ID: 1167366412

View in Genome Browser
Species Human (GRCh38)
Location 19:49057093-49057115
Sequence GGCGGTGCCGAGCGAGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 269}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167366398_1167366412 26 Left 1167366398 19:49057044-49057066 CCAGCCCAGGGGCTCGGCGTGCA 0: 2
1: 0
2: 1
3: 15
4: 144
Right 1167366412 19:49057093-49057115 GGCGGTGCCGAGCGAGAGCCCGG 0: 2
1: 0
2: 1
3: 17
4: 269
1167366407_1167366412 3 Left 1167366407 19:49057067-49057089 CCGGCCATGGCGGGGGCTGTGCA 0: 1
1: 1
2: 2
3: 19
4: 199
Right 1167366412 19:49057093-49057115 GGCGGTGCCGAGCGAGAGCCCGG 0: 2
1: 0
2: 1
3: 17
4: 269
1167366401_1167366412 21 Left 1167366401 19:49057049-49057071 CCAGGGGCTCGGCGTGCACCGGC 0: 2
1: 0
2: 0
3: 8
4: 151
Right 1167366412 19:49057093-49057115 GGCGGTGCCGAGCGAGAGCCCGG 0: 2
1: 0
2: 1
3: 17
4: 269
1167366399_1167366412 22 Left 1167366399 19:49057048-49057070 CCCAGGGGCTCGGCGTGCACCGG 0: 2
1: 0
2: 0
3: 6
4: 75
Right 1167366412 19:49057093-49057115 GGCGGTGCCGAGCGAGAGCCCGG 0: 2
1: 0
2: 1
3: 17
4: 269
1167366409_1167366412 -1 Left 1167366409 19:49057071-49057093 CCATGGCGGGGGCTGTGCAGGAG 0: 1
1: 1
2: 2
3: 35
4: 337
Right 1167366412 19:49057093-49057115 GGCGGTGCCGAGCGAGAGCCCGG 0: 2
1: 0
2: 1
3: 17
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167366412 Original CRISPR GGCGGTGCCGAGCGAGAGCC CGG Intronic