ID: 1167371001

View in Genome Browser
Species Human (GRCh38)
Location 19:49081953-49081975
Sequence ATGGCTGGTGATCGAACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167371001_1167371011 22 Left 1167371001 19:49081953-49081975 CCTGCTGTTCGATCACCAGCCAT No data
Right 1167371011 19:49081998-49082020 GCTTGGGCCACCACTCCAGAGGG No data
1167371001_1167371007 6 Left 1167371001 19:49081953-49081975 CCTGCTGTTCGATCACCAGCCAT No data
Right 1167371007 19:49081982-49082004 CAGGGTCCCAAGTACAGCTTGGG No data
1167371001_1167371010 21 Left 1167371001 19:49081953-49081975 CCTGCTGTTCGATCACCAGCCAT No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167371001_1167371006 5 Left 1167371001 19:49081953-49081975 CCTGCTGTTCGATCACCAGCCAT No data
Right 1167371006 19:49081981-49082003 ACAGGGTCCCAAGTACAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167371001 Original CRISPR ATGGCTGGTGATCGAACAGC AGG (reversed) Intergenic
No off target data available for this crispr