGG + Intronic
912814448 1:112817897-112817919 CTGTGGGTCAGGCCCTCACAGGG - Intergenic
914436572 1:147665665-147665687 CTTTGTGTCAGGCCCTGTGGTGG - Intronic
914509312 1:148317508-148317530 CTGAGGGCCTGCCCCTCAGGAGG + Intergenic
915120750 1:153628475-153628497 CGGTTGGCCTGGGCCTGAGGTGG - Exonic
915907665 1:159890597-159890619 CTGTCGCTCTGGCCCTGGGCTGG + Exonic
916879040 1:169000954-169000976 CTCTGGGCCTGGCCCTGGGATGG + Intergenic
918372078 1:183870574-183870596 CTTTGGGACTGGGCCTGAGAAGG + Intronic
919741831 1:200985645-200985667 CTGTGGGCCTGGCCCACATGTGG + Intronic
922685499 1:227635818-227635840 CCGTGGGACTGGGCCTGAGAAGG + Intronic
922705435 1:227788071-227788093 CTGTGGGTGTGGCCAGGCGGGGG + Intergenic
922746873 1:228049102-228049124 CACTGGGGCTGGCCCTGGGGAGG + Intronic
923282814 1:232461117-232461139 CTGTGGAAATGACCCTGAGGAGG - Exonic
924273704 1:242362901-242362923 GTGTGGGTCTGGTCCTCAGCAGG - Intronic
924719353 1:246607746-246607768 CTTTGGGACTGGGCCTGAGAAGG + Intronic
924722989 1:246640027-246640049 CCTTGGGACTGGGCCTGAGGAGG + Intronic
1062768211 10:81068-81090 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1065123921 10:22554816-22554838 CTGTGCGTCTAGTCCTGAGCTGG + Intronic
1066711005 10:38233753-38233775 GTGTGGGTCTGGCCCTCAGCAGG + Intergenic
1067756258 10:49008132-49008154 GTGTGGGACTAGCCCTGAGCTGG + Intergenic
1067906278 10:50294627-50294649 CTGTGGCTCTGCTCCTGGGGAGG - Intergenic
1069802970 10:71093689-71093711 CTGTGGGTCTGGGCCTGACCTGG + Intergenic
1070764490 10:79048585-79048607 CTGGGGGTGTGGGTCTGAGGTGG + Intergenic
1071413534 10:85420304-85420326 CTGTGTGTCTTCCCCTGTGGTGG + Intergenic
1073604215 10:104877542-104877564 CTGTGTGTCTGGGCCTGAACTGG + Intronic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1075711617 10:124533818-124533840 CTTGGGGTCTGGCCCTGGGCTGG - Intronic
1076031569 10:127163465-127163487 CTCTACTTCTGGCCCTGAGGTGG - Intronic
1077049229 11:559317-559339 CTGGGGGTAGGGCCCTGAGCTGG - Intronic
1077305886 11:1868547-1868569 CTGCTGGGCTGGCCCTGAGGGGG + Intronic
1077309903 11:1883645-1883667 CTGTGGGTCTAGCCCAGAGTGGG + Intronic
1077319778 11:1935987-1936009 CAGAGGGGCTGGCCCTGAGACGG + Intronic
1077408834 11:2394239-2394261 GGCTGCGTCTGGCCCTGAGGAGG + Intronic
1077678531 11:4219026-4219048 CTGGAGGTCAGGGCCTGAGGAGG - Intergenic
1077682099 11:4251306-4251328 CTGGAGGTCAGGGCCTGAGGAGG + Intergenic
1077687934 11:4315429-4315451 CTGGAGGTCAGGGCCTGAGGAGG - Intergenic
1079377236 11:19904488-19904510 CTATGGGTCTCACCCTGAAGAGG - Intronic
1080474949 11:32581741-32581763 CTGTGGGCTGGGCACTGAGGTGG + Intergenic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1081733003 11:45384734-45384756 CTGTGGGGCTGGCGTTGGGGAGG - Intergenic
1083063594 11:59899822-59899844 CCTTGGGACTGGGCCTGAGGAGG + Intergenic
1083261496 11:61525457-61525479 GTGTGCGCCCGGCCCTGAGGCGG - Intronic
1083616291 11:64028246-64028268 CTGAGGGTCTGGAGCCGAGGGGG + Intronic
1084178669 11:67436092-67436114 CTGGGGGGCTGGCCCAGAGCAGG + Exonic
1084403972 11:68960546-68960568 GTGTGGGTCAGGCACGGAGGTGG - Intergenic
1084589032 11:70079455-70079477 CTCTGGGTCTGGCCCTGGGGAGG - Intronic
1084610862 11:70202281-70202303 CCGTGGGTCTGGAGGTGAGGAGG - Intergenic
1084651873 11:70494279-70494301 CTGAGGTTCTGGCCCGGTGGGGG - Intronic
1085300547 11:75455877-75455899 CTTTGGGCCCAGCCCTGAGGGGG + Intronic
1085519443 11:77129525-77129547 CTCTGGGTCTGGCCCTGTGCTGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1087012383 11:93526214-93526236 CTGGTGGTCTGCCCCTGGGGAGG - Intronic
1087049414 11:93870154-93870176 CATTGGGACTGGGCCTGAGGAGG + Intergenic
1088411469 11:109539358-109539380 CTGTGGGCCTGGAGCTGTGGTGG - Intergenic
1088964349 11:114702933-114702955 CTGTGGCTCTGGCTCTGAAAGGG + Intronic
1090969013 11:131623709-131623731 GAGTGGGCCTGGCCCAGAGGGGG - Intronic
1091191696 11:133701098-133701120 ATGTGAGCCTGGCTCTGAGGTGG - Intergenic
1091463836 12:666557-666579 CTGGGGGTTGGGGCCTGAGGTGG - Intergenic
1091723133 12:2827594-2827616 CTTTGGGTCAGGCCCTGAGTGGG + Intronic
1092049334 12:5456660-5456682 CTGAGGGTCTGGCTCTGGGAGGG + Intronic
1095468379 12:42511502-42511524 CTGAGGGTCTGGCCTTGTGGTGG + Intronic
1095735264 12:45548978-45549000 CTATGGGTCTGCCCCTGTAGCGG - Intergenic
1095861253 12:46920219-46920241 CTGTTGGTCTGGTGCTAAGGAGG - Intergenic
1096797820 12:54089702-54089724 CCTTGGGCCTGGCCCTGTGGAGG - Intergenic
1099862302 12:88235264-88235286 CCTTGGGACTGGGCCTGAGGAGG - Intergenic
1101961671 12:109255580-109255602 CTGTGGCTCTGACCAGGAGGGGG - Intronic
1102470784 12:113158783-113158805 CTGTGTGCCTGGCCCTGTGCTGG - Exonic
1102882350 12:116495346-116495368 CTGTGGGAATGTCCCTGTGGAGG - Intergenic
1103446708 12:120999605-120999627 CTGTGGGGCTGGCGCTGAGCCGG - Exonic
1103624422 12:122207171-122207193 TTGTGGGTATGTGCCTGAGGCGG + Exonic
1103923753 12:124412694-124412716 CTGGGGGTCAGCCCCTGAGCAGG - Intronic
1103948367 12:124539357-124539379 CAGTGGGCCTGGGCCTGAGCTGG - Intronic
1103988677 12:124784094-124784116 CTGAGGGACTGGGCCAGAGGAGG - Intronic
1104288828 12:127449840-127449862 CAGTGGGGCTGGCCCTGGGGTGG - Intergenic
1104898608 12:132176108-132176130 CTTTGGCTCTGGCTCTGAGGGGG - Intergenic
1104935195 12:132360764-132360786 CTGTGTGTCTGGCTCTGGGATGG - Intergenic
1104939546 12:132388478-132388500 CTGTGGCTCTGAGCCTGTGGTGG - Intergenic
1105843663 13:24276865-24276887 CTGTGGGTCTGGCCATTGTGAGG + Intronic
1106304020 13:28494746-28494768 CTGGGGGCCGGGGCCTGAGGCGG - Intronic
1106554601 13:30798715-30798737 CTGTGTGCCTGGCCTTGTGGGGG + Intergenic
1107239054 13:38210443-38210465 CTTTGGGTCTCCCCCTTAGGAGG - Intergenic
1111934966 13:94549095-94549117 CCCTGGGTCTGGCCCTGGGGTGG - Intergenic
1112370361 13:98788200-98788222 CTGTGGCTGTGGCCCGGGGGTGG - Intergenic
1113726493 13:112606537-112606559 GCGCGGGTCCGGCCCTGAGGCGG + Intergenic
1113784866 13:112997140-112997162 CTCTGGGTCTGCCACTGAGCTGG - Intronic
1113811613 13:113146171-113146193 CTGTGTGTCAGGCACTGAGCCGG + Intronic
1113937438 13:114001868-114001890 CAGCAGGGCTGGCCCTGAGGGGG - Intronic
1114517217 14:23307851-23307873 CTGTGGAGCTGGCCCCGGGGAGG + Exonic
1114648506 14:24268852-24268874 CTGTGGGCCTGGTGCTGATGGGG - Intronic
1116300558 14:43175974-43175996 CAGTGGGTCTGGCCCTGAAGTGG + Intergenic
1116685776 14:48036264-48036286 CTGGGGGTGTGGCTCTCAGGTGG + Intergenic
1117221234 14:53608594-53608616 CTCTGCCTTTGGCCCTGAGGAGG + Intergenic
1119375735 14:74191120-74191142 CTGTGGCTCTGGCGCAGAGCTGG - Intronic
1119703337 14:76769499-76769521 CTTTGGGAGTGGTCCTGAGGGGG - Intronic
1121429963 14:93879573-93879595 CTGTGGGTAGAGCCCAGAGGAGG + Intergenic
1121582724 14:95043268-95043290 CAGAGAGTCTGACCCTGAGGTGG - Intergenic
1121614357 14:95303186-95303208 CTGTGGCTTTGGGCTTGAGGAGG + Intronic
1122075091 14:99230728-99230750 GTCTGGGTCTGGCCCAGAGCCGG + Intronic
1122142944 14:99673591-99673613 GAGTGGGTATGGCACTGAGGGGG + Intronic
1122695227 14:103549165-103549187 CTGTGGGAATGGCCATCAGGTGG + Intergenic
1122872323 14:104644840-104644862 GTGTCAGTCTGGCCCTGTGGGGG - Intergenic
1123028726 14:105440647-105440669 ATGTGGCCCTGGCCCTGAGGAGG - Intronic
1123031894 14:105455886-105455908 CTGTGGGTCGGAGCCTGGGGAGG + Intronic
1123031933 14:105456048-105456070 CTGTGGGTCTGAGCATGGGGAGG + Intronic
1124532315 15:30518406-30518428 ATGAGGGTGGGGCCCTGAGGGGG + Intergenic
1124766338 15:32489239-32489261 ATGAGGGTGGGGCCCTGAGGGGG - Intergenic
1125310324 15:38372098-38372120 CTGTGGGTCTGGAATTCAGGAGG - Intergenic
1125356416 15:38821254-38821276 ATGTGGGTCTGGCACTGTGCTGG + Intergenic
1125475725 15:40046949-40046971 CTGTGGGTCTGTCACAGAGGTGG - Intergenic
1125677091 15:41507956-41507978 CTGTGTGCCAGGCCCTGTGGTGG - Intronic
1125764141 15:42121837-42121859 CTCTGGGCCTGGCCCTGGAGGGG + Intergenic
1128071784 15:64801855-64801877 CAGTGTGCCTGGCCCTGAGCTGG - Intergenic
1128789732 15:70424108-70424130 AGGTGGCTCTGGCACTGAGGAGG - Intergenic
1128869373 15:71141237-71141259 CTGTGGGTCAGGCACTGTGCTGG + Intronic
1129500800 15:76035791-76035813 CTGGTGGTCGGGCCCTGGGGTGG + Intronic
1129726397 15:77903812-77903834 CTGTGGCTCAGGCCCTCGGGTGG - Intergenic
1129743168 15:78000064-78000086 CTGAGGCTCTAGCCCAGAGGCGG + Intronic
1130274431 15:82469160-82469182 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1130466778 15:84196534-84196556 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1130497486 15:84477002-84477024 CTGAGGCTCAGGCCCTCAGGTGG + Intergenic
1130589073 15:85201127-85201149 CTGAGGCTCAGGCCCTCAGGTGG - Intergenic
1131000911 15:88939237-88939259 CTTTGGGACTGGGCCTGAGAAGG + Intergenic
1132457111 16:30044-30066 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1132600254 16:769945-769967 CTGTGGGAGTGGCCACGAGGCGG + Intronic
1132863609 16:2083229-2083251 CTGTGGGTCTGGCTTGGAGTTGG + Intronic
1134089684 16:11384867-11384889 CGGTGGGTCTGGGCCCCAGGAGG - Exonic
1134745880 16:16587855-16587877 ATGTGGGTCTGGCATTGGGGAGG + Intergenic
1134999599 16:18765887-18765909 ATGTGGGTCTGGCATTGGGGAGG - Intergenic
1135842718 16:25891341-25891363 CTGTGGGTCAGGCATTTAGGAGG + Intronic
1138297411 16:55898866-55898888 CTGTGTGTCTGGCACTGGGTTGG + Intronic
1138554826 16:57765054-57765076 CTGTGGGTGAGGCCATGTGGTGG + Intronic
1139482229 16:67236865-67236887 CTGTGGGGCGGGGCCTGAGGGGG + Intronic
1140901579 16:79372810-79372832 CAGTGGGTCTGGAGCTGAGAGGG - Intergenic
1141089982 16:81123537-81123559 CTGGAGCTCTGGCCCTGGGGTGG + Intergenic
1141596722 16:85101454-85101476 CTGTGGGTCTGGGGTTGATGGGG - Intronic
1142312828 16:89323791-89323813 CAGTTGGTGTGGCCCTGAGGAGG - Intronic
1142591625 17:1008698-1008720 CGGGGGGCCTGGCCCTGAGCTGG + Intronic
1142902105 17:3018476-3018498 CTGCAGGGCTGGCCCCGAGGAGG - Intronic
1143317897 17:6046600-6046622 GTTTTGGTCTGGCCCAGAGGTGG - Intronic
1145058615 17:19718677-19718699 CAGTGGGTTTGACCCTGGGGAGG + Intronic
1146660949 17:34664884-34664906 CTGGGGGTCTCAGCCTGAGGTGG + Intergenic
1146683439 17:34824703-34824725 CTGAAGGCCTGGCCCAGAGGAGG + Intergenic
1147248200 17:39136021-39136043 CTGTGTGTCTGGTCCTGAGCAGG + Intronic
1147251024 17:39152329-39152351 GATTGGGTCTGGCCCTGAGTAGG - Intronic
1148438019 17:47697045-47697067 GTGTGGGACTGACCCTGTGGTGG + Intronic
1148783875 17:50135792-50135814 CTGGGGGTCTGGCTCTGTGCTGG + Intronic
1150063321 17:62087692-62087714 CTGTGGGCCTAGCTCTGAGAAGG + Intergenic
1151655606 17:75494557-75494579 CTGTGTGTGTGGCCCTGGGCTGG + Intronic
1151683321 17:75633250-75633272 CAGTGAGTCAGGGCCTGAGGAGG - Intronic
1151959998 17:77400769-77400791 CTGTGGGTCTGGCCTGGGGAAGG + Intronic
1151980998 17:77508417-77508439 TTGTGGGTTTAGCCCTGAGTGGG + Intergenic
1152325633 17:79634261-79634283 CAGTGGCTCTGGCGGTGAGGTGG - Intergenic
1152725104 17:81941292-81941314 CTGTGGAGGTGGCCCTGACGCGG - Exonic
1152751691 17:82065370-82065392 CCGCGGGCCTGGCCCTGAGCAGG + Exonic
1152961100 18:80565-80587 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1153837877 18:8980629-8980651 TTATGGCTGTGGCCCTGAGGCGG - Intergenic
1154197442 18:12276913-12276935 CAGTGGGTCTGGCCAGGAGCAGG - Intronic
1155174565 18:23291112-23291134 CTGTGGGTCTTGCCCTGCAATGG + Intronic
1157584254 18:48791104-48791126 CTGTGGCTCAGGCCCAGAGAGGG + Intronic
1157600088 18:48888370-48888392 CTGTGAGGCTGGCACAGAGGGGG + Intergenic
1157918958 18:51696663-51696685 CTTTGGGACTGGGCCTGAGAAGG - Intergenic
1159267765 18:66105313-66105335 CTTTGTGTCTGGCCCTTAGGAGG - Intergenic
1160152652 18:76406833-76406855 GTGTGGGTCTGTCTCTGAGAAGG - Intronic
1160338039 18:78060159-78060181 CTGAGGGTCTGGGGCTGAGTGGG - Intergenic
1160797955 19:954392-954414 CTGGGGGTCTTTCCCTGAGGGGG - Intronic
1160896911 19:1407475-1407497 CTGTGCGTGCGTCCCTGAGGCGG - Intergenic
1162418664 19:10553301-10553323 ACGTGAGTCAGGCCCTGAGGGGG - Exonic
1163397992 19:17075434-17075456 CGGCGGGTCGGGCCTTGAGGTGG - Exonic
1163769514 19:19182355-19182377 CTGTGTGCCTGGCCCTGGGCTGG - Intronic
1165111836 19:33507120-33507142 ATGTGGGTATGGCCCTGGGAAGG + Intronic
1166303783 19:41926577-41926599 CCGTGGCTCTGGCCCTGGGTGGG + Intronic
1166351497 19:42200674-42200696 CTCTGGGGCTGGCCCTGCGTAGG - Intronic
1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG + Intronic
1167074649 19:47240923-47240945 CTGGGGGTCTGGGACTGGGGAGG - Intergenic
1167137105 19:47623388-47623410 CTGGGGGTCTGACCCTCATGAGG - Intronic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167385557 19:49160984-49161006 CAGTGGGGCTGTCCCTGAGATGG + Intronic
1167565053 19:50250785-50250807 CTGTTTGTCTGGACCTCAGGAGG - Intronic
1167746830 19:51356586-51356608 CTGTGTGCCTGGCTCTGAGCTGG + Exonic
1167863010 19:52300115-52300137 GGCTGGGTCTGGCCCTGAAGGGG + Intronic
1168013571 19:53554107-53554129 CTGTGTGTTTGGGCCTGAGTAGG + Intronic
1168646670 19:58063424-58063446 CTATGGGTCTCTCCCTGAGCAGG + Exonic
925953396 2:8937205-8937227 CCATGGGGCAGGCCCTGAGGTGG + Intronic
926681153 2:15665160-15665182 CTGGGGGTGCGGCCATGAGGTGG + Intergenic
927636693 2:24821871-24821893 CTGTGAGTCTGACCACGAGGCGG + Exonic
929681558 2:43997343-43997365 CTGTGTGTCTGGCACTGGGTAGG - Intergenic
930373452 2:50534041-50534063 CTGTGGGCCTGGCATTGTGGGGG - Intronic
930533012 2:52613947-52613969 CCTTGGGACTGGGCCTGAGGAGG - Intergenic
932436416 2:71704829-71704851 CTGTGGGCTGGGCCCTGAGACGG - Intergenic
933157598 2:78992819-78992841 CAGTGCCTTTGGCCCTGAGGAGG - Intergenic
934624549 2:95835605-95835627 CTCGGGGTCTGGCCCAGTGGGGG + Intergenic
934660814 2:96142827-96142849 CTGAGGGTGTGGTCCTGTGGGGG - Intergenic
934723928 2:96602753-96602775 CTGTGGGGCTGGTCCTGGGGAGG + Exonic
934809035 2:97265815-97265837 CTCGGGGTCTGGCCCAGTGGGGG - Intergenic
934828470 2:97491354-97491376 CTTGGGGTCTGGCCCAGTGGGGG + Intergenic
935735824 2:106105980-106106002 CTGAGTGTCTGGTGCTGAGGGGG - Intronic
936016229 2:108961154-108961176 CTCTGGGCCTGGCCCTGACTGGG + Intronic
937242344 2:120470450-120470472 CAGTCGGCCTGGCCCGGAGGAGG - Intergenic
937910591 2:127073741-127073763 CTGTTTGTCTGTCACTGAGGTGG - Intronic
939238633 2:139530513-139530535 CTGTTGGTCTGGCACTGTGCAGG + Intergenic
940362683 2:152813257-152813279 CTGTGGCCCTGCTCCTGAGGCGG + Intergenic
944500573 2:200355153-200355175 CAGTGGCTCTGGCATTGAGGGGG - Intronic
946014061 2:216589740-216589762 CTGTGGTTCTGGCTCTCACGGGG - Intergenic
946192259 2:218013752-218013774 CTGGGGGTCTGGCCAGGAGTTGG + Intergenic
948574793 2:238942726-238942748 CTGGGGGTTTGGCCGTGAGCAGG - Intergenic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
1168854054 20:996691-996713 CTGTGGGCCAGGCCCTGGGCTGG - Intronic
1171464548 20:25318464-25318486 CAGGGGGTCTGGACCTCAGGGGG + Intronic
1171849659 20:30299528-30299550 CCTTGGGCCTGGCCCTGTGGAGG - Intergenic
1173126594 20:40342159-40342181 GTGTTGTTCTGGCACTGAGGAGG - Intergenic
1173178977 20:40787438-40787460 CCGCTGGCCTGGCCCTGAGGGGG - Intergenic
1174859640 20:54078633-54078655 CTGTGGTTCTAGAGCTGAGGTGG - Intergenic
1175247018 20:57588460-57588482 CCGTGTCTGTGGCCCTGAGGTGG - Intergenic
1175500000 20:59442991-59443013 TTGTGGATCTGGAGCTGAGGGGG - Intergenic
1176121090 20:63454912-63454934 CTGTGGGCCTGGGTCTGAGGTGG - Intronic
1176409788 21:6442639-6442661 CTGTGTGTCTGGCCTTATGGTGG - Intergenic
1176858116 21:13986853-13986875 CTGTGGCCCTGGCCCTGCCGTGG + Intergenic
1178391047 21:32198634-32198656 GTGAGGGGCTGTCCCTGAGGAGG + Intergenic
1178973431 21:37201225-37201247 CTCAGGATCTGACCCTGAGGTGG + Intronic
1179666595 21:42917043-42917065 CCTTGGGACTGGGCCTGAGGAGG + Intergenic
1179668018 21:42925805-42925827 CGTTGGGACTGGGCCTGAGGAGG + Intergenic
1179685281 21:43050961-43050983 CTGTGTGTCTGGCCTTATGGTGG - Intergenic
1179919327 21:44499108-44499130 CTGTGGGTGGGGCCGTGGGGAGG + Exonic
1180077592 21:45470900-45470922 CCCTGGGTCTGGCCCTGGGCTGG + Intronic
1180140319 21:45889536-45889558 CCGTGGCCCTGGCCATGAGGAGG - Intronic
1181418274 22:22776207-22776229 TTGTGGTTCTGGCCCTGGGTTGG + Intronic
1181780237 22:25187113-25187135 GTGGGGGTCTGCACCTGAGGGGG - Intronic
1182323422 22:29493215-29493237 CTGTGTGCCTGGGCCTGTGGAGG - Intergenic
1182434914 22:30324446-30324468 CTGTAGGGCTGGGGCTGAGGTGG - Intronic
1182552175 22:31106445-31106467 CTGTGGGGCTGGGCCGCAGGTGG - Intronic
1183192864 22:36332832-36332854 CTGTGGGTGGGGCCAGGAGGGGG + Intronic
1183674669 22:39292601-39292623 CTGTGGGCCAGGCCCTGTGCCGG + Intergenic
1183708637 22:39489765-39489787 TTGTAGGTGTGGCCTTGAGGGGG + Exonic
1183780581 22:39996125-39996147 CTGTGTGCCTGGCCCTGTGCTGG + Intronic
1183930661 22:41234309-41234331 CCCTGGGTCTAGCCCAGAGGTGG + Intronic
1184010560 22:41744964-41744986 CTGGAGGCATGGCCCTGAGGTGG - Exonic
1184101986 22:42345555-42345577 CTCTGGATCTAACCCTGAGGGGG - Intergenic
1184147335 22:42619312-42619334 GCCTGGGCCTGGCCCTGAGGCGG + Exonic
1184164515 22:42719939-42719961 CTGAGCCTCTGGCCCTGAGTGGG - Intronic
1184786732 22:46675718-46675740 CTGTGGGTCTGCCCCTGCCCTGG + Intronic
1184907372 22:47497887-47497909 CTGTGGGGCAGGGCCTGAGTGGG + Intergenic
1185076947 22:48688529-48688551 CTGAAGATCTGGCCCTCAGGGGG - Intronic
949837154 3:8281427-8281449 CTGTGGGCCAGGCCTAGAGGTGG - Intergenic
950467177 3:13162400-13162422 CCCTGGGGCTGGCTCTGAGGTGG - Intergenic
950769423 3:15299613-15299635 CTGTGGTCCTAGCCCTTAGGAGG - Intronic
952656489 3:35792590-35792612 CTGTGGGTCTGTCCCTGGTTTGG + Intronic
952966730 3:38625683-38625705 ATGTGTGTCTGGCCCTGAGTGGG + Intronic
953961208 3:47267250-47267272 CTGTTGGTCTCACCCTGAAGAGG + Exonic
954380991 3:50218949-50218971 GTGAGGGTCTGGCCCTGCTGTGG + Intronic
954400110 3:50315051-50315073 CTGTGGGCAGGGCCCTGGGGTGG - Intergenic
954543838 3:51416002-51416024 CTGTGGGTTTGGGCCTGGGTAGG - Intronic
954758599 3:52857474-52857496 CAGTGGCTCTGGCCCTGACTGGG - Intronic
954944495 3:54408010-54408032 CTGTGAATATGGCCCTGAGCTGG + Intronic
956793014 3:72694478-72694500 CTGTGGATGCGGGCCTGAGGCGG - Intergenic
957660973 3:83152844-83152866 GTCTGGTTCTGGCCCAGAGGAGG - Intergenic
959578164 3:107957327-107957349 CTCTGAGTCTGGCCCTGGTGTGG - Intergenic
960719935 3:120616104-120616126 CCTTGGGACTGGGCCTGAGGAGG + Intergenic
961357646 3:126349267-126349289 GAGTGGGTCTGGCCCTGGTGGGG - Intronic
962970678 3:140398977-140398999 CTTCTGGTCTGGCCCTGAAGGGG + Intronic
963001743 3:140688058-140688080 CTGTGGGTCAGGCCTGTAGGTGG - Exonic
964506637 3:157406812-157406834 TTGTAGGTCTGGCACAGAGGAGG + Intronic
967185697 3:186942700-186942722 CTGTGTGCCTGGCCCTGATTAGG + Intronic
967911232 3:194544329-194544351 CTGTGGGTCTGATCCTGACTGGG - Intergenic
968391722 4:198386-198408 CACTGGGTCTGGACCTGAGGGGG - Intergenic
968405266 4:335524-335546 CACTGGGTCTGGACCTGAGGGGG - Intergenic
968518907 4:1027013-1027035 CTGTGGCTCTGGCCCAGCGAGGG - Intergenic
968571885 4:1346551-1346573 CTGTGCGTCTGGCGCCGAGGTGG + Intergenic
968664306 4:1812495-1812517 CCGAGGGTCTGGCCCTGGGCAGG + Exonic
968744606 4:2353185-2353207 CTCTGGGCCTGGCCCTGCTGCGG - Intronic
969036344 4:4256895-4256917 CTGTGGAGCTGGCACTGAGTGGG - Intergenic
969478599 4:7434979-7435001 CTGTGGGAGTGGCCAGGAGGTGG - Intronic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
971740961 4:30520598-30520620 CTGTAGTTCCAGCCCTGAGGTGG + Intergenic
973808818 4:54550519-54550541 CTGAGGGTGTGTCCCTGAGGGGG - Intergenic
975950892 4:79769787-79769809 CAGTGGCTCTGGCCCTGGAGGGG - Intergenic
980091488 4:128447594-128447616 CTGTGGGTCAGAAGCTGAGGGGG + Intergenic
980108842 4:128615212-128615234 CTGTGGGCCTGTCTCTGAGGAGG - Intergenic
983818019 4:172156287-172156309 CCTTGGGGCTGGGCCTGAGGAGG + Intronic
984387290 4:179077329-179077351 CCTTGGGACTGGTCCTGAGGAGG + Intergenic
984854884 4:184186666-184186688 CATTGGGTCTGGCCATTAGGAGG + Intronic
985547856 5:519085-519107 GGGAGGGTCTGGCCCTGAAGGGG - Intronic
985609826 5:881200-881222 CTGAGCGTCTGTCCCTCAGGAGG + Intronic
989003419 5:36784038-36784060 CCTTGGGACTGGGCCTGAGGAGG - Intergenic
989397835 5:40977547-40977569 GTGTGGAGATGGCCCTGAGGAGG + Intronic
989661119 5:43798432-43798454 CTGTGCGGCTGCCCCAGAGGGGG + Intergenic
994748988 5:103715337-103715359 CTGGGGGTCGGGGGCTGAGGGGG + Intergenic
994828428 5:104746259-104746281 CTTTGGGTGAGGCCCAGAGGAGG + Intergenic
994871882 5:105362222-105362244 CTGTGGGCCTGCCACTGGGGAGG - Intergenic
997568111 5:134905018-134905040 CTGCGGGGCTGGCCCGGAGCGGG - Intronic
999265501 5:150264515-150264537 CTGTGGGCCAGGGCCTGAGTTGG + Intronic
999401636 5:151268903-151268925 CTATGGCTTTGGCCCTGTGGAGG - Exonic
999693982 5:154172069-154172091 CTGTGTGCCTGGCACAGAGGTGG + Intronic
1001226481 5:169948796-169948818 CTGAGGAACTGGCCCTGAGTGGG - Intronic
1002050115 5:176565769-176565791 CTGTGGGTCAGGACCTGACATGG - Intronic
1002399135 5:178981503-178981525 CGGTGGGGCTGGCCTTGAGAAGG - Exonic
1002452307 5:179325920-179325942 CGGAGGGTGTGGCCCAGAGGCGG - Intronic
1005198809 6:23319558-23319580 CTGTGTGTCTGGAGCTGAAGGGG + Intergenic
1006373594 6:33659686-33659708 ATGTGGGTGGGGCCCTGTGGAGG - Intronic
1006375354 6:33668779-33668801 CTGTGTGCCTGGCACTGTGGGGG + Intronic
1006424931 6:33958081-33958103 CTGTGGCTATGGCACTCAGGAGG - Intergenic
1006579265 6:35067246-35067268 CTGTGGGGCTGGCCCGGGGGTGG - Intronic
1006749057 6:36365226-36365248 CAGAGGCTCTGGCCCTCAGGAGG + Intronic
1007387972 6:41532146-41532168 CTGTCTGTCTGTCCCTGAGAGGG + Intergenic
1007622640 6:43224258-43224280 TTCTGCCTCTGGCCCTGAGGAGG - Exonic
1007753292 6:44082935-44082957 TTGTGAGCCTGGCCCCGAGGAGG - Intergenic
1008771457 6:54983499-54983521 CCTTGGGACTGGGCCTGAGGAGG + Intergenic
1009950917 6:70394676-70394698 CCTTGGGACTGGGCCTGAGGAGG - Intergenic
1016523032 6:144967965-144967987 CTGTGGGCCAGGCCAGGAGGTGG - Intergenic
1016874556 6:148851909-148851931 CTGAGGGGCTGCCCCTGATGAGG + Intronic
1018343664 6:162879681-162879703 CTGTGGGCCAGGCCCCGAGCTGG + Intronic
1018755871 6:166849436-166849458 CTGTGTGTCTGGCCCTGTGCTGG - Intronic
1018950084 6:168373388-168373410 CTGTGGGTCAGGCTCAGACGTGG + Intergenic
1018991118 6:168675155-168675177 CAGTGGGTCTGGCCCTGCCTTGG + Intergenic
1019060273 6:169252424-169252446 GTGTGGGGCTGGCCCTGCAGAGG + Intronic
1019181208 6:170188188-170188210 CTGCTGGACTGGCCCTGGGGAGG + Intergenic
1019354056 7:569850-569872 CTCGGGGTCTGGCCCTGGGGTGG - Intronic
1019412367 7:911902-911924 CTGTGGGGCTGCCCCTCGGGGGG - Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019537416 7:1536491-1536513 CTGCGTCTCTGGCCCTGGGGTGG + Intronic
1019686127 7:2383321-2383343 CTGTGTGAGGGGCCCTGAGGTGG + Intergenic
1020098508 7:5381387-5381409 GTGTGTGTGTGGCCCAGAGGTGG - Intronic
1021815444 7:24443085-24443107 CTGTGTGTCTGGCCCTCACAAGG + Intergenic
1023965313 7:44960964-44960986 CTGAGGGGCTGGGGCTGAGGGGG + Intergenic
1023983698 7:45083360-45083382 CAGAGGCTCTGGACCTGAGGTGG + Exonic
1024461002 7:49659155-49659177 CACTGGGTCTGGCCCTGGAGAGG + Intergenic
1026903739 7:74051127-74051149 CTAGTGGTCTGACCCTGAGGTGG - Intronic
1029309936 7:99653711-99653733 CTGTGGGGCTGACCCTGGTGTGG - Intronic
1029576319 7:101405887-101405909 CTGTGGGGCTGGCTCTCAGGTGG + Intronic
1030207511 7:106965392-106965414 ATATGAGTCTGTCCCTGAGGAGG - Intergenic
1030636449 7:111954536-111954558 CCTTGGGACTGGGCCTGAGGAGG - Intronic
1031454737 7:121965172-121965194 CTGTGGGTCAGGAGCTGAGGAGG + Intronic
1034276674 7:149826822-149826844 GTGAGGGCCTGGCCCTGGGGTGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034413299 7:150952424-150952446 CTTCGGCTCTGGCTCTGAGGAGG - Exonic
1034680817 7:152925950-152925972 CTGTGGGGCTGCCCGGGAGGGGG - Intergenic
1035286236 7:157809217-157809239 CTGTGACTCTGGCCCTGGAGGGG + Intronic
1035286271 7:157809350-157809372 CTGTGACTCTGGCCCTGGAGGGG + Intronic
1037810838 8:22086130-22086152 CTGGGCCTCAGGCCCTGAGGAGG - Intergenic
1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG + Exonic
1038429863 8:27491335-27491357 CAGTGGGTCGGGGCCTCAGGAGG + Intronic
1039941610 8:42096261-42096283 TGGTGGATCTGGCCATGAGGAGG - Intergenic
1040618776 8:49065956-49065978 CTCTGGTACTAGCCCTGAGGTGG + Intronic
1042157650 8:65863285-65863307 CCTTGGGACTGGGCCTGAGGAGG - Intergenic
1042158683 8:65870133-65870155 CCTTGGGACTGGGCCTGAGGAGG - Intergenic
1043768742 8:84169870-84169892 CCTTGGGACTGGGCCTGAGGAGG + Intergenic
1043856721 8:85273521-85273543 CCTTGGGACTGGGCCTGAGGAGG - Intronic
1043857422 8:85277933-85277955 CCTTGGGACTGGGCCTGAGGAGG + Intronic
1049799388 8:144510723-144510745 GTGAGGGGCTGGCCTTGAGGAGG + Intronic
1053268387 9:36732699-36732721 TTGTGGGTCTGGCCCCGACAAGG + Intergenic
1053787437 9:41662822-41662844 CCTTGGGCCTGGCCCTGTGGAGG - Intergenic
1054157689 9:61651945-61651967 CCTTGGGCCTGGCCCTGTGGAGG + Intergenic
1054175713 9:61874161-61874183 CCTTGGGCCTGGCCCTGTGGAGG - Intergenic
1054477463 9:65582950-65582972 CCTTGGGCCTGGCCCTGTGGAGG + Intergenic
1054661826 9:67706649-67706671 CCTTGGGCCTGGCCCTGTGGAGG + Intergenic
1054837911 9:69699366-69699388 CTGTGGGGCTGGCCTGGTGGTGG + Intergenic
1056764357 9:89435774-89435796 CTGTGGGCGTGGCCCTGGGAGGG - Intronic
1057227419 9:93299692-93299714 CTGGGAGTTTGGCCTTGAGGAGG + Intronic
1057903504 9:98967204-98967226 CTGTGAAACTGGCCCTGGGGTGG + Intronic
1058286852 9:103189284-103189306 CCTTGGGACTGGGCCTGAGGAGG + Intergenic
1058835072 9:108853466-108853488 CTGTGGGTCAGGCCCAGTGCTGG - Intergenic
1059383615 9:113947508-113947530 CTGTGTGTCAGGCCCTGTGCAGG - Intronic
1059386775 9:113970902-113970924 CTGTGGGCCTGGCCCCTAGCAGG + Intronic
1060002337 9:119969792-119969814 CTGTGAGCCTGGCCCTGTGCCGG - Intergenic
1061856699 9:133445454-133445476 CTGTGGGCCTGGCCGAGAGCTGG - Intronic
1061866858 9:133496749-133496771 CTGGGGGTCTGGCCCCGAAATGG + Intergenic
1062250005 9:135589098-135589120 CTGGGGGTGTGGCCGTGATGGGG + Intergenic
1062424412 9:136499409-136499431 CCATGGGGCTGCCCCTGAGGAGG + Intronic
1062673029 9:137722934-137722956 CTGTGGTTCTGGGCCTGAGCCGG + Intronic
1062673055 9:137723045-137723067 CTGTGGTTCTGGGCCTGAGCCGG + Intronic
1062737061 9:138143421-138143443 CTCTGGGTGTGGACCTCAGGAGG + Intergenic
1187286267 X:17906813-17906835 CTATGGGTCAGGCCCGGAGGTGG - Intergenic
1187311335 X:18146263-18146285 GTGTGGGTCAGGCCATGAAGTGG - Intergenic
1187413838 X:19074987-19075009 CTGTGGGTATGGGCCTAATGAGG + Intronic
1187414462 X:19081223-19081245 CTGTGGGTGTGGGGGTGAGGTGG - Intronic
1190229569 X:48571756-48571778 ATATGGGTCTGTCTCTGAGGTGG - Intergenic
1190726852 X:53195467-53195489 CTCTGTGCCTGGCCCTGAGCTGG + Intronic
1196466524 X:115977438-115977460 CAGTTGGTGTGGCCCTGTGGTGG + Intergenic
1197514619 X:127410845-127410867 CTGTGGGCCTGGGCCAGTGGTGG - Intergenic
1199559288 X:149146177-149146199 CTTGGGGTCAGGCCCTGGGGTGG + Intergenic
1199870262 X:151892150-151892172 CTCTGGGTCAGGTCCTGTGGAGG - Intergenic
1200122045 X:153795670-153795692 CTCTGGGTCTGGACCACAGGAGG - Intronic
1200399248 X:156009682-156009704 CTCTGGGTGTGGACCTCAGGAGG + Intronic
1201763356 Y:17560609-17560631 TTGTGTGTCTCGCCCTCAGGGGG + Intergenic
1201838197 Y:18345381-18345403 TTGTGTGTCTCGCCCTCAGGGGG - Intergenic