ID: 1167370998

View in Genome Browser
Species Human (GRCh38)
Location 19:49081944-49081966
Sequence GATCGAACAGCAGGGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167370998_1167371006 14 Left 1167370998 19:49081944-49081966 CCCTGCATCCCTGCTGTTCGATC No data
Right 1167371006 19:49081981-49082003 ACAGGGTCCCAAGTACAGCTTGG No data
1167370998_1167371002 -4 Left 1167370998 19:49081944-49081966 CCCTGCATCCCTGCTGTTCGATC No data
Right 1167371002 19:49081963-49081985 GATCACCAGCCATGACACACAGG No data
1167370998_1167371007 15 Left 1167370998 19:49081944-49081966 CCCTGCATCCCTGCTGTTCGATC No data
Right 1167371007 19:49081982-49082004 CAGGGTCCCAAGTACAGCTTGGG No data
1167370998_1167371010 30 Left 1167370998 19:49081944-49081966 CCCTGCATCCCTGCTGTTCGATC No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167370998_1167371003 -3 Left 1167370998 19:49081944-49081966 CCCTGCATCCCTGCTGTTCGATC No data
Right 1167371003 19:49081964-49081986 ATCACCAGCCATGACACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167370998 Original CRISPR GATCGAACAGCAGGGATGCA GGG (reversed) Intergenic
No off target data available for this crispr