ID: 1167371005

View in Genome Browser
Species Human (GRCh38)
Location 19:49081972-49081994
Sequence ACTTGGGACCCTGTGTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167371005_1167371015 22 Left 1167371005 19:49081972-49081994 CCATGACACACAGGGTCCCAAGT No data
Right 1167371015 19:49082017-49082039 AGGGTGCAAGCCATAAACTTTGG No data
1167371005_1167371010 2 Left 1167371005 19:49081972-49081994 CCATGACACACAGGGTCCCAAGT No data
Right 1167371010 19:49081997-49082019 AGCTTGGGCCACCACTCCAGAGG No data
1167371005_1167371011 3 Left 1167371005 19:49081972-49081994 CCATGACACACAGGGTCCCAAGT No data
Right 1167371011 19:49081998-49082020 GCTTGGGCCACCACTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167371005 Original CRISPR ACTTGGGACCCTGTGTGTCA TGG (reversed) Intergenic
No off target data available for this crispr