ID: 1167370999

View in Genome Browser
Species Human (GRCh38)
Location 19:49081945-49081967
Sequence TGATCGAACAGCAGGGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167370999_1167371002 -5 Left 1167370999 19:49081945-49081967 CCTGCATCCCTGCTGTTCGATCA No data
Right 1167371002 19:49081963-49081985 GATCACCAGCCATGACACACAGG No data
1167370999_1167371010 29 Left 1167370999 19:49081945-49081967 CCTGCATCCCTGCTGTTCGATCA No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167370999_1167371003 -4 Left 1167370999 19:49081945-49081967 CCTGCATCCCTGCTGTTCGATCA No data
Right 1167371003 19:49081964-49081986 ATCACCAGCCATGACACACAGGG No data
1167370999_1167371006 13 Left 1167370999 19:49081945-49081967 CCTGCATCCCTGCTGTTCGATCA No data
Right 1167371006 19:49081981-49082003 ACAGGGTCCCAAGTACAGCTTGG No data
1167370999_1167371007 14 Left 1167370999 19:49081945-49081967 CCTGCATCCCTGCTGTTCGATCA No data
Right 1167371007 19:49081982-49082004 CAGGGTCCCAAGTACAGCTTGGG No data
1167370999_1167371011 30 Left 1167370999 19:49081945-49081967 CCTGCATCCCTGCTGTTCGATCA No data
Right 1167371011 19:49081998-49082020 GCTTGGGCCACCACTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167370999 Original CRISPR TGATCGAACAGCAGGGATGC AGG (reversed) Intergenic
No off target data available for this crispr