ID: 1167371000

View in Genome Browser
Species Human (GRCh38)
Location 19:49081952-49081974
Sequence TGGCTGGTGATCGAACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167371000_1167371006 6 Left 1167371000 19:49081952-49081974 CCCTGCTGTTCGATCACCAGCCA No data
Right 1167371006 19:49081981-49082003 ACAGGGTCCCAAGTACAGCTTGG No data
1167371000_1167371010 22 Left 1167371000 19:49081952-49081974 CCCTGCTGTTCGATCACCAGCCA No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167371000_1167371011 23 Left 1167371000 19:49081952-49081974 CCCTGCTGTTCGATCACCAGCCA No data
Right 1167371011 19:49081998-49082020 GCTTGGGCCACCACTCCAGAGGG No data
1167371000_1167371007 7 Left 1167371000 19:49081952-49081974 CCCTGCTGTTCGATCACCAGCCA No data
Right 1167371007 19:49081982-49082004 CAGGGTCCCAAGTACAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167371000 Original CRISPR TGGCTGGTGATCGAACAGCA GGG (reversed) Intergenic
No off target data available for this crispr