ID: 1167371004

View in Genome Browser
Species Human (GRCh38)
Location 19:49081968-49081990
Sequence GGGACCCTGTGTGTCATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167371004_1167371015 26 Left 1167371004 19:49081968-49081990 CCAGCCATGACACACAGGGTCCC No data
Right 1167371015 19:49082017-49082039 AGGGTGCAAGCCATAAACTTTGG No data
1167371004_1167371010 6 Left 1167371004 19:49081968-49081990 CCAGCCATGACACACAGGGTCCC No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167371004_1167371007 -9 Left 1167371004 19:49081968-49081990 CCAGCCATGACACACAGGGTCCC No data
Right 1167371007 19:49081982-49082004 CAGGGTCCCAAGTACAGCTTGGG No data
1167371004_1167371006 -10 Left 1167371004 19:49081968-49081990 CCAGCCATGACACACAGGGTCCC No data
Right 1167371006 19:49081981-49082003 ACAGGGTCCCAAGTACAGCTTGG No data
1167371004_1167371011 7 Left 1167371004 19:49081968-49081990 CCAGCCATGACACACAGGGTCCC No data
Right 1167371011 19:49081998-49082020 GCTTGGGCCACCACTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167371004 Original CRISPR GGGACCCTGTGTGTCATGGC TGG (reversed) Intergenic
No off target data available for this crispr